Diagnosis and Clinical Management ofSchistosoma haematobium–Schistosoma bovisHybrid Infection in a Cluster of Travelers Returning From Mali

Introduction The increasing use of molecular techniques in ecological studies has revealed many cases of hybridization and introgression in plants and animals [1]–[3], but examples in metazoan parasites are rare [2]. Hybridization can have a major impact on adaptive radiation and diversification of the species under study [2],[4], and in the case of parasites, this may also have an impact on the host and the epidemiology of disease. The acquisition of new genes may generate new phenotypes that might differ in virulence, resistance, pathology, and host use, ultimately leading to the emergence of new diseases. Schistosomiasis is a disease of medical and veterinary importance in tropical and subtropical regions, caused by parasitic flatworms of the genus Schistosoma (subclass Digenea). Over 200 million people are infected, of which 85% live in Africa. Chronic infection may lead to severe liver, intestinal and bladder complications, sometimes leading to death. Schistosoma species have a two-host life cycle with an asexual stage within an intermediate freshwater snail host and a sexual stage within the definitive mammalian host; parasite eggs are voided in the urine or faeces depending on the species. Schistosomes are highly unusual trematodes as they are dioecious, which creates an opportunity for interplay between male and female parasites in the vasculature system of the definitive mammalian host. Several crossing experiments have been carried out in controlled laboratory settings especially between species belonging to the Schistosoma haematobium group (e.g. [5]–[7]). Depending on the phylogenetic distance between the two species involved, crossing may lead to parthenogenesis or hybridization, with certain combinations being more viable than others. Experimental hybrids tend to show heterosis: they have a higher fecundity, faster maturation time, higher infectivity, and wider intermediate host spectrum compared to their parental species (e.g. [7],[8]). In nature, the distribution of schistosome species and their intermediate snail hosts, together with definitive host specificity are believed to restrict these hybridization events from occurring. However, both natural (climate change) and anthropogenic changes (migration, deforestation, water development) can break down the ecological isolation barriers by facilitating the introduction of parasite species and strains into new areas, resulting in novel host-parasite and parasite – parasite interactions. For example, deforestation of the tropical rainforest in Loum (Cameroun) led to the establishment of the snail B. truncatus, the intermediate host of S. haematobium. Shortly after, the parasite S. haematobium became established. The epidemiology of schistosomiasis changed dramatically: prevalences and infection intensities increased and a complete switch from intestinal schistosomiasis (S. guineenis) transmitted by B. forskalii to urinary schistosomiasis (S. haematobium and the hybrid S. haematobium×guineenis) was observed [9],[10]. The extent of hybridization only became clear after the application of molecular genetic markers including SSCP and sequence analysis [11]. Other examples of hybridization events that came to light through molecular studies include the hybridization of a primarily human parasite, S. mansoni and a rodent parasite S. rodhaini in western Kenya [12],[13]. In this example, hybrid cercariae have been recorded from naturally infected Biomphalaria snails, but transmission of these hybrids into humans has not been detected. Because of their inaccessibility in the human mesenteric system, it is very difficult to obtain adult schistosome worms. Traditionally, schistosome infections were identified by egg morphology, site of infection and snail compatibility studies but these methods are not sufficiently sensitive and interactions between species can be missed. Laboratory passage of natural miracidia into adult worms enabled the development of molecular techniques but this labour-intensive technique has a low success rate and leads to artificial selection of specific parasite genotypes [14]. The recent development of a storage protocol for larval schistosomes on Whatman FTA® Cards [15] together with new molecular markers have provided tools to genotype individual miracidia and cercariae sampled directly from the field. The initial project aim was to perform a large molecular genotyping study of human schistosomes in northern Senegal to study the population structure and transmission dynamics of Schistosoma species. The habitats found in the Senegal River Basin (SRB) have changed dramatically over the last 30 years due to the construction of the Diama Dam, intended to prevent salt-water intrusion from the sea facilitating rice and sugar cane agriculture, and the Manantali Dam in Mali, constructed for hydroelectricity and regulation of water flow. The subsequent ecological changes (e.g pH and salinity) together with increased irrigation created new aquatic habitats, which allowed the prolific spread of Biomphalaria pfeifferi, the intermediate host of S. mansoni, and various species of Bulinus responsible for transmitting S. haematobium and S. bovis. This resulted initially in a major outbreak of human intestinal schistosomiasis (S. mansoni) [16],[17] followed by subsequent dynamic changes in the prevelance of both urinary (S. haematobium) and intestinal schistosomiasis (Polman, unpublished data). Several areas of sympatry between these schistosomes now exist, and many children can be found with both urinary and intestinal schistosomiasis. It is likely that the prevalence of the bovine schistosomes, especially S. bovis, has also increased, but this has not been documented. Both the laboratories of the Natural History Museum and the Institute of Tropical Medicine involved in the studies discovered independently the occurrence of schistosome miracidia from children with a S. bovis mitochondrial genetic profile. In 1970, Taylor demonstrated the successful experimental hybridization of S. haematobium and S. bovis while Brémond et al. [18] found schistosome species in Niger with allozyme profiles that were intermediate between S. bovis and S. haematobium or S. curassoni, but more sensitive markers were needed to discriminate S. haematobium from S. curassoni. In this study we use molecular sequencing tools to provide conclusive evidence of the hybridization of S. haematobium and S. bovis in nature, with hybrid offspring infecting children in northern Senegal. This study provides a first glimpse at the intricacies between a human and a cattle schistosome species and our data are discussed in relation to implications for schistosomiasis epidemiology and control. Results Nuclear and mt DNA genotyping Sequence identification cox1 mtDNA (545 bp) – Pairwise distance analysis of all the sequence data (pure species, hybrids and the reference taxa) showed that there was 12% sequence divergence separating S. haematobium and S. bovis. The genetic distance between S. bovis and S. curassoni and between S. bovis and S. mansoni was 6% and 21% respectively (Table 1). No sequence variation was found within the S. haematobium sequences. 0.3% sequence divergence was found within the S. bovis sequences. Sequences of the most prevalent hybrids found in the urine and stool samples contained 3 point mutations compared to the sequences from the pure S. bovis cercariae. None of the hybrid sequences were identified as being S. mansoni or S. curassoni (Table 1). 10.1371/journal.ppat.1000571.t001 Table 1 Uncorrected pair-wise distances between the cox1 mtDNA sequences of the reference and hybrid schistosomes. 1 2 3 4 5 6 1. S. haematobium - - - - - - 2. S. bovis 0.118 - - - - - 3. S. bovis cox1 hybrid* 0.114 0.006 - - - 4. S. haematobium cox1 hybrid** 0 0.118 0.114 - - 5. S. curassoni 0.118 0.061 0.063 0.118 - - 6. S. mansoni 0.176 0.206 0.202 0.176 0.214 - Hybrids with the genetic profile: *cox1 S. bovis+ITS rRNA S. haematobium; **cox1 S. haematobium+ITS rRNA S. haematobium/S. bovis. ITS nuclear rRNA (927 bp) – S. haematobium and S. bovis differed at 5 point mutations in all specimens examined. No intra-specific variation was detected within all the ITS sequences, with the exception of hybrids 2 and 3 (Table 2). These showed additive chromatogram profiles at the polymorphic positions between the reference S. bovis and S. haematobium sequences, with the larger peak representing the S. haematobium genotype and the smaller detected peak representing the S. bovis genotype (peak difference less than 20%). 10.1371/journal.ppat.1000571.t002 Table 2 Data for the natural S. haematobium x S. bovis hybrids in northern Senegal. Location Stage From No. sequenced‡ No. hybrids Sequence identification cox1 ITS rRNA Nder Miracidia Urine 5 1 S. bovis S. haematobium Nder Miracidia Urine 5 2 S. bovis S. haematobium Nder Miracidia Urine 5 2 S. bovis S. haematobium Nder Miracidia Urine 5 2 S. bovis S. haematobium Nder Miracidia Urine 5 1 S. bovis S. haematobium Nder Miracidia Stool 5 1 S. haematobium S. haematobium+S.bovis peaks* Nder Cercariae B. globosus 49 1 S. haematobium S. haematobium+S.bovis peaks* Mbane Cercariae B. truncatus 13 4 S. bovis S. haematobium Mbane Eggs Stool• 16 3 S. bovis S. haematobium Mbane Miracidia Urine 11 2 S. bovis S. haematobium Mbane Eggs Stool 5 1 S. bovis S. haematobium Mbane Eggs Stool 1 1 S. bovis S. haematobium Gaya Eggs Stool• 4 2 S. bovis S. haematobium Thiekenne Eggs Stool 15 3 S. bovis S. haematobium Thiekenne Miracidia Urine 11 3 S. bovis S. haematobium Thiekenne Miracidia Urine 4 1 S. bovis S. haematobium Mbodjenne Eggs Stool 5 1 S. bovis S. haematobium Tiguet Eggs Stool• 5 1 S. bovis S. haematobium * At the polymorphic positions between the S. haematobium and S. bovis sequences two significant chromatogram peaks are seen. The higher one matching S. haematobium and the lower one matching S. bovis (peak heights differing less than 20%). • Pooled samples from a number of children. All other samples are from individual children. ‡ The number of individual larval stages sequenced per patient or snail infected with hybrids. Eggs and miracidia The majority of eggs and miracidia collected from the human stool and urine samples were identified as S. mansoni and S. haematobium. However, 15% of the sequenced eggs or miracidia presented a genotype suggesting a hybrid origin. Most of these had an ITS rRNA fragment that was identical to S. haematobium and a partial cox1 mtDNA fragment which was identified as S. bovis. A single miracidium (hybrid 2, Table 2) sampled from one of the human stool samples from Nder had a different composition: the cox1 fragment was identical to cox1 from S. haematobium and the ITS rRNA sequence showed double chromatogram peaks as described above. Hybrid eggs and miracidia were found in the urines and stools of 8 and 7 children respectively, in 6 different villages around Lac de Guiers and along the Lower Valley of the Senegal River Basin (Table 2). Cercariae from snails Cercariae from naturally infected intermediate snail hosts presented pure S. haematobium genotypes from B. globosus and pure S. bovis genotypes from B. truncatus. Both snail species were also found shedding cercariae that displayed the hybrid genetic profiles. One out of three infected B. truncatus snails collected in Mbane and one B. truncatus from Rhenne were shedding hybrid cercariae presenting an ITS sequence identical to S. haematobium and a cox1 sequence identified as S. bovis. In Nder, a single cercaria (hybrid 3, Table 2) isolated from B. globosus had a cox1 sequence identical to S. haematobium and an ITS sequence identified as both S. haematobium and S. bovis with double chromatogram peaks as described above. Egg morphology It was not possible to record egg morphology in the field but some limited data are available for samples from Thiekenne. Atypical and intermediate shaped eggs were found in both a pooled stool sample from 6 individual children and a stool sample from a single child. Apart from the expected lateral spined S. mansoni eggs three types of terminal spined eggs were observed: the typical S. bovis type (length ∼202 µm), the typical S. haematobium type (length ∼144 µm) and (variations of) the slender intermediate form between S. haematobium and S. bovis (length ∼174 µm), suggested to be hybrid eggs [5]. Co-infections within the definitive host All but one of the fifteen patients that were infected with hybrids were also infected with S. mansoni (median 18 epg) and S. haematobium (median 93,5 eggs/10 ml). Several children were found to be passing S. haematobium shaped eggs in their stool samples and this could indicate inter-specific mating between S. mansoni males and S. haematobium females. However most eggs appeared viable and could reflect hybridization between S. haematobium and S. bovis. Discussion Here we present conclusive evidence for the natural hybridization between the cattle parasite S. bovis and the human parasite S. haematobium. The hybrid species are able to infect humans, and they use the intermediate snail hosts of both parental species, B. globosus and B. truncatus. Our data imply that one or both of these parental schistosome species has managed to infect the definitive host of its sister species through host switching, enabling these schistosomes to interact. Back-crossing of the hybrid progeny with one of the parental species resulted in the observed introgression. Two hybrid lines have been found, resulting from bidirectional introgressive hybridization. The first line is the most prevalent one resulting from an initial cross between a male S. haematobium and a female S. bovis, leading to introgression of S. bovis mtDNA into S. haematobium. This proves that these F1 hybrids are fertile and able to reproduce. The observation of hybrid egg shapes also suggests the occurrence of further generation hybrids and or back-crossing. These data together with the few mutations in the cox1 fragment compared to the pure S. bovis sequence, indicate that this hybridization goes beyond the 1st generation, suggesting a stable ‘hybrid zone’. This is also supported by the occurrence of this hybrid over a wide geographical range, in villages separated from each other by 5–200 kilometer and located near different water resources (different tributaries of the SRB, and Lac de Guiers, see Figure 1). The other hybrid line (resulting from a cross between a male S. bovis with a female S. haematobium) is much less frequent and is most likely a first generation hybrid as suggested by the double peaks in the nuclear rRNA ITS sequences. F1 hybrids usually display both parental nuclear ITS copies, resulting in additive chromatograms [19],[20]. Biased homogenization towards one of the parental sequences can already occur in F2 hybrids or backcross generations due to concerted evolution operating in the ribosomal arrays [21] or to asymmetrical backcrossing [20]. As such, this cross might be less viable and less successful than the reverse cross. Laboratory experiments have shown that hybridization between schistosomes can be unidirectional, due to competition between males, or due to genomic incompatibility like hybrid breakdown. Taylor [5] showed that experimental crossing between male S. haematobium worms and female S. bovis worms readily occurred resulting in viable hybrid offspring but he did not test the reverse cross nor backcrosses. 10.1371/journal.ppat.1000571.g001 Figure 1 Map of the study area in northern Senegal indicating the villages where Schistosoma haematobium x S. bovis hybrids have been observed (see Table 2). Hybridization and introgression Ecological barriers between species can be lost due to both natural and anthropogenic changes. Deforestation of the tropical rainforest in Loum led to the establishment of S. haematobium followed by introgressive hybridization and competitive exclusion of the endemic S. guineensis [9],[22]. In this particular study, the habitat of the Senegal River Basin has changed dramatically over the last 30 years due to the construction of the Diama and Manantali Dams in Senegal and Mali respectively. These dams prevented salt-water intrusion from the sea and stabilized the flow, facilitating new forms of agriculture. This was followed by human population movements to these resources, increased migration of livestock and snails, creating areas for close associations between humans and domestic livestock facilitating interplay between the schistosomes they carry. In Nder and Thiekenne for example, transmission sites were found where both human and cattle contaminate the water (Figure 2) and where B. truncatus and B. globosus occur sympatrically. These snail species have very similar diurnal cercarial shedding patterns, potentially facilitating the infection of single definitive hosts with both parasite species [23],[24]. 10.1371/journal.ppat.1000571.g002 Figure 2 Transmission site in Mbane, Senegal. Hybrid parasites were recovered from snails (Bulinus truncatus) collected at this habitat. Host switching and animal reservoirs The hybridization between S. bovis and S. haematobium is of special interest as S. bovis is a parasite primarily of ruminants and S. haematobium a parasite almost exclusively of man. As our findings were discovered during human parasitological surveys we have, as yet, no data from schistosome infections in local cattle, therefore we cannot speculate on whether S. haematobium or the hybrid can infect cattle. So, in which host is this initial hybridization occurring? A few studies reported S. bovis shaped eggs excreted by man [25]–[27], but it was suggested that this could be due to S. bovis eggs passing through the digestive tract of humans eating infected cow livers. Putative S. haematobium infections have been documented in primates, rodents and artiodactyls [28],[29]. The identification of these infections has relied heavily on egg morphology alone, thus it is possible that hybrids or other morphological similar species were involved. The infectivity of a schistosome to a mammalian host depends on the ability of the cercariae to locate the host, penetrate the skin and evade the host's immune system. The phylogeny of the Schistosoma genus does not show a single origin of human host use suggesting that host switching may have occurred at several time points in schistosome evolution [30]. Phylogenetically, S. haematobium is ancestral to S. bovis [30] and the ability to infect humans may have been retained by S. bovis. Also, as human skin is thinner than the skin of a bovine, it is perhaps more feasible that S. bovis cercariae could penetrate a human rather than S. haematobium managing to infect cows. The exact circumstances facilitating hybridization in either cattle or people need to be determined but immunological factors and co-infections with other pathogens will undoubtedly have a role to play. Another possibility is that the initial pairing between these two schistosome species occurred in a non-human mammalian host that can readily be infected by both species, such as rodents. Rodents are routinely used in laboratories to passage schistosome species, so they are likely to be susceptible in the wild too. However, Duplantier and Sene [31] studied 2000 animals belonging to six different rodent species collected in and around Richard Toll (Senegal) and found only S. mansoni in two rodent species (Arvicanthis niloticus and Mastomys huberti, prevalence of about 5%). Therefore, rodents are unlikely to be involved in this hybridization event, but they might be ideal reservoirs for hybridization between S. mansoni and S. rodhaini [13]. The role of sheep and goats found in the area does also need to be considered. Neglecting the role of animal reservoirs in transmission might contribute to failure of Schistosoma control programmes, as is the case with S. japonicum in Asia that infects humans, livestock, rodents and other animals [32],[33]. At the level of the intermediate snail host, the hybrid increased its host range compared to the parental species. Earlier work has shown that B. truncatus from the Lower and Middle Valley of the SRB is not susceptible to a S. haematobium strain isolated from the Lower Valley, but it is however susceptible to a S. haematobium strain isolated from Mali [34], suggesting a strong role for parasite genetics in this host-parasite relationship. The authors also found that natural transmission of S. haematobium in the Lower Valley is normally associated with B. globosus. In this study we found B. truncatus from Mbane and Rhenne (Lower Valley of the SRB) also to be infected with the hybrid species. It appears therefore that hybridization between S. haematobium and S. bovis is facilitating this breakdown of intermediate snail specificity. This has important implications for the epidemiology of schistosomiasis in northern Senegal because B. truncatus became widespread after dam constructions in the early nineties It seems likely that hybridization may well lead to increased transmission intensities in the Senegal River Basin. Given the small sample size of infected snails in this study, additional screening of cercariae is needed to clarify the exact role of each snail species in parasite transmission. Distribution Our data show that the observed hybridization is not a rare isolated phenomenon, hybrids are being found in human populations located near different tributaries of the SRB, and around Lac de Guiers separated by 5–200 km. In 2004, Sene and colleagues [35] described S. haematobium from Bulinus truncatus collected in Nguidjilone, but our re-inspection of the molecular cox1 data shows that the genetic profiles are in fact identical to the hybrids found in this present study. Nguidjilone is situated in the Middle Valley of the SRB, more than 600 kilometer further east from our study area. Suggestions for natural interactions between S. haematobium and S. bovis were made by Brémond and colleagues [18] who found intermediate egg shapes and intermediate allozyme phenotypes between S. bovis and S. haematobium or S. curassoni collected from children in Niger. Although the allozyme profiles strongly suggested a hybrid origin, the exact role of S. curassoni could not be established as the allozyme markers could not discriminate between S. haematobium and S. curassoni. The authors suggested that S. curassoni could also be involved, through initial hybridization with S. bovis. Indeed hybridization between S. bovis and S. curassoni has been reported in Senegal [36] but this study does not find any proof of S. curassoni involvement. In either case, this and the above data suggest that hybridization between S. haematobium and S. bovis is successful in other areas too and that it has been taking place for some time. This ease of hybridization as suggested by the field data and by the experimental work of Taylor [5], together with the fact that hybrid parasites can infect the very abundant B. truncatus, suggest this interaction may lead to increased transmission in these areas. This, together with the high intensities that can be reached, indicates the need for further screening and experimental studies (see below). Implications Our findings are of utmost importance due to the possible implications that it bears on the disease dynamics and control strategies for these parasites. The acquisition of new genes through introgressive hybridization can lead to phenotypic innovation that can profoundly influence the evolution of disease. Pitchford and Lewis [37] suggested that the poor response of the cattle parasite S. mattheei to oxamniquine treatment might have been due to hybridization with S. haematobium, which is not susceptible to the drug. Hybrids between S. haematobium and S. intercalatum [7],[38] and S. haematobium and S. mattheei [8] acquired an enhanced infectivity to their laboratory hosts, with increased growth rates and reproductive potential. The natural hybridization of S. haematobium and S. guineensis in Cameroon had important consequences on the disease dynamics causing severe disease outbreaks in certain areas [9],[10]. If this new hybrid in Senegal exhibits the same hybrid vigour, it can develop into a new emerging pathogen, necessitating new control strategies in zones where both parental species overlap. Given the increased intermediate host range of the hybrid parasite, an intense and rapid control response is required to minimize further spread of the hybrid and possible escalation of human schistosomiasis. The recent increase in urinary schistosomiasis in the villages along the SRB could be a direct effect of hybrid vigour and/or the use of two abundant snail hosts. The way forward To fully understand the consequences of the introgressive hybridization between these two schistosome species further studies are needed. The recent history of S. haematobium and S. mansoni transmission in northern Senegal is relatively well documented but very little is known about the epidemiology, host use and geographical distribution of S. bovis. A study by Diaw et al. [39] reported a sharp increase in bovine schistosomiasis in the lower valley of the SRB, and the appearance of new infection foci from 1989–1990 onwards. It is important to establish the role of cattle, sheep and other possible mammalian reservoir hosts in these hybridization events through genotyping adult worms and larval stages from these possible reservoirs, and also to determine how each snail species is involved in transmission in these foci. This information together with the screening of other localities will provide further insights into the dynamics and the extent of this hybridization. Experimental infections are needed to study the mating behaviour of S. bovis and S. haematobium and to study the biological characteristics of the hybrid lines such as fecundity, infectivity, longevity, cercarial production and response to praziquantel, the drug used to treat and control schistosomiasis. If it is not as effective in the hybrid, this can result in more pathology and morbidity. Genetic introgression is likely to occur in areas of the genome involved in schistosome biology such as virulence, transmission, host specificity and disease processes. When carefully chosen, microsatellite genotyping can provide a genome-wide view of the level of introgression while direct sequencing of targeted gene regions involved in schistosome biology could provide information for potential drug targets and genes involved in isolating mechanisms, speciation and evolution of the Schistosoma genus. Materials and Methods Ethics statement This study is part of a larger investigation of schistosomiasis epidemiology, transmission and control in Senegal, for which approval was obtained from the ethical committees of the Ministry of Health in Dakar, Senegal, the Institute of Tropical Medicine in Antwerp, Belgium, and the NHS-LREC of Imperial College London, England. According to common practice, all parents and teachers gave oral consent for urine and stool examination and the data were analyzed anonymously. All schistosomiasis positive children were treated with a single dose of praziquantel, at 40 mg/kg of bodyweight. In schools or classes where the percentage of S. haematobium or S. mansoni infections were more than 50%, mass treatment of all children was carried out at the end of the study. Parasite collection Parasitological surveys were carried out in March 2006 and 2007 in six villages within the Senegal River Basin (SRB) separated by about 10 to 150 miles; Tiguet and Gaya along the Senegal River, Mbodjenne on the Lampsar River and Mbane, Thiekenne, Nder on the shores of the Lac de Guier (see Figure 1, 2). To detect the prevalence of urinary and intestinal schistosomiasis, urine and stool samples were taken from 75 school age children per village, with the exception of Nder where 200 children were involved. For S. haematobium detection, 10 mls of each urine sample was filtered using a Nucleopore filter, eggs were viewed and counted under a microscope. Eggs from positive samples were hatched by sedimentation and subsequent exposure to clean water and light. S. mansoni infections were diagnosed by duplicate 41.7 mg Kato Katz for each stool sample. Eggs from positive samples were hatched by homogenising each sample with 0.85% saline solution and then passing it through a metal sieve of 212 µm pore size to remove any larger debris. The remaining aqueous solution containing the eggs was then passed through a home-made Pitchford and Visser funnel [40] and washed copiously with bottled mineral water. The eggs were then concentrated within the Pitchford and Visser funnel and placed in a petri dish where they were exposed to clean water and light. Using a binocular microscope individual miracidia and un-hatched eggs were collected using a Gilson pipette. Where possible egg morphology was recorded by description but no photographs could be taken. S. mansoni eggs have a characteristic lateral spine where as S. bovis and S. haematobium have terminal spines with species specific body shape. Un-hatched eggs were given a further opportunity to hatch by pippetting them into a dish containing fresh water before they were subsequently collected. All samples were individually pipetted onto Whatman FTA® indicator cards in a volume of 3 µl of water and the cards were allowed to dry for 1 hour. Snails caught at the transmission sites were placed into pots containing clean water and exposed to light to stimulate them to shed. Individual cercariae were loaded onto Whatman FTA® indicator cards as described above and the species of snail was identified using morphological characters and recorded. DNA analysis of the FTA samples was carried out at the Natural History Museum in London (Nder material) and the Katholieke Universiteit of Leuven (all other material). FTA DNA extraction A 2.0 mm disc was removed with a Harris Micro Punch from the Whatman FTA® indicator cards at the centre of where the sample was loaded and purified according the manufacturers protocol. Samples were air dried at 56°C for 30 –60 mins. Individual discs were used directly in the multiplex PCR. Primary detection of hybrids This study initially started as routine analysis of S. haematobium and S. mansoni populations using the partial cox1 mtDNA marker with the same PCR primers and conditions as described below. Both the NHM and KUL laboratories involved in the studies discovered unusual cox1 sequences from several eggs and miracidia collected from both urine and stool samples identified as S. bovis. The standard Whatman FTA® indicator cards used in our sampling enable the collection and preservation of large numbers of individual larval schistosome stages under field conditions. However, one drawback is that the FTA punch can only be used once, in a single PCR. Therefore, to detect the hybrids, the nuclear ITS rRNA+cox1 mitochondrial (mt) DNA multiplex PCR was developed for simultaneous amplification of both DNA regions from an individual larval stage (i.e. a single FTA disc). Multiplex PCR and sequencing at the KUL The complete ITS rRNA (981 bp)+partial cox1 mtDNA (585 bp) multiplex PCR amplifications were performed in a total reaction volume of 25 µl and consisted of 1× PCR buffer (Eurogentec), 1.5 mM MgCl2 (Eurogentec), 200 µM of each dNTP (Amersham Pharmacia Biotech, Sweden), 1 µM of each primer (Eurogentec; Asmit1 TTTTTTGGTCATCCTGAGGTGTAT [41] and Schisto 3′ TAATGCATMGGAAA-AAAACA [42], ITS4: TCCTCCGCTTATTGATATGC and ITS5: GGAAGTAAAAGTCGTAACAAG [43], 1 unit Taq polymerase (Eurogentec), milli-Q water and the individual purified FTA disc. PCR parameters were 3 min at 96°C followed by 40 cycles of 30 sec at 95°C, 30 sec at 54°C and 1 min at 72°C, followed by a final cycle at 72°C for 7 min. The PCR products were visualized on a 1.5% ethidium bromide agarose gel, gel extracted and purified by means of GFX columns according to the manufacturer's instructions (Amersham Pharmacia). The purified products were sequenced using a Big Dye Chemistry Cycle Sequencing Kit (version 1.1) in a 3130 DNA Analyzer (Applied Biosystems), using the original PCR primers. Multiplex PCR and sequencing at NHM The complete ITS rRNA (981 bp)+partial cox1 mtDNA (585 bp) multiplex PCR amplifications were performed in a total reaction volume of 25 µl using Ready-to-go PCR Beads (Amersham Pharmacia Biotech) each containing 1.5units DNA Taq Polymerase, 10 mM Tris-HCl (pH 9), 50 mM KCl, 1.5 mM MgCl2, 200 µM of each dNTP and stabilizers including BSA, 10 pmol of each primer (cox1 primers as above) and ITS primers - ITSF: TAACAAGGTTTCCGTAGGTGAA, ITSR: TGCTTAAGTTCAGCGGGT [44] and the individual purified FTA disc. Thermal cycling was performed in a Perkin Elmer 9600 Thermal Cycler and the PCR conditions used were: 5 min denaturing at 95°C: 40 cycles of 30 sec at 95°C, 30 sec at 40°C, 1 min at 72°C; followed by final extension period of 7 min at 72°C. 25 µl of each amplicon were run out on 1.5% Ethidium bromide agarose gel until good separation of the ITS and cox1 bands could be seen using the UVP system. Each ITS and cox1 band was gel extracted and purified using Qiagen PCR gel extraction Kits (Qiagen) according to the manufacturer's protocol. Each band was sequenced with the original PCR primers using a Fluorescent Dye Terminator Sequencing Kit (Applied Biosystems) and the sequencing reactions were run on an Applied Biosystems 377 automated sequencer. The sequences were assembled and manually edited using Sequencher ver 4.5 (GeneCodes Corp.). Identity of the sequence was confirmed using the Basic Local Alignment Search Tool (BLAST) and by comparison with reference alignments. At the polymorphic positions of the ITS between S. haematobium and S. bovis any occurrence of double chromatogram peaks was recorded to identify mixed ITS sequences. Sequences are submitted to Genbank under Ac. Nos. FJ588850-62. Reference samples/Controls (NHM) Genomic DNA from schistosomes from Senegal stored in the NHM liquid nitrogen collection was extracted using the DNeasy extraction kit (Qiagen). S. haematobium from Guede Chantier, S. mansoni from Richard Toll, S. bovis from St. Louis and S. curassoni from Guede Chantier were used. S. curassoni was included to rule out any possible involvement in our findings. The cox1 and ITS sequences were amplified from the reference samples as described above and these sequences were used as templates to identify and compare the samples in this study. The pair-wise uncorrected distances between the cox1 sequences were calculated using MEGA 4.1 [45].

Introduction In recent years, developments in molecular tools and their use in epidemiological studies have revealed several cases of hybridization and introgression in plants and animals [1]–[8], although there are very few examples from metazoan parasites [7]–[8]. Hybridization can have a major impact on species diversification and adaptive radiation [9]–[12]. With regard to parasites and pathogens, this may have a crucial impact on disease epidemiology and evolution, affecting factors such as virulence, drug efficacy and response to control, and host range, potentially ultimately leading, in certain cases, to the evolution of new species of pathogens [13]–[14]. Schistosomiasis is a parasitic disease of considerable medical and veterinary importance throughout tropical and subtropical regions, caused by dioecious digeneans of the genus Schistosoma. Schistosomes infect more than 207 million people worldwide (the majority of whom are in sub-Saharan Africa) and cause chronic diseases that can lead to severe liver, intestinal and bladder pathology and death [15]. Schistosomiasis is also a disease affecting domestic livestock such as cattle, sheep and goats throughout Africa, the Middle East, Asia, and some countries bordering the Mediterranean Sea. Indeed it has been estimated that over 165 million cattle are infected worldwide with chronic infections resulting in hemorrhagic enteritis, anemia, emaciation and death [16]. Schistosomes have a two-host life cycle with an asexual stage occurring in an intermediate freshwater snail and a sexual stage within the definitive mammalian host from which eggs are voided in the urine or faeces of the infected individual, depending on the schistosome species involved. The sexual stage of these dioecious parasites enables interactions between male and female worms within their definitive hosts, while the asexual stage within the aquatic intermediate snail host gives rise to clonal larvae facilitating exposure and potential infection of any mammal in contact with the water. Most Schistosoma species are host specific and geographically separated, which helps to maintain species barriers however, given the opportunity, heterospecific crosses between species can occur and have been demonstrated in controlled laboratory experiments [17]–[20]. Heterospecific crosses can lead to either parthenogenesis or hybridization depending on the phylogenetic distance of the species involved. Hybridization, with the production of generations of viable offspring, will result from heterospecific crosses between closely related species and viable hybrids have been observed experimentally to exhibit several enhanced phenotypic characteristics such as higher fecundity, faster maturation time, higher infectivity, increased pathology and the ability to infect both intermediate snail hosts of the parental species, thereby widening their intermediate host spectrum [19]–[20]. Whilst in nature host specificity and distribution may have restricted the potential for hybridization between schistosomes, natural and anthropogenic environmental changes, accompanied by host migration, introduction and/or radiation, can all serve to alter the distribution of schistosome species. This can result in novel interactions between schistosomes and host and also between different schistosome species infecting the same host. For example, dam construction and irrigation may be expected to give rise to changes in agricultural practice and create new habitats for intermediate snail hosts, bringing humans into even greater contact with their livestock, and hence the parasites of these animals, certain species of which can successfully hybridize with human schistosome species. Due to the inaccessibility of schistosome adult worms within their hosts, detecting natural interactions and hybridization between schistosome species, especially in humans, can be highly problematic. Past studies have speculated on such events using morphological characteristics such as egg shape, infection site and snail compatibility, although this can be misleading [19]–[26]. Recent developments in the ability to store and genetically analyze individual schistosome larval stages directly from their natural hosts have, nevertheless, proved revolutionary in detecting natural hybridization events [27]–[33]. Accordingly, studies incorporating such molecular analysis of the parasites have proved that interactions and hybridization between schistosome species does occur in nature with varying epidemiological outcomes [19], [34]–[37]. In particular, a preliminary study reported on the bidirectional hybridization between a cattle schistosome, S. bovis, and a human schistosome, S. haematobium, in several villages along the Senegal River Basin in Northern Senegal [32]. Hybrid larval stages were found in human urine and stool samples and also transmitted through both the intermediate snail hosts (Bulinus truncatus and B. globosus respectively) of the parental species. This hybridization was hypothesized to have been able to occur due to the ecological and climatic changes that have taken place in these areas over the last 30 years facilitating the creation of areas of sympatry between these schistosome species and their hosts. Whilst this study provided the first conclusive evidence for the natural hybridization between these two species, it also inspired a number of further related questions such as: what is the occurrence, host use and distribution of these hybrids in Senegal and elsewhere. Additionally, in Senegal, there exists another schistosome species within the S. haematobium group, S. curassoni, which infects sheep, goats and cattle and is very closely related to both S. bovis and S. haematobium, potentially enabling all three species to interact if given the opportunity [38]–[41]. The definitive host range of S. curassoni and S. bovis does overlap, so it may be predicted that these two species also natural hybridize in areas of sympatry. Indeed an earlier report by Rollinson and colleagues [41], provided initial field and experimental evidence, based on isoenzyme data, for the hybridization between these two species in Senegal and Mali. There has also been some speculation about the potential involvement of S. curassoni infecting or interacting with S. haematobium in humans in Niger [42], although there was no conclusive evidence to support this as more sensitive molecular markers were needed to discriminate between S. haematobium and S. curassoni [41]–[44]. In the current study we use molecular sequencing tools and a multi-locus approach to provide novel data on the occurrence, interactions and host use of all three schistosome species and their natural hybrids at four foci across Senegal. In particular we aimed to confirm the presence of S. curassoni or hybrids thereof in children living in areas where S. curassoni occurs in ruminants and where transmission is likely to occur. We also aimed to elucidate the role of domestic livestock in the transmission and possible hybridization of the human schistosome S. haematobium and to provide data on the frequency and viability of the hybridization between, and also the transmission of, S. haematobium, S. bovis and S. curassoni at the specific field study sites. These data are discussed in relation to the implications for the transmission and control of schistosomiasis in Senegal and other neigbouring West African countries, where all three schistosome species may be occurring and interacting. Materials and Methods Parasite collection Parasitological surveys of domestic livestock and children were carried out in March 2009 and 2010 in four areas across Senegal; the Senegal River Basin (SRB) in the North, Vallée du Ferlo which is central, Tambacounda in the South East and Kolda in the South. (Figure 1). These sites were specifically selected as they were known foci for human and livestock schistosomiasis (personal communication). As these were mainly pilot surveys aimed to positively identify the different Schistosoma species and any hybrids infecting livestock and children in each area only human urine samples and animal intestines were sampled. 10.1371/journal.pntd.0002110.g001 Figure 1 Map showing the location of the survey sites across Senegal. The survey sties are numbered in red. GPS coordinates: 1. Richard Toll = 16°27′40.71″N, 15°41′15.29″W, 2. Nder = 16°15′33.50″N, 15°53′2.13″W, 3. Linguiere = 15°23′34.33″N, 15°6′55.87″W, 4. Barkedji =  =  15°16′38.46″N, 14°51′55.48″W, 5. Tambacounda = 13°46′8.00″N, 13°40′2.00″W, 6. Kolda = 12°53′58.27″N, 14°56′39.37″W. The regions of Senegal are also shown on the map. Collection of schistosome miracidia from children To detect the presence and prevalence of urinary schistosomiasis, urine samples were collected from school-aged children in each area (refer to Table S1 for details). Schools and villages where children were suspected by the local health workers to have urinary schistosomiasis, were selected to take part in the study. Positive urine samples from each child were first identified using haemastix and by visual inspection to detect the presence of blood. Eggs from positive samples were hatched by sedimentation and subsequent exposure to clean water and light. Using a stereomicroscope individual miracidia were harvested and stored in RNAlater as described by Webster [33]. Schistosome collection from domestic livestock In each abattoir, intestines were randomly obtained from individual animals routinely slaughtered as part of the daily work of the abattoir. The mesenteric veins around the small and large intestines of individual cows, sheep or goats that had been slaughtered were visually inspected for the presence of schistosome worms. Any worms found were dissected from the veins and stored as individual pairs or individual single worms in ethanol. The number of worms dissected from each animal and the animal species was recorded. From some of the highly infected animals, a small piece of the liver was taken, macerated, and passed through a 212 µm sieve with 0.85% saline and any schistosome eggs present in the samples concentrated using a Pitchford funnel [45]. The eggs were then released into a clean Petri dish and exposed to fresh water and light to facilitate hatching. Individual miracidia were stored in RNAlater as above. Genomic DNA (gDNA) extraction gDNA from individual miracidia was extracted as described in Webster [33]. Individual worm pairs were washed in TE buffer to remove any residual ethanol and allowed time to relax in the TE buffer so that they could be separated. The male and female worm from each pair was recorded. gDNA from individual worms was extracted using the DNeasy blood and tissue kit (Qiagen) according the manufacture's protocol and DNA was eluted in a total of 100 µl. To enable high throughput processing of the samples the majority of the gDNA extractions were carried out using the DNeasy blood and tissue kit 96 well plate spin protocol (Qiagen) according the manufacturer's protocol and DNA was eluted in a total of 100 µl. Molecular hybrid detection Hybrid detection of schistosomes requires a multi-locus approach, analyzing both mitochondrial and nuclear DNA simultaneously from individual specimens [32]. A partial region of the mitochondrial cox1 gene and the complete ITS1+2 rDNA were analyzed from each individual as described below. Mitochondrial (mt) cox1 amplification and analysis To identify individual miracidia and worms with S. haematobium, S. bovis or S. curassoni mtDNA, the cox1 rapid diagnostic multiplex PCR (RD-PCR) was carried out for each individual sample as described by Webster and colleagues [46]. 4 µ1 of each RD-PCR was visualised on a 2% gel-red agarose gel. Any miracidium that was collected from the human urine samples that did not present a clear S. haematobium RD-PCR profile was selected for sequencing and those that did present a clear S. haematobium profile were recorded as having S. haematobium mtDNA. In addition, a selection of these miracidia (4 from each urine sample) was also sequenced to confirm the mtDNA identity. Where there was a mixture of S. bovis and S. curassoni RD-PCR profiles from the individual worms all RD-PCR products were sequenced to confirm the mtDNA identity. All RD-PCR's were run in conjunction with +ve and −ve reactions. Nuclear ITS1+2 rDNA amplification The complete ITS1+2 rDNA (981 bp) was amplified from each individual specimen in 25 µ1reactions containing 2 µ1 of each gDNA extract, Illustra PuReTaq Ready-To-Go PCR Beads (GE Healthcare) and 10 pmol of each forward and reverse primer [32]. Thermal cycling was performed in a Perkin Elmer 9600 Thermal Cycler and the PCR conditions used were: 5 min denaturing at 95°C: 40 cycles of 30 sec at 95°C, 30 sec at 40°C, 1 min at 72°C; followed by a final extension period of 7 min at 72°C. 4 µl of each PCR reaction was visualised on a 0.8% gel-red agarose gel to confirm amplification success. All PCR's were run in conjunction with +ve and −ve reactions. Sequencing and analysis Selected RD-PCR's and all positive ITS PCR reactions were purified using the Qiaquick 96 PCR purification Kit (Qiagen) according to the manufacturer's protocol. Both the forward and reverse strands of the purified amplicons were sequenced using a dilution of the original PCR primers and a Fluorescent Dye Terminator Sequencing Kit (Applied Biosystems), the sequencing reactions were run on an Applied Biosystems 377 automated sequencer. For the RD-PCR amplicons, the primer used for the reverse sequencing reaction corresponded with the diagnostic profile of the amplicon. The sequences were assembled and manually edited using Sequencher V.4.5 (GeneCodes Corp.). Identity of the sequence was confirmed using the Basic Local Alignment Search Tool (BLAST) and comparison to the reference sequences (see below). At the polymorphic positions of the ITS1+2 between S. haematobium, S. bovis and S. curassoni, any occurrence of double chromatogram peaks was recorded to identify mixed ITS sequences. The species identity of the mt and nuclear DNA for each individual specimen was recorded (Tables S1+S2). Reference sequences The cox1 and ITS reference sequences of S. haematobium, S. bovis and S. curassoni from Huyse and colleagues [32], were used to identify and compare the sequences from the samples in this study. Crosses of S. haematobium, S. bovis and S. curassoni in laboratory animals During the collection of the parasite material at the sampling sites, eggs were also collected to establish laboratory isolates of S. haematobium, S. bovis and S. curassoni. Group 1: S. curassoni A small liver sample was taken from a cow (C1, Table S2) from Tambacounda and processed for miracidial collection. After an hour of hatching a few miracidia had hatched and were seen swimming around the Petri dish. In view of the low numbers and slowness of the hatching, eight laboratory bred Bulinus wrighti were added to the Petri dish and left for approximately 12 hours to facilitate snail infection. Group 2: S. bovis A small liver sample was taken from a cow (C4, Table S2) from Kolda and processed for miracidial hatching. The eggs hatched well and 12 laboratory bred Bulinus wrighti were exposed to five miracidia each. Group 3: S. haematobium Miracidia hatched from the urine sample collected from a child ID (32, Table S1) from Nder school in the Senegal River basin were used to infect 24 laboratory bred Bulinus wrighti. The snails were individually exposed to five miracidia each. Snail shedding and molecular species identification The snails were maintained in their groups in the NHM schistosome culture facility and at 4–6 weeks post exposure each group was exposed to light to facilitate cercarial shedding. At the time of the snail infections, the species identity of the miracidia used had not been confirmed so 20 individual cercariae from each group of snails were harvested for molecular identification. Individual cercariae were captured in 2–3 µl of water and pipetted into individual Eppendorf tubes. gDNA was immediately extracted from each individual cercaria using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer's protocol, but with the modifications to the protocol as described in Webster [33]. The mt cox1 and nuclear ITS DNA were analysed and identified from each individual cercaria using the same methodology as described earlier. Species crosses in laboratory animals The remaining cercariae from each group of snails were used to infect two laboratory mice or two laboratory hamsters (see Table 1) by the paddling technique [17]. The snails were then set up to shed cercariae again every other day and the same animals were exposed to the cercariae from a different group of snails, so that each of the animals had been exposed to a combination of cercariae from two of the different groups of snails (see Table 1). If necessary, animals were repeatedly exposed to cercariae shed from the snails on different days so that they had been exposed to approximately 100 cercariae from each of the 2 snail groups to which they had been initially exposed. Ten weeks post exposure, animals were culled and all the worms were perfused and dissected from the animals. Each individual worm pair was put into a separate pot in 0.85% saline and allowed to separate. gDNA was directly extracted from each individual worm and the mt cox1 and nuclear ITS DNA were analysed and identified as described earlier. The molecular identity of each male and female worm in each pair was recorded. From each animal the liver was processed for miracidial hatching [17] and 96 miracidia were harvested individually from each animal cross for molecular identification. Each miracidia was captured individually in 2–3 µl of water and pipetted into a single well of a 96 well PCR plate. gDNA was extracted from each individual miracidium as described in Webster [33]. The mt cox1 and nuclear ITS DNA were analysed and identified from each individual miracidium using the same methodology as previously described. 10.1371/journal.pntd.0002110.t001 Table 1 Experimental laboratory animal infections. Animal cross (No. of animals) 1st infection 2nd infection Homospecific worm pairs (no.) No. of homospecific miracidia (no.) Heterospecific worm pairs (no) Hybrid miracidia** Snail Group Cercariae sp. Snail Group Cercariae sp. ITS profile mt cox1 profile No. 1 (2 Mice) 1 S. c 2 S. b S. b M X S. b F (14) 18 S. b M X S. c F (15) S. c/S. b S. c 15 S. c M X S. c F (41) 51 S. c M X S. b F (17) S. b/S. c S. b 12 2 (2 Hamsters*) 2 S. b 3 S. h S. b M X S. b F (11) 83 S. h M X S. b F (3) S. h/S. b S. b 5 S. h M X S. h F (4) 4 S. b M X S. h F (2) S. b/S. h S. h 4 3 (2 Hamsters*) 3 S. h 1 S. c S. c M X S. c F (56) 77 S. h M X S. c F (7) S. h/S. c S. c 3 S. h M X S. h F (24) 12 S. c M X S. h F (8) S. c/S. h S. h 4 * Hamsters were used as S. haematobium does not develop well in mice. ** Genetic profiles and number of hybrid miracidia resulting from the heterospecific crosses. In total 96 miracidia from each animal cross were genetically analysed. S. c = S. curassoni, S. b = S. bovis, S. h = S. haematobium, M = male and F = female. Ethics statement Ethical approval for these studies was obtained from the Imperial College Research Ethics Committee (ICREC), Imperial College London and the Ministry of Health Dakar, Senegal. Before conducting the study, the MoH-approved plan of action had been presented and adopted by regional and local administrative and health authorities. Meetings were held in each village to inform the village leader, heads of the families, local health authority, teachers, parents and children about the study, its purpose and to invite them to participate voluntarily. According to common practice and with approval from the Imperial College Research Ethics Committee (ICREC), due to low levels of literacy all village leaders, teachers, parents and study participants gave oral consent for the studies to take place. Informed consent for the urine examinations was obtained from each study participant and their parents or guardians. Oral consent for each participant was documented by inscription at school committees comprising of parents, teachers and community leaders. All the data were analysed anonymously and all schistosomiasis positive participants were treated with PZQ (40 mg/kg). In schools or classes where the percentages of infections were more than 50%, mass treatment of all children was carried out at the end of the study. Laboratory animal use was within a designated facility regulated under the terms of the UK Animals (Scientific Procedures) Act, 1986, complying with all requirements therein, including an internal ethical review process at the NHM and regular independent Home Office inspection. Work was carried out under the Home Office project license number 70/6834. Results Adult schistosome worms and miracidia collected during parasitological surveys across Senegal of domestic livestock and children at four transmission foci, identified as potential hybrid zones, were identified by nuclear and mitochondrial (mt) DNA genotyping. The numbers of S. haematobium, S. bovis, S. curassoni or hybrids thereof from each host were recorded. The viability of the interactions between S. haematobium, S. bovis and S. curassoni were also investigated during inter-species crossing experiments in laboratory rodents. Nuclear and mtDNA genotyping ITS1+2 nuclear rDNA In the reference sequences and all the specimens examined S. haematobium differed from S. bovis and S. curassoni at five point mutations and S. curassoni differed from S. bovis at one point mutation. No intra-specific variation was detected in all the ITS sequences, however, in some of the hybrid miracidia double chromatogram profiles were observed at the polymorphic positions between the two species involved in the hybridization. The peak height that represented each species varied, with some hybrids having a higher peak for one species than the other and some hybrids having equal peak heights for both species. cox1 mtDNA Considerable genetic distance separates the cox1 mtDNA of S. haematobium, S. bovis and S. curassoni and this is therefore a good molecular tool for mtDNA identification for these three species [32]. The diagnostic cox1 RD-PCR [46] proved robust for distinguishing worms and larval stages with S. haematobium mtDNA from those that had S. bovis and S. curassoni mtDNA, with all the individuals that produced a S. haematobium cox1 RD-PCR profile, that were sequenced, having a S. haematobium cox1 mtDNA sequence. The diagnostic cox1 RD-PCR varied in its robustness to distinguish between worms and larval stages with S. bovis and S. curassoni mtDNA and hence all the individuals that presented a S. bovis or a double-banded (both the S. haematobium and S. bovis diagnostic bands present [46]) cox1 RD-PCR profile were sequenced. All individuals that presented a double-banded cox1 RD-PCR profile had a cox1 mtDNA sequence that was identified as S. curassoni. The majority of individuals that presented a S. bovis RD-PCR cox1 profile had a cox1 mtDNA sequence that was identified as S. bovis, however, a few had a cox1 mtDNA sequence that was identified as S. curassoni. Human parasitological surveys The prevalence of human urogenital schistosomiasis was high in all areas sampled, ranging from 57–100%, and visible haematuria was obvious in urines samples from all study areas. A total of 823 individual miracidia were collected and genetically analysed from 52 urine samples. 79% of the miracidia were molecularly identified as pure S. haematobium, however, 21% presented a mixed mt cox1 + nuclear ITS genotype suggesting that these miracidia had a hybrid origin. Hybrid miracidia were found in 88% of the urine samples analysed and in all areas surveyed. The numbers and type of hybrids varied between urine samples and areas (Table S1). Hybrids between S. bovis and S. haematobium were found in children from all areas except Barkedji in the Vallée du Ferlo and hybrids between S. curassoni and S. haematobium were only isolated in Tambacounda and the Vallée du Ferlo. Domestic livestock parasitological surveys In total, 1004 schistosome worms (502 pairs) were dissected and genetically analysed from the mesenteric vessels of 33 animal intestines and 109 miracidia were hatched and analysed from three infected liver samples (Table S2). Only S. bovis was found in animals from Kolda and Richard Toll but S. bovis and S. curassoni were found in animals from Tambacounda and the Vallée du Ferlo. The number of worm pairs found in each individual animal varied considerably from 1 to over 100. S. bovis/S. curassoni hybrid worms with different genetic profiles were found in small numbers in the intestines of five animals from Tambacounda and all these hybrids were paired with either S. bovis or S. curassoni worms. No worms with pure or hybrid S. haematobium genetic profiles were found in any domestic animal. Inter-species crosses in laboratory rodents All three species were successfully isolated from the field samples and maintained in laboratory Bulinus wrighti snails. The molecular ITS and cox1 identification of the cercariae resulting from the three groups of laboratory snail infections showed that each group was infected with one species (Group 1 S. curassoni, Group 2 S. bovis and Group 3 S. haematobium). No hybrid profiles were observed in these isolates. The mixed species infections in all the laboratory rodents (animal crosses 1–3, Table 1) produced heterospecific pairs between male and female worms of all three species (Table 1) and also homospecific pairs. The numbers of pairs varied between animals with the most abundant heterospecific parings occurring between S. bovis and S. curassoni worms. Miracidia were hatched from the infected livers of animals with mixed infections. Molecular typing of these miracidia detected hybrid offspring (Table 1) and confirmed viable heterospecific pairings between all three species. Homospecific miracidia of each species were also identified. The numbers of each type of miracidia correlated to the number of homospecific or heterospecific worm pairs present. Discussion When humans and their livestock start to frequent the same water bodies, due to environmental and/or behavioural changes, novel zoonotic hybrid schistosomes could evolve with subsequent changes in the parasite's life history traits, transmission potential and virulence. Here, through incorporating both field and laboratory experimental data, we provide both additional and novel molecular evidence for the natural hybridization between three Schistosoma species in Senegal: S. haematobium a parasite of humans, S. bovis and S. curassoni which both parasitize primarily domestic livestock. The data from different areas of Senegal demonstrate that these hybridisation events are not rare and so, understanding such inter-species interactions will be essential for predicting the outcomes of current and future control programmes in hybrid zones. Hybridization and introgression Children were found excreting S. haematobium/S. curassoni hybrids in Tambacounda and the Vallée du Ferlo and S. haematobium/S. bovis hybrids in Tambacounda, Kolda and the SRB. A low number of S. bovis and S. curassoni hybrid worms were found in cows slaughtered in the Tambacounda abattoir but no S. haematobium worms or hybrids thereof were found in ruminants, however this could be due to the fact that only the intestines of the animals were sampled. . These data do suggest that at some point host switching has been able to take place between these three sister species enabling the two species involved to interact, hybridize and produce viable offspring. The laboratory mixed infection experiments further indicate that males and females of each species readily pair and produce viable hybrid offspring and in these experimental crosses there does not appear to be any competition, exclusion or mating preference between the species and each cross produced viable hybrid offspring. In each of the three types of hybrids two hybrid lines were observed, resulting from bidirectional introgressive hybridization with mtDNA from both the parental species introgressing into the other species involved in the hybridization (see Table S1+S2). Regarding the nuclear DNA profiles, initial hybrid generations usually display both parental nuclear rDNA ITS copies, resulting in double chromatogram peaks at the species-specific mutation sites [32], [47]–[49]. In subsequent hybrid generations or backcrossing of hybrids with parental species, biased homogenisation towards one of the parental species may result in nuclear rDNA ITS sequences that can appear as just one species or the other [49]. As the dynamics of this homogenisation and silencing of the genetic signal from one species over the other is unknown it is impossible to decipher which generation the natural hybrids are from by looking at their genetic profiles. Nevertheless, the observation of both pure and mixed nuclear rDNA ITS sequences within our hybrid populations strongly suggest that there are different generations of hybrids and/or hybrid backcrosses persisting in nature. Host switching in the definitive hosts and animal reservoirs of infection The hybridization of S. bovis and S. curassoni with S. haematobium is of particular interest, as for this to occur, host switching must have taken place of either, S. bovis and S. curassoni into humans or S. haematobium into domestic livestock. The oviposition site of a schistosome pair is generally assumed to primarily be dependent on the species of the male worm [37], [43], with S. bovis and S. curassoni males carrying their females to the intestinal tract and S. haematobium males carrying their females to the urinary tract. It is unknown how hybridization will affect this phenotypic/behavioural characteristic, however it would be expected that in the initial parental cross the worm pair would migrate to the oviposition site determined by the species of the male worm. Hybrid miracidia analysed from the human urine samples that present S. curassoni cox1 and mixed ITS sequences or S. bovis cox1 and mixed ITS sequences could be first generation hybrids resulting from pure parental crosses between S. haematobium males and S. curassoni or S. bovis females, however, it is also possible that second generation hybrids or hybrid backcrosses could also present these genetic profiles. It would be expected that first generation hybrids of the reciprocal cross (S. haematobium females paired with males of S. bovis or S. curassoni) would be excreted in stool samples, therefore miracidia from any eggs present in stool samples also need to be analysed to identify further hybrids and also any possible homospecific infections of S. bovis and or S. curassoni in humans. No S. haematobium/S. bovis or S. haematobium/S. curassoni hybrids or S. haematobium worms were found in the domestic livestock, possibly suggesting that S. haematobium and indeed S. haematobium hybrids may lack the ability to penetrate and or develop in ruminants. It is also necessary to consider whether major differences in the vasculature between ruminants and humans would restrict the migration of S. haematobium to the blood vessels of the bladder of ruminants. However, as only the intestinal tracts of the slaughtered animals were routinely available for inspection at the abattoirs, and as S. haematobium is a parasite of the urinary tract, the presence of S. haematobium or the hybrids may have been missed. A much earlier study in Zambia did report the possible finding of S. haematobium/S. mattheei (another closely related ruminant schistosome) hybrids in the mesenteric veins of cattle [50] however these findings remain unconfirmed. It is clear that more extensive and detailed dissections off and egg collections from the ruminants is warranted. The infectivity of a schistosome to a mammalian host depends on several physical and immunological factors, however, the variety of host use by different species of the Schistosoma genus suggests that host switching has occurred at several time points in the evolution on this genus [38]. It is possible that the close phylogenetic ancestral position of S. haematobium to its sister species S. curassoni and S. bovis, together with physical and anatomical host differences may enable the latter two species to retain an ability to infect humans. Another possibility is that the initial pairing between these human and domestic livestock parasites occurred first in another susceptible host, such as a rodent. Rodents have proved extremely efficient for passaging a variety of schistosome species in the laboratory [17] and are utilised as reservoir hosts by other species of schistosome [51]–[54]. The hybridization between S. curassoni/S. bovis is not that surprising given their neighbouring phylogenetic position and their overlap in definitive host associations [38] and the molecular data presented here conclusively confirm that these parasites are able to hybridize. Distribution and prevalence Observations from the different survey sites clearly demonstrate the focality of the transmission of the different species and their hybrids. Hybridization between the human and domestic livestock schistosomes appears common with hybrid genetic profiles recovered from human urine samples from several areas where the different species are transmitted sympatrically. Also, S. haematobium/S. bovis hybrids have previously been sampled from humans from several widely dispersed villages along the SRB [32], and the possibility of the hybridization between S. haematobium/S. bovis or S. curassoni was reported by [42] in Niger. Due to the wide distribution of the intermediate snail hosts B. globosus and B. truncatus, S. haematobium and S. bovis are common infections across much of Senegal, providing the opportunity for these species to interact, however the distribution of S. curassoni, transmitted through B. umbilicatus, is more restricted. The data presented here confirm an intense S. curassoni focus in the Vallée du Ferlo, increasing the known distribution of this species and the hybrids thereof. S. haematobium/S. curassoni hybrids were found in the urines of children sampled from the village of Barkedji, where only S. curassoni was found in the slaughtered sheep. This, together with the data from Tambacounda, provides the first confirmation of this species or hybrids thereof infecting children in Senegal. Only small numbers of S. curassoni/S. bovis hybrids were found in cattle at Tambacounda abattoir, with most worms being identified as S. curassoni in agreement with an earlier report [41]. There are no obvious isolating barriers other than intermediate snail host preferences that prevent S. curassoni and S. bovis from interacting and hybridizing as both species readily infect ruminants. However, transmission of these two species does appear to be localised, with the majority of the animals sampled in one particular place being infected with either S. bovis or S. curassoni. The origins of the animals sampled at the small abattoirs in this study are usually unknown and would be almost impossible to trace due to changes of ownership during an animal's lifetime. The worm burden reflects past exposure: S. bovis transmission being associated with B. truncatus habitats while S. curassoni is associated with B. umbilicatus [54]. With regard to the role of intermediate snail hosts, hybridization between Schistosoma species potentially enables the schistosomes to increase their host range with the hybrids being able to utilize both the intermediate snail hosts of the parental species, which will have important implications for schistosomiasis epidemiology by increasing transmission and distribution [19]–[20], [27], [32]. Snail surveys were not conducted during this study, however, the study of Huyse and colleagues [32] did provide evidence for the transmission of S. haematobium/S. bovis hybrids through both B. globosus and B. truncatus the intermediate snail hosts of S. haematobium and S. bovis respectively. Snail surveys and molecular screening of cercariae from the hybrid zones are needed to clarify what role each snail species plays in the transmission of the parental species and their hybrids. Some degree of sympatric transmission enabling interbreeding between these species may have always occurred but remained undetected due to the limitations of previously available sampling and analysis tools. However, hybridisation between species can be further facilitated by the loss of ecological barriers existing between species due to natural and or man-made changes. [35]–[37]. In Northern Senegal, it was speculated that the hybridization between S. haematobium and S. bovis was facilitated by the creation of water bodies for agriculture, through dam construction, which led to an increased prevalence and distribution of the intermediate snail hosts and movements of humans and livestock to these resources, creating sympatric transmission of these species, resulting in hybridization. In the additional hybrid zones confirmed in this study, while no such ecological change can be attributed to enabling hybridization to have taken place, the natural progression in farming, population (both human and livestock) movements and expansion will result in areas of increased close associations between humans and their domestic livestock, increasing the chances of interspecific interactions between the schistosomes they carry. Other behavioural factors could also have an important impact, for instance during the sampling of cattle in the abattoir in Richard Toll in the SRB where S. bovis was highly prevalent, it became apparent that due to the lack of running water the intestines of slaughtered animals were routinely washed in the local river, which was also frequented by the local people for their everyday activities, thus creating a potential sympatric transmission site for S. haematobium and S. bovis. Implications Introgressive hybridization may lead to phenotypic changes that can dramatically influence disease dynamics and evolution of the parasites. Although treatment with praziquantel, the drug routinely used to control human schistosomiasis across Africa, is successful against S. haematobium, S. bovis and S. curassoni [55]–[56], hybridization between different Schistosoma species have been reported to affect the success of drug treatment in cattle [57], cause severe disease outbreaks and competitive exclusion of one species by the other [35]–[37] and laboratory hybrids have been observed to acquire enhanced characteristics such as infectivity, fecundity and growth rates [19], [20], [54]. S. haematobium has long been recognised as a parasite with few, if any, reservoir hosts [38]. However, it seems that in Senegal and possibly in other areas of West Africa, new genotypes may emerge that may pass from people to domestic livestock and vice versa. Furthermore, if the hybridization events reported here result in phenotypic characteristics that influence drug sensitivity, pathology and transmission, it will be highly important to re-evaluate control strategies in these hybrid zones. The increased host range of the hybrid parasites and changes in host distribution may have a direct impact on transmission of these schistosomes. Human and veterinary schistosomiasis in Senegal and neighbouring countries needs to be further monitored to clarify further the epidemiology and dynamic interactions of these closely related schistosome species. Supporting Information Table S1 Data from children. (DOC) Click here for additional data file. Table S2 Date from domestic livestock. (DOC) Click here for additional data file.

Introduction Schistosomiasis, also known as bilharzia, is caused by trematodes of the Schistosomatidae family. It is among the most important parasitic diseases worldwide, with a significant socio-economic impact [1]. More than 200 million people are infected, and about 200,000 may die from the disease each year. On a global scale, one of thirty individuals has schistosomiasis [2]. Movements of refugees, displacement of people, and mistakes in freshwater management promote the spread of schistosomiasis [3],[4]. Human disease is caused by S. haematobium, S. mansoni, S. japonicum, and less frequently, S. mekongi and S. intercalatum [5],[6]. Infection with cercariae occurs through intact skin via contact with infested water. Penetration of cercariae is followed by Katayama syndrome, an acute syndrome with fever, rash and eosinophilia. The syndrome is thought to be caused by antigen excess due to the presence of schistosomules in blood and the beginning of egg deposition [5],[6]. After maturation in the lung and liver sinusoids, adult male and female worms mate and actively migrate to their target organs [4],[5]. S. haematobium resides in walls of the bladder and sacral and pelvic blood vessels surrounding the urinary tract. The other mentioned species reside in mesenteric veins. After deposition of eggs in the capillary system, eggs penetrate the mucosa of target organs and are excreted in urine or feces. Sequelae of acute and chronic infection include hepato-splenic disease, portal hypertension with varices, pulmonary hypertension, squamous cell cancer of the bladder, liver fibrosis, and less common conditions such as myelo-radiculitis and female genital schistosomiasis. Co-infections with HCV and Schistosoma may also modify the course of hepatitis C [4], [7]–[14]. Anti-Schistosoma antibodies can be detected by enzyme immunoassay (EIA), immunofluorescence assay (IFA), and indirect hemagglutination assay [15]. Antibody detection is valuable in patients with rare exposure to Schistosoma, e.g., tourists. In patients with Katayama syndrome, a positive EIA antibody test is usually the earliest diagnostic laboratory result. Still, a large fraction of patients will initially test negative [16],[17]. False negative tests prevent timely treatment of schistosomiasis in travellers who present with fever of unknown origin. Moreover, the inability of serology to discriminate between active and past disease limits its clinical value for confirmation of the success of treatment [18]. Microscopic demonstration of eggs in stool or urine specimens is considered the diagnostic gold standard for confirmation of schistosomiasis in patients from endemic countries, as well as for the confirmation of the success of treatment. In field studies the rapid and inexpensive Katz-Kato thick smear technique is often used [19]. Because the shedding of eggs is highly variable, it is necessary to concentrate eggs from stool or urine prior to examination [20]. Even in concentrated samples the sample volume analysed in the microscope is limited. Due to random distribution effects, the analysed sample may not contain eggs even if the disease is active. It is thus very difficult to achieve a conclusive confirmation of successful therapy. In symptomatic patients with unsuccessful egg detection, it is often necessary to perform endoscopic biopsies of the bladder or rectal mucosa to increase the chance of detection [20]. Several groups have developed polymerase chain reaction (PCR) methods to improve the direct detection of Schistosoma. These tests are done on urine, stool, or organ biopsy samples, and involve the preparation of DNA from eggs prior to PCR amplification [21],[22]. Unfortunately, only a small volume of sample can be processed for DNA extraction, and it is dependent on chance whether the processed sample contains eggs or not. In this regard, PCR has the same limitations as microscopy and does not provide a significant clinical benefit. The detection of circulating cell-free DNA in human plasma has long been explored for the non-invasive diagnosis of a variety of clinical conditions (reviewed in [23] and [24]). It has been known since almost 20 years that patients with solid tumors have tumor-derived DNA circulating in plasma that can be used for diagnostic purposes [25]–[28]. Circulating fetal DNA in maternal plasma is used for diagnosing and monitoring of a range of fetal diseases and pregnancy-associated complications [29]–[33]. The normal concentration of cell-free DNA in plasma of adults is 10–100 ng/mL or 10e3 to 10e4 human genome equivalents per mL [34],[35]. It has been determined that the concentration of fetal DNA in maternal plasma is 3.4% of total serum DNA on average [16]. The presence of cell-free DNA in plasma may be a consequence of apoptosis, which is associated with physiological and pathological turnover of tissue, e.g., in tumor growth or embryonic development (reviewed in [36] and references therein). In parasitic diseases such as schistosomiasis, there is a huge turnover of parasites involving replication, maturation, and death of organisms. Multi-cellular parasites like Schistosoma contain DNA copies in stoichiometrical excess over parasite count. We reasoned that it might be possible to find cell-free parasite DNA (CFPD) circulating in plasma, and that this could be used to diagnose schistosomiasis. In contrast to eggs in stool or urine, CFPD would be equally distributed throughout the plasma volume of the patient, resolving the issue of random sampling that spoils clinical sensitivity of classical detection methods. As an extension of this rationale, we reasoned that it might also be possible to confirm the elimination of Schistosoma CFPD after successful treatment. To prove these concepts, Schistosoma-specific real-time PCR was established and optimised for detection of DNA from large volumes of plasma. A Balb/c mouse model of schistosomiasis was used to study the levels of CFPD in plasma during infection, as well as during and after therapy. The concept was then transferred to patients with different stages of infection, including Katayama syndrome, chronic disease with egg excretion, and patients treated for schistosomiasis in the past without current signs of disease. Materials and Methods Ethics statement Written informed consent was obtained from every patient. The study was approved by the ethics committee of the Board of Physicians of the City of Hamburg. Animal model of S. mansoni infection The Liberian isolate of S. mansoni [37], was maintained in Biomphalaria glabrata and Syrian hamsters. Maintenance of the life cycle was exactly performed as described elsewhere [38]. Adult female Balb/c mice (Charles Rivers Laboratories, Sulzfelden, Germany) were infected by intraperitoneal injection of 100 cercariae diluted in 200 µL sterile isotonic saline solution. Approval was obtained from the animal protection board of the City of Hamburg. Patients The study included patients with Katayama syndrome (n = 8) defined by fever, eosinophilia and a history of surface freshwater contact during a recent travel to a schistosomiasis endemic region. A second group had active, untreated disease defined by detection of eggs in stool or urine (n = 14). Most patients in this group were immigrants from endemic regions presenting to their primary care physician with acute manifestations like hematuria. Most of them where not aware of their disease. A third group of patients had treated schistosomiasis defined by prior anti-parasitic treatment and failure to detect viable eggs by microscopy (n = 30). Samples Serum and plasma samples were collected for antibody testing and DNA extraction, respectively. Serum was stored at +4°C and plasma was stored at −20°C prior to use. Stool samples were collected in Merthiolat-Iodine-Formol buffer and stored at +4°C until use. Serology All patient sera were tested for anti-Schistosoma antibodies by means of an extensively validated in-house EIA that has been described previously [15]. EIA used crude extracts from cercariae and adult worms of S. haematobium and S. mansoni, as well as extracts from adult worms of S. japonicum. Parasite detection Stool investigation was done essentially as described earlier [15]. For detection of S. haematobium eggs, urine was filtered as described by Peters et al. [39]. Microscopy was performed directly on untreated biopsies and on paraffin-embedded tissue. The latter was cut with a microtome into 5-µm sections. The sections were subsequently mounted on glass slides, stained with hematoxylin-eosin, periodic acid–Schiff and Trichrome stains and subsequently examined by an experienced pathologist for Schistosoma eggs. Plasma DNA preparation DNA from plasma was prepared by large volume phenol-chloroform extraction. In brief, up to 20 mL of plasma were mixed with an equal volume of phenol and centrifuged for 5 min at 1,200 g. The aqueous phase was transferred to a new tube, mixed with an equal volume of phenol∶chloroform 1∶1, and centrifuged 5 min at 3,500 rpm. Again the aqueous phase was transferred to a new tube, mixed with an equal volume of chloroform, and centrifuged 5 min at 3,500 rpm. DNA was precipitated by adding 1/10 volume of 3 M sodium acetate and 1 volume of 99% ethanol. After centrifugation for 1 h at 14,000 g the supernatant was discarded. To remove residual salt the pellet was washed with 1 mL ethanol 70% and centrifuged 20 min at 10,000 rpm. Supernatant was discharged. The DNA pellet was air-dried and dissolved in 50 µL of water and stored at −20°C. Real-time PCR In order to achieve high analytical sensitivity, the 121 bp tandem repeat sequence (GenBank accession number M61098) that contributes about 12% of the total Schistosoma mansoni genome sequence was chosen as the PCR target gene [40]. 20 µL reactions contained 3 µL of DNA, 2 µL 10X Platinum Taq PCR-Buffer (Invitrogen, Karlsruhe, Germany), 1.5 µL MgCl2 (50 µM), 200 µM of each dNTP, 0.8 µg bovine serum albumin, 500 nM of primers SRA1 (CCACGCTCTCGCAAATAATCT and SRS2 (CAACCGTTCTATGAAAATCGTTGT) each, 300 nM of probe SRP (FAM-TCCGAAACCACTGGACGGATTTTTATGAT-TAMRA), and 1.25 units of Platinum Taq polymerase (Invitrogen). Cycling in a Roche LightCycler® version 1.2 comprised: 95°C/5 min, 45 cycles of 58°C/30 s and 95°C/10 s. Fluorescence was measured once per cycle at the end of the 58°C segment. Quantification standard and technical sensitivity The PCR target fragment was cloned into plasmid by means of a pCR 2.1-TOPO TA cloning reagent set (Invitrogen, Carlsbad, California, USA). Plasmid purification was done with a QIAprep MiniPrep kit (Qiagen, Hilden, Germany). Plasmids were quantified by spectrophotometry. The standard plasmid was tested in 10-fold dilution series by PCR, showing a detection limit of 5.4 copies per reaction. If plasmids were inoculated into 200 µL of plasma prior to preparation, 68.8 copies per mL of plasma were detectable. Because the DNA contained in 200 µL was concentrated in 50 µL elution volume, of which 3 µL were tested by PCR, the PCR input at 68.8 copies per mL corresponded to a calculated 0.8 copies per PCR. Dilutions of the standard plasmid were also used as a quantification reference in real-time PCR. It should be mentioned that only approximate concentrations of Schistosoma DNA can be determined because the number of copies per genome of our target sequence varies between S.mansoni and hematobium and is unknown for S. japonicum [40]. Internal control Target gene nucleotides 39–79 bp were removed from the quantification standard plasmid, and replaced by an alternative probe binding site with techniques described earlier [41], using primers SRA-mut (ATCGTTCGTTGAGCGATTAGCAGTTTGTTT TAGATTATTTGCGGAGCGTGG) and SRS2-mut (CTGCTAATCGCTCAACGAAC GATTACAACGATTTTCATAGAACGGTTGG) for extension PCR, in combination with diagnostic PCR primers mentioned above. The resulting construct was cloned as described in the section “quantification standard”. Optimization of Schistosoma PCR for large plasma volumes One whole schistosome was ground in liquid nitrogen. Its nucleic acids were extracted and inoculated into human normal plasma. Different volumes of plasma were prepared by classical phenol-chloroform extraction, keeping the water volume in which DNA was resuspended at the end of the procedure constant at 50 µL. Parallel PCRs conducted on these nucleic acid solutions showed that an increase of detection signal was achieved up to an input volume of 10 mL of plasma, as evident by reduction of Ct values in real-time PCR. Above this input volume, no increase of signal was observed anymore, probably due to the introduction of interfering substances into PCR that were derived from large volumes of plasma. These experiments were repeated and confirmed with plasmid DNA spiked in human plasma. An input volume in humans of 10 mL of plasma was chosen as the volume to be analyzed in human diagnostic application in this study. It should be mentioned that outside this study, smaller volumes of plasma (down to 1 mL) were successfully used for CFPD detection. Quantitative correction factors Different input volumes of plasma were processed for mice or humans, respectively. For mice, 1 mL of plasma was extracted and the resulting DNA resuspended in 50 µL, of which 3 µL were tested in PCR. One DNA copy per PCR vial thus represented 16.7 copies per mL (50 / 3). For Humans, 10 mL of plasma were extracted and resuspended in 50 µL of water, of which 3 µL were tested in PCR. One DNA copy per PCR vial thus represented 1.67 copies per mL. Confirmation of PCR specificity Plasma from 30 blood donors and 35 patients examined for other conditions were tested by large-volume plasma extraction and CFPD real-time PCR. None yielded positive results. Statistical analysis The Statgraphics V 5.1 software package (Manugistics, Dresden, Germany) was use for all statistical analyses. T-tests were always two-tailed. Results In the case of tumors and pregnancy, cell-free DNA can be detected in plasma. Because the high turn-over rates of cells in these conditions resemble processes observed in parasitic infections, we reasoned that the detection of cell-free DNA from infecting parasites (CFPD) might be effective as a diagnostic approach in schistosomiasis. In preliminary experiments, stored serum samples from humans with confirmed schistosomiasis were processed with a method commonly used for detection of DNA viruses from cell-free plasma [42] and tested by Schistosoma PCR [21]. Plasma samples from mice infected with S. mansoni were also tested. In both cases, Schistosoma DNA was detectable in some but not all of the tested samples (data not shown). To determine systematically under which conditions and at what quantities CFPD was detectable in schistosomiasis, a quantitative real-time PCR assay for a Schistosoma multi-copy gene was established as described in the Materials and Methods section. A well-established mouse model of schistosomiasis was employed. In a first step it was tested whether CFPD circulated in plasma during the phase of chronic schistosomiasis. Four adult BALB/c mice were infected with 100 cercariae of S. mansoni and sacrificed after completion of the replication cycle on day 42 after infection. To enable testing of a large volume of mouse plasma, blood was pooled from four mice and one mL of pooled plasma was extracted. Quantitiative PCR with an absolute quantification standard (refer to Materials and Methods section) yielded a DNA concentration of 128.27 copies of CFPD target gene per mL of plasma (Figure 1, marked datum point). 10.1371/journal.pntd.0000422.g001 Figure 1 DNA copies per mL of pooled mouse plasma (y-axis, four mice per datum point) in mice infected intraperitoneally with 100 cercariae of S. mansoni. After completion of parasite maturation on day 42, mice were treated orally with praziquantel on day 45 (120 mg per kg). At the indicated times (x-axis), four mice were sacrificed, their blood pooled, and 1 mL of pooled plasma was tested as described in the Materials and Methods section for cell-free Schistosoma DNA. The untreated group is marked with an asterisk (*). It was next determined whether any associations might exist between the amount of living parasites in mice and the concentration of CFPD. Along with the four mice mentioned above, 16 more mice had been infected on the same day with the same dose of S. mansoni cercariae. On day 45 post infection all 16 mice were treated with a single oral dose of 120 µg praziquantel per gram body weight. This dose was known to eliminate Schistosoma in our model (own unpublished data). Groups of four mice were sacrificed on days 50, 80, 120, and 180 after infection, respectively, and from each group one mL of pooled plasma was tested. Figure 1 summarizes the CFPD target gene concentrations observed in all groups of mice, including the untreated group. Interestingly, in mice sacrificed five days after treatment the Schistosoma CFPD concentration in pooled plasma was considerably increased against the group that was sacrificed immediately before treatment (899.23 vs 128.27 target gene copies per mL). CFPD concentrations decreased to 182.93 and 70.97 target gene copies/mL on days 80 and 120, respectively, and became undetectable in the last group sampled on day 135 post treatment. It was concluded that the concentration of CFPD in plasma might be associated with the number of viable parasites or eggs in the mouse model, and the observed increase of CFPD immediately after treatment may have been due to parasite decay. To determine whether CFPD could also be detected in humans, fourteen patients with chronic disease were studied. These patients had been referred to our tropical medicine ward after being identified in routine screening for gastrointestinal conditions or other symptoms compatible with Schistosomiasis. It could not be reconstructed how long these patients had been infected, or how long ago they had been exposed. Diagnoses were initially made by EIA. Active infections were subsequently confirmed in all patients by microscopic detection of intact eggs in urine, stool, or organ biopsies. Either S. mansoni, or S. haematobium, or S. japonicum eggs were seen (Table 1). From each patient, 10 mL of plasma were extracted and tested for Schistosoma CFPD. All patients tested positive. The observed CFPD concentrations ranged from 1.22 to 27,930 target gene copies per mL of plasma. 10.1371/journal.pntd.0000422.t001 Table 1 Patients with chronic disease. Patient Suspected origin of infection Country of residence Residence status EIA Schistosoma species Sample in which eggs were detected Cell-free DNA cop/mLa 1 West Africa No data available Refugee + S. haematobium Bladder biopsy 27930.64 2 Mozambique Germany NGO worker + S. mansoni Rectum biopsy 27930.64 3 Nigeria Nigeria Immigrant + S. mansoni Rectum biopsy 3247.14 4 Egypt Egypt Immigrant + S. mansoni Rectum biopsy 1584.80 5 Egypt Egypt Immigrant + S. mansoni Rectum biopsy 1584.80 6 Philippines Germany Expatriate + S. japonicum Rectum biopsy 1584.80 7 Egypt Egypt Immigrant + S. mansoni Rectum biopsy 773.48 8 Zambia Germany NGO worker + S. mansoni Rectum biopsy 377.50 9 West Africa No data available Refugee + S. mansoni Rectum biopsy 184.24 10 Ghana Ghana Immigrant + S. mansoni Rectum biopsy 184.24 11 Gambia/Senegal Gambia/Senegal Immigrant + S. mansoni Rectum biopsy 21.42 12 West Africa West Africa Immigrant + S. haematobium Urine 21.42 13 Uganda Uganda Immigrant + S. mansoni Stool 2.49 14 Egypt Egypt Immigrant + S. mansoni Rectum biopsy 1.22 a Note that 10 mL of plasma were processed. 1 copy per mL = 1.67 copies per PCR vial. Because of the high detection rates in patients with active disease, it was tested whether CFPD might already be detectable in the early acute disease (Katayama syndrome). Eight patients were studied, as shown in Table 2. All of these patients had acute disease that was confirmed subsequently to be associated with Schistosoma infection. Although most patients were seen only in the third week of symptoms, two patients could be tested already on days 2 and 8 of symptoms, respectively. In three of eight patients, antibody EIA was still negative during the first visit. CFPD PCR was positive in all eight patients (Table 2). Target gene concentrations in the cohort seemed to increase with increasing times after exposure or after disease onset, as shown in Figure 2. Highest values were observed about six weeks from exposure or about 15 days from onset of symptoms. 10.1371/journal.pntd.0000422.g002 Figure 2 Cell-free Schistosoma DNA concentrations in plasma of patients with acute disease (Katayama syndrome) plotted against the days post exposure or post onset of symptoms when the tested samples were taken. 10 mL of plasma were tested for cell-free DNA. 10.1371/journal.pntd.0000422.t002 Table 2 Patients with Katayama syndrome. Patient Destination Purpose Visit DPEa DPOb DPTc LEUKd EOe EIAf Cell-free DNA copies per mLg 1 Mozambique Professional First 42 14 13.6 20.9 + 57227.85 Second 210 195 156 5.3 3.6 + 21.42 2 Ethiopia Professional First 42 15 10.2 26 − 27930.64 Second 135 120 79 7.3 4.1 + 1584.80 3 Uganda Professional First 56 18 10.1 19 + 21.42 Second 270 250 200 4.9 2.6 + 5.10 4 Uganda Professional First 12 20 7.3 22 + 10.45 Second 460 445 434 6.9 5.0 + 2.49 5 Malawi Tourist First 20 2 6.2 6.5 + 10.45 Second 750 740 716 5.2 0.8 + − 6 Mozambique Tourist First 56 21 50.7 65 − 13631.84 7 Jemen Tourist First 54 14 6.7 23 + 773.48 8 Malawi Tourist First 35 8 4.9 19.7 − 184.24 a Days post exposure with fresh water (most likely event). b Days post onset of symptoms. c Days post treatment for second visits. d Leukocyte count (n per nL). Average leukocyte count in patients 1 to 5: first visit, 9.48 cells/nl; second visit, 5.92 cells/nl (p<0.0017). e Percent eosinophiles in total leukocytes. Average eosinophile fraction in patients 1 to 5: first visit, 18.88%; second visit: 3.2% (p<0.033). f Enzyme immunoassay. g Note that 10 mL of plasma were processed. 1 copy per mL = 1.67 copies per PCR vial. It was next studied whether a decrease of CFPD concentration due to treatment could be confirmed. In the group of patients with Katayama syndrome, five of eight patients could be followed after treatment (Table 2). All five patients received praziquantel and prednisolon (1 mg/kg) within two weeks after initial diagnosis. A second treatment course (same dose of praziquantel, no prednisolon) was conducted in all patients 4 to 6 weeks later. Patients were appointed for control visits which took place 105 to 738 days after the initial visit (rows labelled “second visit” in Table 2). As expected, average leukocyte counts and levels of eosinophilia (% eosinophiles in leukocyte count) were significantly lower in second visits than in first visits. All patients had normal or only marginally increased eosinophile levels during their second visits (Table 2). Mean Schistosoma CFPD target gene concentrations in plasma were 17,040.20 copies/mL during first visits and 322.76 copies/mL during second visits. Means were significantly different (two-tailed T-test, p<0.05, Wilcoxon paired-sample test, p<0.04). Interestingly, only one patient had a completely negative CFPD PCR test during the second visit, and this was the patient with the longest interval between treatment and second visit. To obtain more data on Schistosoma CFPD concentrations after treatment, we tested 30 patients who had been treated for schistosomiasis during eight years in our institution, and who were available for a re-visit. These patients were in good clinical condition, had no eosinophilia, and had received between 1 and 6 treatment courses since their last exposure in endemic regions. Patient histories are summarized in Table 3. Ten of the 30 patients had positive CFPD PCR results. Intervals between treatment and PCR testing were significantly different between PCR-positive and PCR-negative patients (0.43 years vs. 3.4 years, p<0.0004, ANOVA f-test). The longest interval between treatment and a positive PCR result in any patient was 58 weeks. Interestingly, three of the ten patients with positive PCR showed dead eggs in histology. 10.1371/journal.pntd.0000422.t003 Table 3 Patients seen after treatment. Patient Country of origin Residence status Schistosoma speciesa Histologyb YPEc NTd TPTe Cell-free DNA cop/mLf 1 Egypt Immigrant S. haematobium Negative 3 1 2 wk 6653.16 2 Sierra Leone Refugee Unclassified Negative 6 1 2 wk 89.92 3 Guinea Immigrant S. mansoni DE 8 1 4 wk 89.92 4 Sierra Leone Refugee Unclassified Negative 7 2 13 wk 43.88 5 Zimbabwe/Botswana Immigrant Unclassified Negative 4 1 2 wk 21.41 6 German Tourist Unclassified Negative 3 3 24 wk 10.45 7 Ghana Immigrant S. mansoni EO 2 4 54 wk 10.45 8 Data not available Immigrant Unclassified DE 2 2 58 wk 2.49 9 Germany Expatriate Unclassified DE 3 2 9 wk 2.49 10 Egypt Immigrant Unclassified Negative 4 5 52 wk 2.49 11 Cameroon Immigrant S. haematobium Negative 2 3 2 y - 12 Uganda Immigrant Unclassified Negative 3 1 0 y - 13 Germany Tourist S. haematobium Negative 3 3 1 y - 14 Germany Tourist S. mansoni Negative 3 3 2 y - 15 Philippines Immigrant S. japonicum DE 4 6 2 y - 16 Ghana Immigrant Unclassified EO 4 2 3 y - 17 Germany Tourist S. mansoni Negative 4 3 3 y - 18 Egypt Immigrant S. mansoni EO 5 1 0 y - 19 Egypt Immigrant Unclassified Negative 5 4 3 y - 20 Cameroon Immigrant Unclassified EO 6 2 5 y - 21 Egypt Immigrant S. mansoni Negative 6 4 4 y - 22 Ghana Immigrant S. haematobium DE/EO 10 1 0 y - 23 Germany Tourist Unclassified Negative 10 3 8 y - 24 Egypt Immigrant S. haematobium Negative 6 2 6 y - 25 Germany Expatriate Unclassified Negative 5 3 4 y - 26 Cameroon Immigrant Data not available Negative 5 3 4 y - 27 Germany Tourist Unclassified Negative 5 3 4 y - 28 Cameroon Immigrant Unclassified Negative 6 3 5 y - 29 Egypt Immigrant Unclassified Negative 7 4 4 y - 30 Data not available Immigrant Unclassified DE 8 2 8 y - a Identified by microscopy during earlier active disease episode (recorded data). b Microscopic findings in colon or bladder biopsy upon re-visit. DE = degenerated eggs; EO = eosinophilic infiltrates; Negative = normal histology. c Years post exposure = time (years) between last exposure in endemic country and PCR testing. d Number of earlier treatment courses since last exposure. e Time post treatment = time (wk = weeks; y = years) between completion of last treatment course and PCR testing. f Note that 10 mL plasma were processed. 1 copy per PCR mL = 1.67 copies per PCR vial. To obtain an estimate of the approximate duration of CFPD detection after therapy, the CFPD target gene concentrations were plotted against time for all patients in this study who provided positive PCR results after treatment (patients from the Katayama syndrome ever group and post-treatment group). As shown in Figure 3, linear regression or exponential curve fitting suggested that negative results could be expected by weeks 82 or 120 after treatment, respectively. 10.1371/journal.pntd.0000422.g003 Figure 3 Cell-free Schistosoma DNA concentrations after treatment. DNA concentrations were plotted only for those patients still showing cell-free Schistosoma DNA in plasma after treatment. These data were pooled from patients who had been followed prospectively after being diagnosed with Katayama syndrome, as well as from patients examined retrospectively after concluded treatment. Linear regression analysis yielded the graph equation Y = 2.03−0.02 X. Exponential regression yielded the graph equation Y = e ∧ −0.02 (X−30.4). Discussion Schistosomiasis involves a wide range of symptoms and is difficult to diagnose. In this study we have explored the utility of detecting cell-free parasite DNA (CFPD) in serum as an alternative to detecting eggs in stool, urine, or organ biopsies. The concept of using cell-free DNA for diagnostic purposes has been proven in oncology and prenatal diagnostics [25]–[33]. It was our rationale that schistosomiasis involves parasite turnover, liberating DNA from decaying parasites that would reach the blood. Unlike eggs in stool or urine, CFPD in plasma would not undergo random sampling effects that complicate diagnostics. By means of a well-established murine model of schistosomiasis, it was confirmed that DNA could be detected in plasma during active disease, and that praziquantel treatment led to clearance of Schistosoma CFPD from plasma. Consistent with the hypothesis that circulating Schistosoma DNA stemmed from decaying parasites, a marked increase of CFPD concentration was observed in plasma of mice sampled short after initiation of therapy. Because of the large differences in plasma volume between mice and humans, we have not undertaken any further mouse experimentation but continued a proof-of-concept study on available patients with schistosomiasis in various clinical stages. In a first approach, we showed that CFPD could be detected in all of 14 patients with active disease. Due to the small number of available patients, this finding clearly awaits confirmation in larger studies. It should also be mentioned that the sensitivity of our assay may vary between Schistosoma species, as the target gene has not been formally evaluated in S. japonicum (e.g., our whole study contained only one patient with S. japonicum), and it has been shown that S. hematobium contains less copies of it than S. mansoni [40]. More recent PCR protocols (e.g., [21]) may be better suited to detect all species with the same sensitivity. This study therefore does clearly not provide a protocol intended for direct transfer into clinical application. Nevertheless, it is an interesting perspective that CFPD PCR might reach a clinical sensitivity of 100% for active schistosomiasis. In industrialized countries, it may be easier to find well-equipped molecular diagnostic laboratories than experienced microscopists with sufficient expertise in Schistosoma egg detection. Because of the ease of taking blood samples, and in view of the risk contributed by undiagnosed Schistosomiasis, it could become a realistic option to integrate Schistosoma CFPD PCR in routine diagnostic regimens for the clarification of gastrointestinal or urological conditions. Katayama syndrome caused by acute Schistosoma infection is a major differential diagnosis in returning travellers presenting with fever of unknown origin [6]. Although eosinophilia is a helpful criterion to distinguish Katayama syndrome from other conditions such as malaria or dengue fever, it is difficult to make a distinctive diagnosis due the shortcomings of serology and the inability of demonstrating Schistosoma infection before egg production [14]. We have demonstrated here that CFPD can be detected very early after onset of symptoms in patients with Katayama syndrome. Despite the limited number of patients studied, the concentrations of CFPD observed in our patients were well above the detection limit of the PCR assay. Based on experiments on limiting dilution series and quantitative correction factors as described in the Materials and Methods section, it could be assumed that the technical sensitivity limit of our assay was ca. 1.67 CFPD target gene copies per mL of plasma. The earliest patient with Katayama syndrome sampled on day 2 of symptoms already had a plasma concentration of ca. 10 copies per mL. If larger studies can confirm the high clinical sensitivity seen in our study, the detection of CFPD in plasma might become an accepted way of ruling out Katayama syndrome. It should be mentioned here that we have meanwhile modified our protocol by testing smaller volumes of plasma (in the order of 1–2 mL) and using a larger input volume of DNA in PCR. This modification makes the method easier to handle in routine laboratories, and still seems to provide sufficient sensitivity to diagnose patients with Katayama syndrome. A third field of application is the monitoring of therapy. In order to prevent relapse and long term sequelae from insufficient treatment, it is important to achieve a laboratory confirmation of the success of treatment [18], [43]–[45]. Unfortunately, patients after therapy as well as patients after a long course of disease with spontaneous healing (“burnt out bilharzia”) are difficult to judge based on clinical or laboratory findings [16],[18]. Several repetitive, parallel samplings are necessary to increase the statistical chance of detection of eggs by microscope, and thus to increase the clinical sensitivity of laboratory diagnostics [20],[22],[46]. This problem applies not only to microscopy, but also to conventional PCR on stool or urine samples [21],[47]. In the latter tests, there are additional issues such as PCR inhibition in stool samples. We have shown here that the concentration of CFPD in plasma was significantly reduced after therapy. The average CFPD concentration in those patients who still had detectable DNA after treatment (25.1 copies per mL) was significantly lower than in patients with Katayama syndrome (first visits, 537 copies per mL) or active disease (323.6 copies per mL), as determined by ANOVA (F-test, p<0.035; refer to Figure 4 for a Box Plot diagram). The decline of CFPD concentration in patients before and after treatment may thus become an effective parameter for monitoring patients under therapy. On the contrary, we were surprised to see that it took considerably longer in humans than in mice for CFPD PCR to become entirely negative after treatment. Lo et al. have determined that the half-life of fetal DNA in mother's plasma after birth ranges between 4 and 30 minutes [48]. In our study, pooled data from patients followed prospectively and patients re-examined retrospectively after treatment suggest that it may take more than one year until CFPD becomes entirely undetectable. Although we have no experimental evidence, it can be speculated that inactive eggs may release DNA with very slow kinetics. The greater number of eggs in humans with chronic disease as opposed to mice in our experiments may be responsible for a considerably longer duration until CFPD is totally eliminated in humans. Future studies should address the utility of paired CFPD determinations in individual patients before and after treatment, rather than insisting on negative CFPD results for a confirmation of treatment success. 10.1371/journal.pntd.0000422.g004 Figure 4 Box plot analysis of cell-free DNA concentrations in patients with Katayama syndrome (first visits only), patients with chronic disease, and all patients who had positive plasma PCR after treatment (pooled from treated Katayama syndrome patients and patients examined retrospectively after treatment). Boxes represent the innermost two quartiles (25%–75% percentiles = interquartile range, IQR) of data. The whiskers represent an extension of the 25th or 75th percentiles by 1.5 times the IQR. The notches represent the median +/−1.57 IQR √n. If the notches of two boxes do not overlap, the medians ( = notch centers) are significantly different (true for the active disease vs. the treated group). In summary, the detection and quantification of CFPD from plasma might carry the potential of becoming a novel diagnostic tool for any stage of schistosomiasis. With increased automation and better instrumentation for molecular diagnostics, the cost efficiency and quality of results in clinical laboratories can exceed that of repetitive diagnostic determinations by microscopy. The cost of reagents and consumables for our method range around 3 USD per determination, which is probably too expensive in many endemic countries. However, this price is compatible with application in funded surveillance and control programmes, and should be affordable for individualized application in emerging countries. Instrumentation and expertise for proper PCR diagnostics has considerably improved in many countries due to the demands created by HIV and TBC treatment programmes. If future studies can prove the clinical benefits suggested here, Schistosoma CFPD PCR may become a new priority in molecular diagnostics in developing and emerging countries.