10
views
0
recommends
+1 Recommend
0 collections
    0
    shares
      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

      Read this article at

      Bookmark
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          ε-poly- l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly- l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

          Related collections

          Most cited references 45

          • Record: found
          • Abstract: found
          • Article: not found

          Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution

          Human telomeric DNA consists of tandem repeats of the sequence d(TTAGGG). The formation and stabilization of DNA G-quadruplexes in the human telomeric sequence have been shown to inhibit the activity of telomerase, thus the telomeric DNA G-quadruplex has been considered as an attractive target for cancer therapeutic intervention. However, knowledge of the intact human telomeric G-quadruplex structure(s) formed under physiological conditions is a prerequisite for structure-based rational drug design. Here we report the folding structure of the human telomeric sequence in K+ solution determined by NMR. Our results demonstrate a novel, unprecedented intramolecular G-quadruplex folding topology with hybrid-type mixed parallel/antiparallel G-strands. This telomeric G-quadruplex structure contains three G-tetrads with mixed G-arrangements, which are connected consecutively with a double-chain-reversal side loop and two lateral loops, each consisting of three nucleotides TTA. This intramolecular hybrid-type telomeric G-quadruplex structure formed in K+ solution is distinct from those reported on the 22 nt Tel22 in Na+ solution and in crystalline state in the presence of K+, and appears to be the predominant conformation for the extended 26 nt telomeric sequence Tel26 in the presence of K+, regardless of the presence or absence of Na+. Furthermore, the addition of K+ readily converts the Na+-form conformation to the K+-form hybrid-type G-quadruplex. Our results explain all the reported experimental data on the human telomeric G-quadruplexes formed in the presence of K+, and provide important insights for understanding the polymorphism and interconversion of various G-quadruplex structures formed within the human telomeric sequence, as well as the effects of sequence and cations. This hybrid-type G-quadruplex topology suggests a straightforward pathway for the secondary structure formation with effective packing within the extended human telomeric DNA. The hybrid-type telomeric G-quadruplex is most likely to be of pharmacological relevance, and the distinct folding topology of this G-quadruplex suggests that it can be specifically targeted by G-quadruplex interactive small molecule drugs.
            Bookmark
            • Record: found
            • Abstract: found
            • Article: not found

            G-quadruplex DNA structures--variations on a theme.

             T Simonsson (2001)
            To be functional, nucleic acids need to adopt particular three-dimensional structures. For a long time DNA was regarded as a rigid and passive molecule with the sole purpose to store genetic information, but experimental data has now accumulated that indicates the full dynamic repertoire of this macromolecule. During the last decade, four-stranded DNA structures known as G-quadruplexes, or DNA tetraplexes, have emerged as a three-dimensional structure of special interest. Motifs for the formation of G-quadruplex DNA structures are widely dispersed in eukaryotic genomes, and are abundant in regions of biological significance, for example, at telomeres, in the promoters of many important genes, and at recombination hotspots, to name but a few in man. Here I explore the plethora of G-quadruplex DNA structures, and discuss their possible biological functions as well as the proteins that interact with them.
              Bookmark
              • Record: found
              • Abstract: found
              • Article: not found

              Propeller-type parallel-stranded G-quadruplexes in the human c-myc promoter.

              The nuclease-hypersensitivity element III1 in the c-myc promoter is a good anticancer target since it largely controls transcriptional activation of the important c-myc oncogene. Recently, the guanine-rich strand of this element has been shown to form an equilibrium between G-quadruplex structures built from two different sets of G-stretches; two models of intramolecular fold-back antiparallel-stranded G-quadruplexes, called "basket" and "chair" forms, were proposed. Here, we show by NMR that two sequences containing these two sets of G-stretches form intramolecular propeller-type parallel-stranded G-quadruplexes in K(+)-containing solution. The two structures involve a core of three stacked G-tetrads formed by four parallel G-stretches with all anti guanines and three double-chain-reversal loops bridging three G-tetrad layers. The central loop contains two or six residues, while the two other loops contain only one residue.
                Bookmark

                Author and article information

                Journal
                Mar Drugs
                Mar Drugs
                marinedrugs
                Marine Drugs
                MDPI
                1660-3397
                11 January 2020
                January 2020
                : 18
                : 1
                Affiliations
                [1 ]Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, 80131 Naples, Italy
                [2 ]Institute of Biostructures and Bioimaging—CNR 1, Via Mezzocannone 16, 80134 Naples, Italy
                [3 ]Department of Molecular Medicine and Medical Biotechnologies, University of Napoli Federico II, Via Sergio Pansini 5, 80131 Naples, Italy
                Author notes
                [* ]Correspondence: giroviel@ 123456unina.it
                Article
                marinedrugs-18-00049
                10.3390/md18010049
                7024349
                31940851
                © 2020 by the authors.

                Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license ( http://creativecommons.org/licenses/by/4.0/).

                Categories
                Article

                Comments

                Comment on this article