- Record: found
- Abstract: found
- Article: found
Blood Feeding and Insulin-like Peptide 3 Stimulate Proliferation of Hemocytes in the Mosquito Aedes aegypti
research-article
Publication date (Electronic):
6 October 2011
Journal:
PLoS Pathogens
Publisher:
Public Library of Science
Read this article at
There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.
Abstract
All vector mosquito species must feed on the blood of a vertebrate host to produce eggs. Multiple cycles of blood feeding also promote frequent contacts with hosts, which enhance the risk of exposure to infectious agents and disease transmission. Blood feeding triggers the release of insulin-like peptides (ILPs) from the brain of the mosquito Aedes aegypti, which regulate blood meal digestion and egg formation. In turn, hemocytes serve as the most important constitutive defense in mosquitoes against pathogens that enter the hemocoel. Prior studies indicated that blood feeding stimulates hemocytes to increase in abundance, but how this increase in abundance is regulated is unknown. Here, we determined that phagocytic granulocytes and oenocytoids express the A. aegypti insulin receptor ( AaMIR). We then showed that: 1) decapitation of mosquitoes after blood feeding inhibited hemocyte proliferation, 2) a single dose of insulin-like peptide 3 (ILP3) sufficient to stimulate egg production rescued proliferation, and 3) knockdown of the AaMIR inhibited ILP3 rescue activity. Infection studies indicated that increased hemocyte abundance enhanced clearance of the bacterium Escherichia coli at lower levels of infection. Surprisingly, however, non-blood fed females better survived intermediate and high levels of E. coli infection than blood fed females. Taken together, our results reveal a previously unrecognized role for the insulin signaling pathway in regulating hemocyte proliferation. Our results also indicate that blood feeding enhances resistance to E. coli at lower levels of infection but reduces tolerance at higher levels of infection.
Author Summary
Mosquitoes are vectors of several important diseases of humans and other mammals including Dengue fever, malaria and filariasis. These diseases adversely affect worldwide health by killing or debilitating millions of individuals. The key feature of mosquito biology that makes them such important disease vectors is that adult females must feed on the blood of their vertebrate host(s) to produce eggs. In turn, repeated bouts of blood feeding and egg development elevate the risk of mosquitoes feeding on an infected host and transmitting a given pathogen from one individual to another. A key regulator of egg development following blood feeding is the release of insulin-like peptides from the mosquito brain. We have found that insulin-like peptides enhance production of immune cells (hemocytes) that serve as the first line of defense against infection. Conversely, the molecular pathways that regulate egg development and hemocyte proliferation reduce the ability of mosquitoes to tolerate a persistent systemic infection. Taken together, our results indicate that trade-offs exist between reproduction and immune defense in mosquitoes, which is a subject of fundamental interest to evolutionary biologists and of applied importance in understanding disease transmission.
Related collections
Most cited references49
- Record: found
- Abstract: found
- Article: not found
Postembryonic hematopoiesis in Drosophila.
René Lanot, Daniel Zachary, François Holder … (2001)
We have investigated the blood cell types present in Drosophila at postembryonic stages and have analysed their modifications during development and under immune conditions. The anterior lobes of the larval hematopoietic organ or lymph gland contain numerous active secretory cells, plasmatocytes, few crystal cells, and a number of undifferentiated prohemocytes. The posterior lobes contain essentially prohemocytes. The blood cell population in larval hemolymph differs and consists mainly of plasmatocytes which are phagocytes, and of a low percentage of crystal cells which reportedly play a role in humoral melanisation. We show that the cells in the lymph gland can differentiate into a given blood cell lineage when solicited. Under normal nonimmune conditions, we observe a massive differentiation into active macrophages at the onset of metamorphosis in all lobes. Simultaneously, circulating plasmatocytes modify their adhesion and phagocytic properties to become pupal macrophages. All phagocytic cells participate in metamorphosis by ingesting doomed larval tissues. The most dramatic effect on larval hematopoiesis was observed following infestation by a parasitoid wasp. Cells within all lymph gland lobes, including prohemocytes from posterior lobes, massively differentiate into a new cell type specifically devoted to encapsulation, the lamellocyte. Copyright 2001 Academic Press.
- Record: found
- Abstract: found
- Article: found
Blood Meal-Derived Heme Decreases ROS Levels in the Midgut of Aedes aegypti and Allows Proliferation of Intestinal Microbiota
Jose Oliveira, Renata L S Goncalves, Flávio A Lara … (2011)
Introduction Among all tissues in the insect body, gut epithelia receive the greatest exposure to microorganisms. As a consequence, complex communities of microorganisms can be found in the gut, leading to the development of a highly regulated array of immune mechanisms that mediate interactions between the insect and its microbiota [1] and influencing the transmission of pathogens by insect vectors to vertebrate hosts [2]–[4]. A major aspect of innate immunity of Drosophila melanogaster at the midgut interface is the production of free radicals by dual oxidases (Duox), a class of enzymes from the NOX family of proteins [5]–[8]. This is also true for mosquitoes and affects their ability to transmit human diseases such as malaria [9]–[11]. The capacity of some insect species as disease vectors is directly linked to their blood-feeding habit. An important feature of hematophagy is that huge amounts of blood are ingested by these organisms during a meal, as exemplified by Aedes aegypti, which in a single meal ingests volumes of blood of up to 2–3 times their pre-feeding weight. Digestion of hemoglobin, the main blood protein, inside the guts of these insects releases large quantities of its prosthetic group, heme, which has potential pro-oxidant and cytotoxic effects when not bound to proteins [12], [13]. Consequently, hematophagous arthropods need to manage the pro-oxidant effects of ingested heme after they feed on blood, as the interaction of blood-derived heme with ROS generated by the immune system would be deleterious. In fact, several protective mechanisms against heme and ROS toxicity have evolved independently in different species of blood-feeding organisms, including heme aggregation [14]–[16], heme degradation [17], [18], the expression of antioxidant enzymes [19], [20] and heme-binding proteins [21]. As a consequence, the oxidative challenge imposed by blood feeding is well circumvented by hematophagous insects, as evidenced by their extraordinary adaptive success. However, one overlooked aspect of this problem is the impact of these large amounts of heme on the redox metabolism of the midgut and, particularly on the operation of gut immune pathways connected to the production of reactive oxygen species (ROS). The concept of oxidative stress, originally defined as the imbalance between pro-oxidant compounds and antioxidant defenses, has recently been re-described as the “disruption of redox signaling and control” [22]. Related to this subject, heme notably interferes with several signaling pathways, including modulation of gene expression, protein synthesis and phosphorylation connected with cellular responses to stress [23], [24]. We have studied the effect of a blood meal on ROS levels and immune function in the midgut of Aedes aegypti, the vector of yellow fever and dengue virus. ROS levels in the midgut epithelia will be shown to play an important role in controlling bacteria in the midgut and is dramatically reduced soon after the ingestion of blood through a mechanism that involves PKC-dependent heme signaling. Materials and Methods Ethics statement All animal care and experimental protocols were conducted following the guidelines of the institutional care and use committee (Committee for Evaluation of Animal Use for Research from the Federal University of Rio de Janeiro, CAUAP-UFRJ) and the NIH Guide for the Care and Use of Laboratory Animals (ISBN 0-309-05377-3). The protocols were approved by CAUAP-UFRJ under registry #IBQM001. Technicians dedicated to the animal facility at the Institute of Medical Biochemistry (UFRJ) carried out all aspects related to rabbit husbandry under strict guidelines to insure careful and consistent handling of the animals. Mosquitoes Aedes aegypti (Red Eye strain) were raised in an insectary at the Federal University of Rio de Janeiro, Brazil, under a 12 h light/dark cycle at 28 °C and 70–80% relative humidity. Larvae were fed with dog chow, and adults were maintained in a cage and given a solution of 10% sucrose ad libitum. Two to ten day-old females were used in the experiments. Mosquito meals Mosquitoes were artificially fed with different diets: (1) 10% sucrose (ad libitum), (2) heparinized rabbit blood or (3) “bicarbonate-buffered saline-agarose” (BBSA) supplemented with diverse chemicals, as indicated in the figure legends. The BBSA solution was composed of glucose (10 mg), 500 mM freshly made bicarbonate buffer pH 7.4 (10 µL), 0.5 mg low melting-point agarose and 100 mM ATP, pH 7.4 (5 µL). The final volume was set to 500 µL with 150 mM NaCl. Feeding was performed using water-jacketed artificial feeders maintained at 37 °C sealed with parafilm membranes. Midgut dissection and culture Dissection was carried out in a drop of PBS at room temperature. Ten to fifteen midguts were transferred to a 24-well tissue culture flask containing 1 mL of L-15 medium supplemented with 5% fetal bovine serum without antibiotics. Midgut cultures were maintained at room temperature and were viable for at least 2 h, as assessed by the MTT reduction assay (data not shown) [25]. Determination of reactive oxygen species (ROS) in the midgut To assess ROS levels, midguts were incubated with a 2 µM solution of the oxidant-sensitive fluorophores, CM-H2DCFDA(5-(and-6)-chloromethyl-2′,7′-dichloro-dihydrofluorescein diacetate, acetyl ester) or dihydroethidium (hydroethidine) (DHE) (Invitrogen). After a 20-min incubation at room temperature in the dark, the midguts were washed in dye-free medium, and the tissue transferred to a glass slide in a drop of PBS for epifluorescence or confocal microscopic examination. Midguts were examined with a Zeiss Axioskop 40 with an Axiocam MRC5 using a Zeiss-09 filter set (excitation BP 450–490; beam splitter FT 510; emission LP 515, for CM-H2DCFDA) or a Zeiss-15 filter set (excitation BP 546/12; beam splitter FT 580; emission LP 590, for DHE). Differential interference contrast (DIC) images were acquired with a Zeiss AxioObserver, which was also used for some fluorescence images, with two filter sets, Zeiss-15 and Zeiss-10 (excitation BP 450–490; beam splitter FT 510; emission BP 515–565) for CM-H2DCFDA. Comparison of fluorescence levels among distinct images was performed under identical conditions, using the same objectives, microscopes and similar exposure times in each experiment. Confocal images were acquired with a Zeiss LSM 510 META (Excitation at 488 nm). For hydrogen peroxide quantification, the midgut epithelia were dissected in PBS at 4 °C, the gut contents were washed out, and the tissues (pools of 10 organs) were incubated in PBS under dim light and at room temperature in the presence of 100 µM Amplex Red reagent (Invitrogen) and 2 units horseradish peroxidase (HRP). After 30-min incubation, the epithelia were spun, and the supernatant collected. Fluorescence (Ex: 530 nn; Em: 590 nn) was measured with a Cary Eclipse spectrofluorimeter (Varian, Palo Alto, CA, USA) and compared to a hydrogen peroxide standard curve. The total H2O2 release was corrected for non-specific oxidation of Amplex Red measured in the absence of HRP. HPLC analysis of superoxide in the midgut epithelium To provide a more accurate assessment of superoxide levels, HPLC fractionation of dihydroethidium (DHE) oxidation products was used, as previously described [26]. The midgut epithelia of 20 female mosquitoes fed on sugar or 24 hours after blood meal were dissected in PBS at room temperature and incubated in L-15 medium + 5% FBS in 1.5-ml polypropylene tubes. Immediately after dissection, the midguts were spun, the supernatant removed and PBS supplemented with 150 µM dyhydroethidium (DHE) was added for 30 min at ambient temperature under dim light. In some experiments, the epithelium of sugar fed females was treated with 25 µM diphenylene iodonium (DPI) or 100 U/mL of PEG-SOD 30 min before DHE incubation. After DHE incubation, the midguts were washed twice with PBS, frozen in liquid N2 and homogenized. The resulting material was resuspended in acetonitrile (500 µL), sonicated (3 cycles of 8W for 5 s) and centrifuged at 2000 g for 1 min). The supernatant was dried under vacuum (SpeedVac SVC 100 – Savant), and the resulting pellet stored at −20 °C until use. Three to six pools (20 midgut epithelia/pool) were prepared, depending on the conditions. Samples were resuspended in PBS supplemented with 100 µM diethylenetriamine pentaacetic acid (DTPA) and injected into an HPLC system (Waters) equipped with a photodiode array (W2996) and fluorescence detectors (W2475). Chromatographic separation of DHE oxidation products was carried out using a NovaPak C18 column (3.9×150 mm, 5 µm particle size) equilibrated in solution A (water/10% acetonitrile/0.1% trifluoracetic acid) with a flow rate of 0.4 mL/min. After injection of the samples, a 0–40% linear gradient of solution B (100% acetonitrile) was applied for 10 min, followed by 10 min of 40% solution B, 5 min of 100% solution B and 10 min of 100% solution A. The amount of DHE was measured by light absorption at 245 nm, and DHE oxidation products, Hydroxyethidium (EOH) and Ethidium (E), were monitored by fluorescence detection with excitation at 510 nm and emission at 595 nm. RNA extraction and qPCR analysis The protocol used was identical to Gonçalves et al. [27]. Midguts were dissected in PBS and RNA extracted using TRIzol (Invitrogen) according to the manufacturer protocol. RNA was subjected to DNAse I treatment and cDNA synthesized using High-Capacity cDNA Reverse transcription kit (Applied Biosystems). qPCR was perfomed with in a StepOnePlus Real Time PCR System (Applied Biosystems) using Power SYBR-green PCR master MIX (Applied Biosystems). The Comparative Ct Method [28] was used to compare changes in gene expression levels. A. aegypti ribosomal protein 49 gene (RP-49) was used as endogenous control. Primer sequences are given in supplementary table 1. dsRNA synthesis and RNAi experiments A 964-base pair fragment from Duox gene (AAEL007563-RA) was amplified from Aedes aegypti with the following primers: F - GCGATCGATACATTCCGTTT and R - TTCAACAGTTCTGGCTGTCG. The amplicon was subjected to nested PCR with an additional set of primers for Duox that included T7 promoters (F - TAATACGACTCACTATAGGGATAATGTGGTCGCCAA GAGG and R - TAATACGACTCACTATAGGGTG GGACCGAACAGTTTATCC), generating a 450-base pair fragment that was used to synthesize double-stranded RNA (dsRNA) with MEGAscript RNAi kit (Ambion, Austin, TX, USA) according to the manufacturer protocol and standard mosquito RNAi settings [29]. Gene silencing experiments were performed injecting 69 nL of a 3 µg /µL solution of dsRNA into the thorax of cold-anesthetized 2 day-old female mosquitoes. Two days after injection the mosquitoes were used for experiments. Midgut bacterial culture and sequencing To follow the growth profile of cultivable bacteria from the midgut of sugar or blood-fed (BF) mosquitoes, insects were surface-sterilized with 70% ethanol and dissected under aseptic conditions. Pools of 5 guts were homogenized in Luria-Bertani (LB) medium, serially diluted, plated on LB agar, allowed to grow overnight at 37 °C, and the number colony forming units (CFU) counted. One bacterial colony presenting low catalase activity (data not shown) was selected from the midgut of blood-fed mosquitoes (6 h after the meal) and grown in LB medium for subsequent experiments. Bacterial DNA was extracted with the DNeasy Blood & Tissue Kit from Qiagen according the manufacturer's instructions. DNA was subjected to PCR amplification using primers designed to amplify the 16S rDNA (Forward: 5-CCAGACTCCTACGGGAGGCAGC-3 and Reverse: 5-CTTGTGCGGGCCCCCGTCAATTC-3) (kindly provided by Dr. Carolina Barillas-Mury). The resulting product was purified, sequenced and identified using BLAST against the nucleotide collection database (nr/nt). Aedes aegypti feeding with bacteria and the investigation of ROS impact on the outcome of infection Females were fed with BBSA supplemented with bacteria previously isolated from the midguts of blood-fed mosquitoes (Enterobacter asburiae), as described above, in the presence or absence of 50 mM ascorbic acid (ASC) (neutralized to pH 7 with NaOH) or 10 µM DPI (diphenylene iodonium). After growing overnight in liquid LB medium, the appropriate amount of bacteria was pelleted, washed, re-suspended in 150 mM NaCl and mixed with the above components to a final volume of 500 µL. Fully engorged mosquitoes taken immediately after being fed with bacteria were transferred to new cages and scored for survival and bacterial loads at different time-points. Transmission electron microscopy analysis Midguts were dissected 24 h after feeding and fixed with 2.5% glutaraldehyde in 0.1 M Na-cacodylate buffer (pH 7.2) at room temperature for 1 h before being post-fixed in 1% OsO4, 0.8% potassium ferricyanide and 2.5 mM CaCl2 in the same buffer for 1 h at 25 °C. The cells were dehydrated in an ascending acetone series and embedded in PolyBed 812 resin. Ultrathin sections were stained with uranyl acetate and lead citrate and examined in a Jeol JEM1011 transmission electron microscope (Tokyo, Japan). Results Blood feeding reduces ROS in the midgut of Aedes aegypti To evaluate the effect of blood meal on ROS levels in the Aedes aegypti midgut, four different approaches comparing sugar-fed and blood-fed females were employed. Using fluorescence microscopy and two oxidant-sensitive probes (CM-H2DCFDA or DHE), a robust signal was observed in the midguts of sugar-fed females (Figures 1A and 1E), an indicator of ROS. The signal was markedly reduced immediately after blood ingestion (Figure 1B), suggesting that ROS were released constitutively in sugar-fed mosquitoes and their levels decreased soon after blood intake. Oxidant levels remained low while the bolus remained in the gut (Figure 1C and 1F), but it returned to high levels immediately after excretion of feces (Figure 1D). In this panel, images were recorded immediately after excretion, giving fluorescence signals comparable to those in sugar-fed females. 10.1371/journal.ppat.1001320.g001 Figure 1 Blood meal decreases ROS levels in the midgut. Female mosquitoes were fed with sugar or blood, and midguts were dissected at different times after the meal and incubated with CM-H2DCFDA (2 µM) (A–D) or DHE (2 µM) (E–F) for 20 min: (A) sugar; (B) blood (0 hrs after blood ingestion); (C) blood (48 h – before excretion); (D) blood (48 h – after excretion). (E) sugar; (F) blood (24 h). The same camera exposure time was used to allow side-by-side comparison of fluorescence intensity. Differential interference contrast (DIC) images are shown as insets. Scale bar – 100 µm. (G) Superoxide radical production measured by HPLC-separation of DHE oxidation products in midgut epithelia from sugar or blood-fed mosquitoes (24 h). Asterisk indicates P = 0.0239 for the comparison sugar-EOH vs blood-EOH (T-test). EOH – 2-hydroxyethidium; E - Ethidium. (H) Hydrogen peroxide release from midgut. Asterisk indicates statistically different values (P 90% (data not shown). 10.1371/journal.ppat.1001320.g005 Figure 5 Time-course of microbial growth in Aedes aegypti midgut before and after a blood meal. (A) Evaluation of cultivable bacterial population in sugar-fed (SF) and blood-fed midguts dissected at different times after feeding. (B) Culture-independent evaluation of microbiota in sugar-fed (SF) and blood-fed midguts through qPCR for bacterial ribosomal 16S RNA [54]. 10.1371/journal.ppat.1001320.g006 Figure 6 Heme decreases ROS levels in the midgut and allow proliferation of intestinal microbiota. Female Aedes aegypti were fed ad libitum for five days with sucrose supplemented with heme (20 and 40 µM). (A) Representative images of midgut ROS after heme treatment. Scale bar – 100 µm. (B) Fluorescence associated with individual midguts was quantified with ImageJ software. The number of midguts used was: SF – 24, SF + heme (20 µM) – 23, SF + heme (40 µM) – 21. ** P < 0.01. *** P < 0.0001 (ANOVA followed by Tukey's Multiple Comparison Test – GraphPad Prism). (C) Gut bacteria was assessed through qPCR from pools of 10 midguts. 8 pools from each condition were used. ** P<0.01 (T-test – GraphPad Prism). 10.1371/journal.ppat.1001320.g007 Figure 7 Duox silencing in the midgut reduces ROS levels and allow proliferation of intestinal microbiota. 2-day old female Aedes aegypti were injected with dsDuox or a non-related control dsRNA (dsLacZ). 2 days later individual mosquitoes were subjected to evaluation of midgut ROS (A–B) or pools of 10 mosquitoes were used for midgut RNA extraction followed by qPCR analysis (C–D). (A) Representative images of midgut ROS after dsDuox injection. Scale bar – 100 µm. (B) Fluorescence associated with individual midguts was quantified with ImageJ software. The number of midguts used was: dsLacZ – 13, dsDuox – 26. * P<0.05 (T-test – GraphPad Prism). (C) qPCR analysis of Duox expression in the midgut revels a silencing efficiency of 67% compared to LacZ-treated groups. *** P<0.0001 (T-test – GraphPad Prism). (D) Gut bacteria was assessed through qPCR from pools of 10 midguts. 8 pools from each condition were used. *** P<0.001 (T-test – GraphPad Prism). Redox modulation of pathogenesis after bacterial infection in Aedes aegypti We decided to investigate whether ROS modulates the ability of Aedes aegypti to fight a bacterial oral infection. Females were fed a sub-lethal dose of a bacteria, identified as Enterobacter asburiae based on 16S rDNA sequencing (supplementary figure S6), isolated from the midgut of blood-fed (6 h ABM) insects from our colony. Figure 8B shows that mosquitoes orally infected with this bacteria in the presence of ascorbic acid (BBSA + Enterobacter + ASC), a condition that reduces ROS levels (Figure 8A), had a significantly decreased life span compared to the group infected in the absence of the antioxidant. Concomitantly, there was a 4-fold increase in the amount of bacteria in the midgut 24 h after the bacteria-containing meal (Figure 8C), suggesting that increased mortality might be attributable to increased proliferation of bacteria in the midgut. In vitro growth of Enterobacter asburiae in the presence of ascorbic acid did not result in increased proliferation of bacteria after 24 h of culture in LB media (data not shown), demonstrating that the increased bacterial growth in mosquitoes infected in the presence of ascorbate (Figure 8C) was due to the absence of ROS. This conclusion was supported by feeding mosquitoes with Enterobacter asburiae together with DPI (BBSA + Enterobacter + DPI), which also inhibited ROS production (Figure 8D and supplementary figure S1), causing a marked increase in mortality (Figure 8E), accompanied by a 3-fold increment in the proliferation of bacteria 24 h after challenge when compared to mosquitoes that ingested Enterobacter asburiae only (without DPI) (Figure 8F). Noteworthy, mosquitoes fed ad libitum with DPI (diluted in sucrose) without Enterobacter asburiae exhibited no mortality (data not shown) but showed increased proliferation of endogenous gut flora (supplementary figure S7) when compared to sugar-fed mosquitoes. In Figure 8E–F it is also shown that feeding mosquitoes with BBSA + DPI (without Enterobacter) caused significant mortality (“no infection + DPI” in Figure 8E) and increased bacterial counting (Figure 8F). Endogenous bacterial growth and mortality was reverted by antibiotic treatment demonstrating that mortality was due to bacterial proliferation (“no infection + DPI + Ab” in Figure 8E). 10.1371/journal.ppat.1001320.g008 Figure 8 Redox modulation of bacterial growth in the midgut. (A) Female mosquitoes were fed with BBSA + ascorbic acid (ASC) (50 mM pH 7) and immediately dissected and ROS levels were determined based on CM-H2DCFDA fluorescence. (B) Females were fed with BBSA + gut commensal bacterium Enterobacter asburiae at a concentration of 2×109 CFU/mL with or without ascorbic acid (50 mM) and were scored for survival daily. Data was analyzed with the Log-rank Test (GraphPad Prism 5). P = 0.0055 between “infection” and “infection + ASC”. The result shown is the sum of 3 independent experiments. Total number of mosquitoes: Control (n = 40). Control + ASC (n = 40). Infection (n = 105). Infection + ASC (n = 105). (C) In a different group of experiments using the same infection setup as in Figure 7B, mosquitoes were surface sterilized and dissected (5 midguts/pool; 24 h after bacterial oral infection) and the number of CFU/midgut was determined. Figure 8C is the result of a representative experiment using 15 pools per condition. *** P<0.0001 following a Kolmogorov-Smirnov Comparison test. (D) Sugar-fed midguts were pre-incubated for 1 h in medium alone (control) or medium supplemented with diphenylene iodonium (DPI, 10 µM) and stained for ROS with CM-H2DCFDA. Scale represents 100 µm. (E) Females were fed with BBSA supplemented Enterobacter asburiae at a concentration of 4×109 CFU/mL with or without DPI (10 µM), as well as BBSA + DPI with or without antibiotics (penicillin/streptomycin/tetracycline – 200 U/mL, 200 µg/mL, 100 µg/mL, respectively) and scored for survival daily. The total number of mosquitoes was 123 for “infection” 120 for “infection + DPI”, 30 for “no infection”, 106 for “no infection + DPI” and 120 for “no infection + DPI + Ab”. The result shown is the sum of 3 independent experiments. P<0.0001 for the comparison between “infection” and “infection + DPI (Log-rank Test – GraphPad Prism). (F) RNA from whole body (minus head) of pools of 5 mosquitoes was extracted and quantification of bacterial 16S RNA was performed using 6 independent pools of mosquitoes. ** P<0.01. *** P<0.0001 (ANOVA followed by Tukey's Multiple Comparison Test – GraphPad Prism). We used transmission electron microscopy (TEM) in mosquito midguts to explore in more detail the pathogenic mechanisms responsible for increased mortality 24 hours after bacterial infection in the presence of DPI. Mosquitoes infected with Enterobacter asburiae without DPI had healthy epithelial cells, including a normal aspect of the microvilli and cytoplasm (Figure 9A). In contrast, midguts from mosquitoes fed with bacteria and DPI presented highly damaged epithelia, with loss of microvilli and aberrant cell morphology (Figure 9B). In figure 9C it is shown the integrity of cells and the presence of some bacteria, that is morphologically distinct from Enterobacter asburiae (supplementary figure S8), in the lumen after feeding mosquitoes with DPI alone (BBSA + DPI), suggesting the proliferation of bacteria from the gut flora due to the lack of ROS after DPI treatment. In comparison, the group treated with DPI and antibiotics (BBSA + DPI + Ab) displayed a healthy midgut (Figure 9D). The immune status of mosquitoes fed with bacteria with or without DPI was evaluated through gene expression analysis and revealed a complex response to infection. Figures 9E and supplementary figure S9 demonstrates that some anti-microbial genes were up-regulated (cecropin and defensin) while attacin was down-regulated after DPI treatment. This result highlights the complexity of mosquito innate immune response, involving the concerted action of multiple effectors such as ROS and antimicrobial peptides. 10.1371/journal.ppat.1001320.g009 Figure 9 Bacterial infection in the presence of DPI causes cell damage and immune activation in mosquito midgut. Mosquitoes were fed with BBSA with Enterobacter asburiae at a concentration of 4×109 CFU/mL with or without DPI (10 µM). 24 h later midguts were dissected and processed for transmission electron microscopy. (A) Mosquitoes infected with bacteria only. (B) Mosquitoes infected with bacteria + DPI (10 µM) to reduce ROS. (C) Mosquitoes fed with BBSA + DPI. (D) Mosquitoes fed with BBSA + DPI + antibiotics (penicillin/streptomycin/tetracycline – 200 U/mL, 200 µg/mL, 100 µg/mL, respectively). All the scale bars represent 2 µm. (E) Gene expression analysis of whole body (minus head) mosquitoes 24 h after feeding with BBSA + bacteria + DPI. Dashed line indicates gene expression of mosquitoes fed with BBSA + bacteria (without DPI). Different classes of immune genes are indicated with colors. Discussion Overall the data shows that ROS are continuously present in the midgut of sugar-fed Aedes aegypti female mosquitoes and that a blood meal immediately decreased ROS through a mechanism that involves heme-mediated PKC activation. This event occurred in parallel to the expansion of gut bacterial levels, which led the hypothesis that ROS is involved in the control midgut bacteria. The presence of heme or silencing of Duox resulted in decreased ROS levels and increased proliferation of endogenous bacteria. Finally, using a model of bacterial infection in the gut, we showed that the absence of ROS resulted in decreased mosquito resistance to infection and increased mortality. Gut epithelial cells constitute the surface of the body of all metazoans most exposed to contact with microorganisms. These microorganisms comprise a variety of species and ecological relationships, from symbiosis to pathogenicity, and an array of immunological mechanisms essential for the control of the intestinal microbial population have been described. The production of reactive species is one of the key players in gut immunity. Ha et al. [5], [6] showed that the redox balance in the gastrointestinal tract of Drosophila melanogaster is a major microbial control system, determining whether a fly lives or dies after oral infection with bacteria. Two components have been identified, a Duox enzyme that generates ROS to oxidize and kill microbes, and an immune-regulated extracellular catalase that removes any excess of luminal ROS that might harm the gut epithelia of the fly. In the malaria vector, the mosquito Anopheles gambiae, it was recently described that after a blood meal the concerted action of Duox and a peroxidase is required to form a dityrosine barrier that decreases midgut permeability to bacterial elicitors, preventing immune activation and creating a favorable environment for plasmodium development [11]. In addition, control of levels of hydrogen peroxide seems to directly modulate the immune responses against both bacteria and Plasmodium [10]. Similar ROS-mediated immune responses have been described in Caenorhabditis elegans [37] and Manduca sexta [38]. Here, we provide for the first time direct evidence that in Aedes aegypti superoxide anion – and hence hydrogen peroxide – is produced by epithelial cells and secreted into the lumen of the midgut (Figures 1 and 2). ROS levels were inversely correlated with the occurrence of bacteria in the midgut (Figure 1, 5, 6 and 7), and the presence of ROS increased mosquito survival after an oral challenge with bacteria (Figure 8). However, a unique feature of the mosquito midgut is that a dramatic decrease in ROS levels occurs after a blood meal (Figures 1). If sugar-fed mosquitoes adopt the same pattern of intestinal immunity as in other insects, it is not clear why they should behave differently after a blood meal, renouncing the use of ROS as a major weapon to regulate the growth of gut bacteria. The explanation probably resides in the fact that the pro-oxidant activity of heme released in the gut upon digestion of hemoglobin interacts and converts lipid hydroperoxides (ROOH), which exhibit quite low reactivity, into the highly reactive peroxyl (ROO−•) and alcoxyl (RO−•) radicals that have very pronounced cytotoxicity [39]–[41]. Lipid hydroperoxides are normally produced due to abstraction of electrons from lipids by reactive species produced by metabolic pathways, such as respiration in mitochondria, or as a consequence of immune-related oxidase action. Therefore, heme alone does not generate ROS; it only converts pre-formed oxidized molecules back into highly reactive intermediates in the lipid peroxidation chain, thus acting as a catalyst for the formation of potentially toxic radicals. Thus, we propose that after blood feeding, Aedes aegypti shuts down ROS generation to avoid heme-mediated oxidative stress. Consequently, ROS-based immunity is greatly reduced after a blood meal, contributing to bacterial proliferation. Recognizing this phenomenon as an important adaptation that attenuates heme toxicity led us to investigate the signaling mechanism triggering the down-regulation of ROS after a blood meal. Midgut distention can be excluded as a potential mechanism because fully engorged insects fed with BBSA showed intense CM-H2DCFDA fluorescence (Figure 3C). Although hemoglobin is able to decrease ROS, heme alone can account for down-regulation of ROS levels (Figure 3, panel H). The fact that this effect is observed upon early exposure to the incoming diet (<20 min) excluded mechanisms based on modification of gene expression and led us to search for the involvement of protein kinases, a hypothesis that was confirmed by preventing the heme-mediated suppression of ROS with a PKC inhibitor (Figure 4E) and by mimicking the effect of heme using a PKC activator (Figure 4G). In this regard, heme-induced reduction in ROS levels was only found when heme was located in the apical (Figure 4D) but not the basal side of the midgut epithelial cells (Figure 4B), revealing that this signaling pathway was triggered specifically through a mechanism that activated PKC after sensing heme in the lumen, which was achieved by feeding, but not by incubating heme in the culture medium. Alternatively, we cannot exclude the possibility that the result obtained in Figure 4B may reveal that the gut does not respond to heme in vitro. It was already shown that the synthesis of uric acid by Rhodnius prolixus fat body could be triggered by heme through activation of PKC [42], suggesting conservation of this signaling pathway. Activation of PKC by heme modulates ROS production in human neutrophils [43], [44]. Curiously, in these cells heme was a positive effector of ROS production, suggesting that, although the heme capacity to activate PKC is probably conserved in this signaling pathway, a modification downstream of this protein kinase leads to suppression of ROS in the mosquito midgut instead of activation. This hypothesis is a major target for future research. Gut bacteria experience an explosion in growth after ingestion of a blood meal by a mosquito (Figure 5). A simple explanation would be that the proliferation of bacteria after blood feeding is favored by the increase in availability of nutrients compared to sugar-fed mosquitoes (data not shown). Our data suggest that bacterial proliferation is also stimulated by the down-regulation of ROS levels. In spite of the fact that the reduction in ROS levels was sufficient to increase the gut flora, none of these treatments was able to allow the growth of endogenous bacteria to levels found after a blood-meal (100–1000 times more bacteria), probably due to the lack of nutrient supply to support microbial growth. This conclusion is further supported by the data in Figure 6 and 7, where reduced ROS levels due to the presence of heme or RNAi-mediated silencing of Duox resulted in proliferation of endogenous bacteria. ROS reduction occurring in the presence of ascorbate or DPI, 2 unrelated antioxidants that decrease ROS levels through different modes of action (Figure 8), also resulted in increased bacterial proliferation, leading to tissue damage and increased mortality in insects given a sub-lethal dose of a bacterial species naturally found in the gut. A large amount of work has been done on invertebrate immunity, especially in Drosophila melanogaster and mosquitoes, since the discovery that Toll and IMD pathways play a paramount role in the defense against invading microorganisms [45], [46]. However, knockout of the IMD pathway alone in Drosophila leads only to modest alterations in survival when infected orally with ROS-susceptible bacteria [5], but this NF-κB pathway was essential in insects challenged with ROS-resistant microbes [47]. In this regard, it is interesting that the bacteria we used, an Enterobacter (Gram-negative) isolated from the midgut, whose growth was favored by reduced ROS levels (Figure 8), had low levels of catalase (data not shown) similar to most species of this genus [48], and was also found in the gut of Anopheles gambiae (3) In a similar way to that described for Drosophila [47], the immune response triggered in our infection system was not entirely based on production of ROS, but included the up-regulation of the antimicrobial peptides, cecropin and defensin (Figure 9E), known to be part of the IMD pathway [49], and are responsive to Gram-negative (G-) bacterial infection [50]. However, not all genes related to immune response behave in the same way and several genes did not show significant activation. Reduced expression of attacin, which is involved in the defense against gram-negative bacteria [51], [52], prompts us to speculate that attacin down-regulation may be part of the pathophysiological mechanism(s) involved in increased mosquito mortality. When ROS production was blocked by DPI, there was bacterial proliferation in the gut and several antimicrobial genes were up-regulated (Figure 9E and S9), in a possible attempt to reduce tissue damage induced by the bacteria. Immune genes are overexpressed after a blood meal (data not shown) and this could compensate for reduction of ROS levels reported here, explaining why mosquitoes do not die after blood intake, in spite of having increased bacteria proliferation together with the lack of a major antibacterial mechanism. Taken together, these results highlight a complex effect of the blood meal on the immune regulation network. This work has several consequences for the biology of insects that are vectors of disease. One is that a similar phenomenon may operate in the guts of other blood-feeding insects, a possibility currently being studied in our laboratory. The other is that it has the potential to influence infection rates of pathogens transmitted by insect vectors. In fact, a strain of Anopheles gambiae that is refractory to Plasmodium infection lives in a chronic state of oxidative stress [9]. At first glance, one might expect that the decrease in midgut ROS levels after blood meal would be beneficial for the establishment of viral or protozoan infections. However, this situation allows bacterial growth a condition that antagonizes Dengue and Plasmodium infections [2], [3]. Our results are also in line with the hypothesis we proposed a few years ago, namely, that while degrading hemoglobin, some hematophagous organisms such as the blood fluke, Schistosoma mansoni, and Plasmodium parasites decrease ROS generation by shifting energy metabolism to a glycolysis-based anaerobic mode in order to avoid heme-induced oxidative stress [53]. Interestingly, this effect seems to not only affect the midgut but also may constitute a systemic trend, because respiration and H2O2 generation in Aedes flight muscle mitochondria are also reduced following a blood meal [27]. Our data provide a novel view of ROS production in the midgut of a disease vector, highlighting the complexity of the mosquito immune response, where the decrease in ROS generation that comes with hematophagy creates a favorable environment for bacterial proliferation, with possible implications for a better understanding of molecular mechanisms that influence vector competence. Supporting Information Figure S1 Modulation of superoxide radical by DPI and PEG-SOD. Sugar-fed midguts were pre-incubated in the presence of either PEG-SOD (100 U/mL) (Sigma) or DPI (25 µM) for 30 min and transferred to medium with DHE for 20 min; the DHE oxidation products were measured by HPLC. * P<0.0001 for the comparison between sugar and sugar + PEG-SOD or Sugar + DPI (ANOVA, followed by Dunnetts multiple comparison test). (0.49 MB TIF) Click here for additional data file. Figure S2 Nitric oxide synthase and xanthine oxidase inhibitors do not decrease ROS in sugar-fed midguts. (A) L-NAME (1 mg/mL) or (B) allopurinol (500 µM) was added to sugar-fed midgut cultures for 1 h at room temperature, and ROS levels were evaluated under the microscope using CM-H2DCFDA. (1.27 MB TIF) Click here for additional data file. Figure S3 ROS produced by midgut epithelial cells is released into the lumen in sugar-fed mosquitoes. (A) ROS staining with CM-H2DCFDA in the midgut of sugar-fed mosquitoes. The image shows a longitudinal optical section of the midgut. Scale bar- 50 µm. Black asterisk indicates an air bubble in the gut lumen. (B) The same experimental setup as in “A” showing the gut at a lower magnification. Blue represents DAPI (nuclear stain). Scale bar - 20 µm (1.18 MB TIF) Click here for additional data file. Figure S4 ROS modulation by different antioxidants. Female mosquitoes were fed with BBSA alone (A) or BBSA supplemented with 20 mM N-acetyl-cysteine (NAC) (B) (solubilized in 200 mM Tris-buffer) or 500 µM urate (C) and immediately dissected. ROS levels were determined based on CM-H2DCFDA fluorescence. Scale bar represents 100 µm. (2.03 MB TIF) Click here for additional data file. Figure S5 Differential interference contrast images of midguts from experiment shown in Figure 4. (1.46 MB TIF) Click here for additional data file. Figure S6 16S DNA gene sequence from Enterobacter asburiae isolated from the midgut of Aedes aegypti. Females had their midguts dissected 6 h after a blood meal before being plated on LB agar. One colony with low catalase activity was isolated; PCR of the 16S gene was performed after DNA extraction and the sequencing data are shown. BLAST analysis of the 1026-bp fragment allowed identification of the bacterial colony as Enterobacter asburiae (accession number AJ506159), a gram-negative bacteria known to be weakly reactive to the catalase test [48]. (2.06 MB TIF) Click here for additional data file. Figure S7 Mosquitoes were fed ad libitum with sucrose 5% supplemented 10 µM DPI for 5 days and RNA was extracted from the midgut and processed for 16S quantification through qPCR. (0.27 MB TIF) Click here for additional data file. Figure S8 Transmission electron microscopy from the bacterial population typically found in the gut of Aedes aegypti 24 hours after feeding mosquitoes with BBSA + Enterobacter asburiae + DPI (left) or BBSA + DPI (right). (0.67 MB TIF) Click here for additional data file. Figure S9 Mosquitoes were fed with BBSA + DPI (10 µM) or BBSA + DPI + antibiotics (penicillin/streptomycin/tetracycline). 24 h later RNA from whole body (minus head) was extracted and gene expression was performed by qPCR. Dashed line indicates gene expression of mosquitoes fed with BBSA + bacteria (without DPI), similar to Figure 9E. Different classes of immune genes are indicated with colors. * P<0.05, ** P<0.01. *** P<0.0001 after t-test comparing each condition with mosquitoes fed with BBSA + bacteria (without DPI). (1.31 MB TIF) Click here for additional data file.
- Record: found
- Abstract: found
- Article: found
Anopheles gambiae PGRPLC-Mediated Defense against Bacteria Modulates Infections with Malaria Parasites
Stephan Meister, Bogos Agianian, Fanny Turlure … (2009)
Introduction Immune signaling is triggered by recognition of molecular patterns that are common in microbes but absent from the host. PGN is a cell wall component of Gram+ and Gram− bacteria and bacilli, but its amount, sub-cellular localization and specific composition vary between different bacteria, and may set the basis for specific recognition by PGN recognition proteins such as PGRPs. These proteins share a conserved PGRP domain that is similar to the T7 lysozyme. The Drosophila melanogaster PGRP-SA [1] and PGRP-SD [2] are essential for activation of Toll signaling. In contrast, PGRP-LC [3],[4] and PGRP-LE [5] trigger Imd pathway activation. The PGRP-LC gene encodes three PGRP ectodomains, each of which fuses by alternative splicing to an invariant part, generating three distinct isoforms: PGRP-LCx, -LCy and -LCa. The intracellular invariant part encompasses an IMD interaction domain and a receptor-interacting protein homotypic interaction motif (RHIM)-like motif, which mediate contact with the IMD receptor-adaptor protein [6] and perhaps an unknown factor, respectively [5], to initiate signal transduction. Several studies have provided novel, important insights into the structural basis of PGN recognition by PGRPs. Crystal structures have been determined for six Drosophila PGRPs [7],[8],[9],[10],[11],[12],[13], including PGRP-LE and the heterodimer PGRP-LCx/LCa in complex with monomeric meso-diaminopimelic acid (DAP)-type PGN, which is released mostly from Gram− bacteria during PGN turnover and is known as tracheal cytotoxin (TCT). These structures suggest that PGRP-LCx is sufficient for Imd pathway activation by polymeric DAP-type PGN, whereas heterodimerization with PGRP-LCa is required for response to monomeric PGN [14],[15]. PGRP-LCa itself is unable to bind PGN and its suggested role is to “lock” PGRP-LCx in a monomeric PGN binding mode. Anopheles gambiae, the major mosquito vector of human malaria in Africa, encodes seven PGRPs, five of which (LA, LB, LC, LD and S1) are orthologous to Drosophila PGRPs [16]. Similar to its fly ortholog, PGRPLC encompasses three PGRP domains (LC1, LC2 and LC3) that are utilized via alternative splicing for production of three main protein isoforms [16],[17]. Here, we investigate the role of PGRPLC in mosquito infections with bacteria and malaria parasites. Theoretical structural modeling indicates that PGRPLC can recognize PGN from both Gram+ Staphylococcus aureus and Gram− Escherichia coli bacteria, and experimental results demonstrate that indeed PGRPLC mediates resistance against such infections. PGRPLC3 is a key modulator of these reactions. The structural modeling data suggest that, upon monomeric PGN binding, PGRPLC3 may lock other PGRPLC isoforms in binary immunostimulatory complexes, through a mechanism that differs significantly from that employed by Drosophila PGRP-LCa. PGRPLC3 can also sequester monomeric PGN perhaps to prevent unnecessary immune activation during low infections. Importantly, PGRPLC signaling modulates the intensity of mosquito infections with human and rodent malaria parasites. We also demonstrate that PGRPLC initiates responses against microbiota and bacterial infections of the midgut. In female mosquitoes, the size of the midgut bacterial communities substantially increase after a bloodmeal, causing further activation of PGRPLC signaling that appears to consequently affect the parasite infection intensities. Results PGRPLC is required for resistance to bacterial infections We injected dsRNA into newly emerged adult female A. gambiae to silence by RNAi the expression of corresponding PGRP genes. Four days later, the mosquitoes were infected with E. coli or S. aureus, two bacteria species with different types of PGN: DAP and Lysine (Lys)-type PGN, respectively. The survival of these mosquitoes was monitored daily and compared to the survival of GFP dsRNA-injected controls using Log-rank and Gehan-Breslow-Wilcoxon tests of survival curves. PGRPLC silencing had a pronounced effect (P 20 gametocytes/µl was drawn by venipuncture. The serum was separated by centrifugation and replaced by non-immune AB serum. Mosquitoes were fed for 30 min on a 38°C-warm blood feeder. Midguts dissected 8 days later were stained with 0.4% Mercurochrome and developing oocysts were counted. Statistical analysis Anopheles and Drosophila survival after infections with bacteria were analyzed using the Log-rank (Mantel-Cox) and Gehan-Breslow-Wilcoxon tests of the statistical package Prism version 5.0 (GraphPad Software Inc.). Survival rates at the various time points were averaged between biological replicates after being transformed into percentages, and average survival curves were constructed and compared. The median of Plasmodium infection densities were analyzed using the non-parametric Mann Whitney test of Prism version 5.0, and the prevalence of infection and melanized ookinetes were analyzed using the Fisher's exact test. Homology modeling and DAP/Lys-PGN docking Homology models were constructed in SwissModel after structural alignment of PGRP domains with Tcoffee [43] followed by manual adjustments. PD-loop modeling and optimization was performed in MODELLER 9v1 using the Discrete Optimized Protein Energy method [44]. PD-loop prediction methods included: a template-based protocol in Robetta (http://robetta.bakerlab.org) which uses the de novo Rosetta fragment insertion method [45]; and an implementation of ARIA [46], applying a Cartesian MD and simulated annealing protocol with a high-temperature torsion angle dynamics (TAD) stage (2000 K, 36 ps), two cooling steps (2000 to 1000 K over 30 ps and 1000 to 50 K over 24 ps) and a final energy minimization (200 steps) of the MODELLER-derived PD-loop model while all other atomic positions were restrained. An ensemble of 100 loop conformers was calculated and 10 conformers with the lowest total energy were analyzed. To model TCT binding, TCT was docked in the PGN-binding groove of AgPGRP models according to its binding position in PGRP-LCx-TCT-LCa. TCT-protein interactions were optimized manually using O [47] and the Penultimate rotamer library [48] for putative side chain interactions. The conformation of identical TCT-interacting residues in AgPGRP models and PGRP-LCx was not changed and the side-chain χ1 angles of non-identical residues were maintained when possible. TCT torsions were allowed only to relieved clashes and did not compromise predicted binding. Liganded models were subjected to 200 cycles of conjugate gradient energy minimization in CNSsolve1.2 [49]. Similar steps were followed to model Lys-PGN binding, using a complex structure of hPGRP-IαC with a Lys-type MTP [50]. Model quality and intermolecular clashes analysis were performed with PROCHECK [51] and MolProbity [52]. Ligand-protein interactions were analyzed with LIGPLOT [53]. Final models had good stereochemistry without residues in non-permissive areas of Ramachandran plots. Modeling heterodimerization To obtain AgPGRPLC/a models, the portions of helix α2 and N-term segment of LCa mediating contacts with LCx were modeled using SwissModel to map corresponding AgPGRPLC sequences, which accounted for induced fit upon dimerization. Side-chain conformations of identical residues at the dimer interface were altered only if necessary for non-identical residues by manual manipulations in O. AgPGRPLC/a models were positioned by superimposing backbone atoms of helix α2 and the N-term of AgPGRPLC/x models onto the corresponding regions of LCa using LSQMAN [54]. Inter-monomer contact analysis was performed with LIGPLOT and MolProbity. Figures were generated with Pymol [55]. Supporting Information Text S1 AgPGRPLC-TCT and AgPGRPLC-Lys complexes, and TCT-mediated AgPGRPLC heterodimers. (0.12 MB PDF) Click here for additional data file. Table S1 Oligonucleotide primers used in PCR and RT-PCR reactions. (0.08 MB PDF) Click here for additional data file. Table S2 Interactions in AgPGRPLC1-MTP/TCT model structures. (0.08 MB PDF) Click here for additional data file. Table S3 Interactions in AgPGRPLC2-MTP/TCT model structures. (0.08 MB PDF) Click here for additional data file. Table S4 Interactions in AgPGRPLC3-MTP/TCT model structures. (0.08 MB PDF) Click here for additional data file. Figure S1 Injection of bacterial suspensions but not with saline alone causes progressive mosquito mortality. Following the indicated injections in female mosquitoes, survival is recorded daily for 5 days. Mortality is minimal and slow after saline injection alone, but rapid and progressive after S. aureus or E. coli injections. (0.23 MB TIF) Click here for additional data file. Figure S2 Oligonucleotide primers used in PGRPLC PCR and RT-PCR reactions. The relative position and orientation of primers on the PGRPLC genomic locus is shown. Numbers indicate the primer numbers presented in Table S1. (0.21 MB TIF) Click here for additional data file. Figure S3 Amino acid alignment of A. gambiae and D. melanogaster PGRPLC main isoforms. The predicted Imd interaction region in Drosophila (yellow), RHIM-like motifs (blue), transmembrane domains, alternative cassettes (orange) and PGRP domains are shown. Intron positions are indicated with black arrowheads. (0.80 MB TIF) Click here for additional data file. Figure S4 RT-PCR reveals the presence of various PGRPLC isoforms and a pool of unspliced transcripts. Each subpanel (A–J) features a different PCR primer combination and the corresponding gene model prediction. Grey bars above these models represent sequenced RT-PCR products shown on the right side of each panel. (1.78 MB TIF) Click here for additional data file. Figure S5 Efficiency of PGRPLC isoform silencing in A. gambiae. Relative percent expression of each of the three main PGRPLC isoforms quantified by qRT-PCR in adult A. gambiae females silenced for the expression of entire PGRPLC gene or each of the three isoforms. A small increase of LC1 transcript levels in LC3 kd mosquitoes may suggest an effect of silencing on the pool of unspliced transcripts, resulting in upregulation of non-targeted transcripts. (0.72 MB TIF) Click here for additional data file. Figure S6 Blocking phagocytosis does not have a major effect on mosquito survival. (A) Indicative microscopic images of hemocytes in A. gambiaeinjected with PBS (top) or Red amine conjugated polystyrene beads (bottom) and re-injected 24 h later with FITCconjugated E. coli. BF, bright field. (B) Percent survival of mosquitoes subjected to the same procedures as in (A) but injected with live instead of fixed E. coli or S. aureus bacteria. Mortality rates of bead-injected mosquitoes were marginally increased compared to control PBS injected and statistically significant (P<0.05) with the Log rank (Mandel-Cox) and the Gehan-Breslow-Wilcoxon tests in S. aureus, but not in E. coli, infections. The presented survival rates are the average of three independent biological replicates. (1.72 MB TIF) Click here for additional data file. Figure S7 Effect of mosquito midgut infections with different bacteria on P. berghei infection intensities. Median numbers and distribution of P. berghei oocyst intensities in E. coli and S. aureus infected and in control non-infected mosquitoes. Boxes include 50% of the data and whiskers indicate the range in a log10-transformed axis. Median is shown with the bar and number within each box. *, P<0.01; **, P<0.005; N, numbers of mosquitoes. (0.72 MB TIF) Click here for additional data file. Figure S8 Structure-based multiple alignment of A. gambiae (red) and D. melanogaster (blue) PGRP domains. The secondary structure of PGRP-LCx in the DmPGRP-LCx-TCT-LCa complex is shown above sequences. Asterisks next to PGRP names indicate predicted or experimentally validated amidase activity. Known preferences of PGRPs to Lys and DAP-type PGN are noted. Purple triangles indicate residues implicated in zinc coordination and stars mark catalytically important residues in T7 lysozyme. Brown triangles indicate residues of DmPGRP-LCx that interact with TCT in DmPGRP-LCx-TCT-LCa complex. Green and blue triangles show residues that interact with MTP and shape the PGN binding pocket, respectively, in human PGRP-IaC. Green lines indicate cysteines involved in disulfide bridges. (1.36 MB TIF) Click here for additional data file. Figure S9 Surface view of AgPGRPLC models in complex with Lys- and DAP-type PGN. The Lys-type muramyl peptide MurNac-L-Ala-D-isoGln-L-Lys (A, B, C) and the DAP-type PGN fragment TCT (D, E, F) are shown in sticks docked to their predicted binding positions in the PGN-binding grooves of AgPGRPLC1, LC2 and LC3, respectively. Secondary-structure elements are visible under semi-transparent surfaces. (6.58 MB TIF) Click here for additional data file. Figure S10 Schematic hypothetical model for the role of PGRPLC3 in modulating immune signaling. (A) Low amounts of PGN are sequestered on the cell surface by the abundant PGRPLC3 that cannot induce dimerization thus dampening the signal. (B) Other PGRPLC isoforms are also engaged in binding PGN that is in high concentrations during high infections and initiate dimerization with PGRPLC3, which thereby locks these isoforms in immunostimulatory dimeric complexes. (0.82 MB TIF) Click here for additional data file.
Author and article information
Contributors
: Role: Editor
Journal
Journal ID (nlm-ta): PLoS Pathog
Journal ID (publisher-id): plos
Journal ID (pmc): plospath
Title:
PLoS Pathogens
Publisher:
Public Library of Science
(San Francisco, USA
)
ISSN
(Print):
1553-7366
ISSN
(Electronic):
1553-7374
Publication date Collection:
October
2011
Publication date
(Print):
October
2011
Publication date
(Electronic):
6
October
2011
Volume: 7
Issue: 10
Electronic Location Identifier: e1002274
Affiliations
Author notes
* E-mail:
mrstrand@
123456uga.edu
Article
Publisher ID: PPATHOGENS-D-11-01098DOI: 10.1371/journal.ppat.1002274
PMC ID: 3188524
PubMed ID: 21998579
SO-VID: 211986f4-cf4a-40fc-b476-d431325a80f4
Copyright © Castillo et al. This is an open-access article distributed under the terms of the
Creative Commons Attribution License, which permits unrestricted use, distribution,
and reproduction in any medium, provided the original author and source are credited.
History
Date
received
: 26
May
2011
Date
accepted
: 1
August
2011
Page count
Pages: 13
Categories
Subject:
Research Article
Subject:
Biology
Subject:
Anatomy and Physiology
Subject:
Endocrine System
Subject:
Endocrine Physiology
Subject:
Immunology
Subject:
Immunity
Subject:
Immunity to Infections
Subject:
Innate Immunity
Subject:
Microbiology
Subject:
Vector Biology
Subject:
Mosquitoes
ScienceOpen disciplines: Infectious disease & Microbiology
Data availability:
ScienceOpen disciplines: Infectious disease & Microbiology