Cardiovascular Activity

Abstract

Cardiovascular Analysis A.1.1 In Vitro Methods A.1.1.1 α1-Adrenoreceptor Binding PURPOSE AND RATIONALE α 1-adrenoceptors are widely distributed and are activated either by norepinephrine released from sympathetic nerve terminals or by epinephrine released from the adrenal medulla. Receptor activation mediates a variety of functions, including contraction of smooth muscle, cardiac stimulation, cellular proliferation and activation of hepatic gluconeogenesis and glycolysis. In the CNS, the activation of α 1-adrenoceptors results in depolarization and increased neuronal firing rate. The α-adrenoreceptor population of plasma membranes from rat heart ventricles consists only of the α1-adrenoreceptor subtype. A constant concentration of the radioligand 3H-prazosin (0.2–0.3 nM) is incubated with increasing concentrations of a non-labeled test drug (0.1 nM–1 mM) in the presence of plasma membranes from rat heart ventricles. If the test drug exhibits any affinity to α-adrenoceptors, it is able to compete with the radioligand for receptor binding äsites. Thus, the lower the concentration range of the test drug, in which the competition reaction occurs, the more potent is the test drug. The assay is used to evaluate the concentrationbinding characteristics of drugs atria the α 1-adrenoceptor. PROCEDURE Solutions preparation buffer A: MgCl2 × 6H2O 5 mM MgCl2 × 6H2O 1 mM D(+)-sucrose 250 mM pH 7.4 preparation buffer B ( = rinse buffer): Tris–HCl 50 mM MgCl2 × 6H2O 10 mM pH 7.4 incubation buffer: Tris–HCl 50 mM MgCl2 × 6H2O 10 mM ascorbic acid 1.6 mM catechol 0.3 mM pH 7.4 radioligand: 3H-prazosin × HCl specific activity 0.37–1.11 TBq/mmol (10–30 Ci/mmol) (NEN) Tissue Preparation Male Sprague–Dawley rats (200–300 g) are sacrificed by decapitation and the dissected hearts are placed in ice-cold preparation bufferA. After removal of the atria, ventricles (approx. 30 g from 40 rats) are minced with a scalpel into 2–3 mm pieces. Membrane Preparation Ventricles are homogenized by Ultra-Turrax (1 g tissue/ 20 ml preparation buffer A), the homogenate is filtered through gauze, and centrifuged at 2000 g (4 °C) for 10 min. The pellets are discarded; the supernatant is collected, and centrifuged again at 40,000 g for 20 min. The resulting pellets are resuspended in approx. 300 ml preparation buffer B, homogenized by Ultra-Turrax and centrifuged as before. The final pellets are dissolved (by Ultra-Turrax) in preparation buffer B, corresponding to 1 g ventricle wet weight/4 ml buffer. The membrane suspension is immediately stored in aliquots of 5–20 ml at −77 °C. Protein content of the membrane suspension is determined according to the method of Lowry et al. with bovine serum albumin as a standard. At the day of the experiment the required volume of the membrane suspension is slowly thawed and centrifuged at 40,000 g (4 °C) for 20 min. The pellets are resuspended in a volume of ice-cold rinse buffer, yielding a membrane suspension with a protein content of 1.0–1.5 mg/ml. After homogenization by Ultra-Turrax, the membrane suspension is stirred under cooling for 20–30 min until the start of the experiment. Experimental Course For each concentration samples are prepared in triplicate. The total volume of each incubation sample is 200 μl (microtiter plates). Saturation Experiments total binding: 50 μl 3H-prazosin (12 concentrations, 5 × 10−11–5 × 10–9 M) 50 μl incubation buffer non-specific binding: 50 μl 3H-prazosin (4 concentrations, 5 × 10−11– × 10−9 M) 50 μl phentolamine (10–5 M) Competition Experiments 50 μl 3H-prazosin (1 constant concentration, 2–3 × 10–10 M) 50 μl incubation buffer without or with non-labeled test drug (15 concentrations, 10−10–10−3 M) The binding reaction is started by adding 100 μl membrane suspension per incubation sample (1.0–1.5 mg protein/ml). The samples are incubated for 30 min in a shaking bath at 25 °C. The reaction is stopped by withdrawing the total incubation volume by rapid vacuum filtration over glass fiber filters. Thereby the membrane bound radioactivity is separated from the free activity. Filters are washed immediately with approx. 20 ml ice-cold rinse buffer per sample. The retained membrane-bound radioactivity on the filter is measured after addition of 2 ml liquid scintillation cocktail per sample in a liquid scintillation counter. EVALUATION The following parameters are calculated: total binding non-specific binding specific binding = total binding–non-specific binding The dissociation constant (K i) of the test drug is determined from the competition experiment of 3Hprazosin versus non-labeled drug by a computer-supported analysis of the binding data. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ K_{\rm i} = \frac{{K_{\rm D} \;^3 {\rm H} \times {\rm IC}^{50} }}{{K_{\rm D} \;^3 {\rm H} + \left[ {^3 {\rm H}} \right]}} $$\end{document} IC 50 = concentration of the test drug, which competes 50 % of specifically bound 3H-prazosin in the competition experiment [3H] = concentration of 3H-prazosin in the competition experiment. KD 3H = dissociation constant of 3H-prazosin, determined from the saturation experiment. The K i-value of the test drug is the concentration, at which 50 % of the receptors are occupied by the test drug. The affinity constant K i [mol/l] is recorded and serves as a parameter to assess the efficacy of the test drug. MODIFICATION OF THE METHOD Binding of 3H-WB 4101 to α1-adrenergic receptors in brain is used to test hypotensive activity as a possible side effect of neuroleptic drugs. The test E.5.1.6 is described in the chapter on neuroleptic activity. Couldwell et al. (1993) found that the rat prostate gland possesses a typical α 1-adrenoceptor similar to that found in the vas deferens. SUBTYPES OF THE α 1-ADRENOCEPTOR Several subtypes of the α 1-adrenoceptor have been identified by pharmacological means (α 1A and α 1B, α 1C, α 1D; α 1H, α 1L and α 1N adrenoceptors; Endoh et al. 1992; García-Sáinz et al. 1992, 1993; Ohmura et al. 1992; Regan and Cotecchia 1992; Satoh et al. 1992; Schwinn and Lomasney 1992; Veenstra et al. 1992; Aboud et al. 1993; Oshita et al. 1993; Vargas et al. 1993; Ruffolo et al. 1994; Minneman and Esbenshade 1994; Alexander et al. 2001) or by recombinant technology (α 1a/d, α 1b, α 1c adrenoceptors). They correspond to the pharmacologically defined α 1A, α 1B,and α 1D adrenoceptors in native tissues (Bylund et al. 1994, 1998; Hieble et al. 1995; Graham et al. 1996; Hieble and Ruffolo 1996; Alexander et al. 2001; Hawrylyshyn et al. 2004; Waitling 2006). Binding of the radioligand [3H]-prazosin to the α 1A-adrenoceptor subtype can be measured in membranes prepared from male Wistar rat submaxillary glands (Michel et al. 1989). Binding of the radioligand [3H]-prazosin to the α 1B-adrenoceptor subtype can be measured in membranes prepared from male Wistar rat livers (Adolfo et al. 1989). According to Eltze and Boer (1992), the adrenoceptor agonist SDZ NVI 085 discriminates between α 1Aand α 1B adrenoceptor subtypes in vas deferens, kidney and aorta of the rat and may therefore be used as a tool either to detect (rat vas deferens or kidney) or exclude (rat aorta) the functional involvement of “α 1A-adrenoceptors in smooth muscle contraction.”. Stam et al. (1998) found that (+)-cyclazosin, which behaves as a selective, high-affinity α 1B-adrenoceptor ligand in binding experiments, did not show the profile of a α 1B-adrenoceptor antagonist in functional tissues. Decreased blood pressure response in mice deficient of the α 1b-adrenergic receptor was found by Cavalli t al. (1997). Kenny et al. (1995) used the contractile response of rat aorta to adrenaline after the application of various α 1- adrenoceptor antagonists for characterization of a α 1D-adrenoceptor. A.1.1.2 α 2-Adrenoreceptor Binding PURPOSE AND RATIONALE α 2-adrenoceptors are widely distributed and are activated by norepinephrine released from sympathetic nerve terminals or by epinephrine released from the adrenal medulla or from some neurons in the CNS. The most extensively characterized action is the prejunctionally mediated inhibition of the release of neurotransmitters from many peripheral and central neurons. α 2-adrenoceptors are also present at postjunctional sites, where theymediate actions such as smooth muscle contraction, platelet aggregation and inhibition of insulin secretion. Activation of postsynaptic α 2-adrenoceptors in the brainstem results in an inhibition of sympathetic outflow in the periphery. Clonidine is a centrally-acting antihypertensive agent, which lowers blood pressure mostly through reducing sympathetic tone by acting at the nucleus tractus solitarius in the brain stem (Kobinger and Walland 1967). Clonidine can, however, act at both peripheral and central α 2-receptors. Peripherally administered clonidine causes a brief increase in blood pressure followed by a prolonged decrease (Rand andWilson 1968). Functional studies (3H-NE release) indicate a presynaptic mechanism for clonidine (Langer 1977, 1981; Starke 1977). However, lesioning studies fail to confirm a presynaptic location for clonidine receptors in either the CNS or periphery (U’Prichard et al. 1979; Bylund and Martinez 1981; U’Prichard et al. 1980). No change in clonidine receptor sites was seen after 6- hydroxydopamine lesions in cerebral cortex. This may be due to the fact that α 2-receptors are both pre- and postsynaptic (Hieble et al. 1988). Alpha-adrenergic agonists most potently displace 3H-clonidine. Ergot compounds, dopamine agonists and mianserin are also fairly potent (U’Prichard et al. 1977). A survey on functions mediated by alpha-2 adrenergic receptors was given by Ruffolo et al. (1988) and on the role of neurotransmitters in the central regulation of the cardiovascular system by McCall (1990). Although clonidine relieves the autonomic symptoms of morphine withdrawal (Gold et al. 1978), there is no evidence for a direct α 2/opiate-receptor interaction. The purpose of this assay is to assess the interaction of hypotensive agents with central α 2-receptors and determine possible clonidine-like mechanisms of action. Clonidine binding may also be relevant to the activity of other classes of drugs such as antidepressants that interact with α 2-receptors. PROCEDURE Reagents Tris buffer pH 7.7 57.2 g Tris HCl q.s. to 1 liter (0.5 M Tris buffer, pH 7.7) 16.2 g Tris base make a 1:10 dilution in distilled H2O (0.05 M Tris buffer, pH7.7) Tris buffer containing physiological ions Stock buffer NaCl 7.014 g KCl 0.372 g CaCl2 0.222 g MgCl2 0.204 g q.s to 100 ml in 0.5 M Tris buffer Dilute 1:10 in distilled H2O. This yields 0.05 M Tris HCl, pH7.7; containing NaCl (120 mM), KCl (5 mM), CaCl2 (2 mM) and MgCl2 (1 mM) [4-3H]-Clonidine hydrochloride (20–30 Ci/mmol) is obtained from New England Nuclear. For IC 50 determinations: 3H-Clonidine is made up to a concentration of 120nM and 50 μl are added to each tube (yielding a final concentration of 3nM in the 2 ml volume assay). Clonidine-HCl is obtained from Boehringer Ingelheim. A stock solution of 0.1 mM clonidine is made up to determine non-specific binding. This yields a final concentration of 1 μM in the assay (20 μl to 2 ml). Test compounds: For most assays, a 1 mM stock solution is made up in a suitable solvent and serially diluted, so that the final concentrations in the assay range from 10–5 to 10–8 M. Seven concentrations are used for each assay and higher or lower concentrations can be used, depending on the potency of the drug. Tissue Preparation Male Wistar rats are sacrificed by decapitation and the cortical tissue is rapidly dissected. The tissue is homogenized in 50 volumes of 0.05 M Tris buffer pH 7.7 (buffer 1b) with the Brinkman Polytron, and centrifuged at 40,000 g for 15 min. The supernatant 50 volumes of buffer 2b. This tissue suspension is then stored on ice. The final tissue concentration is 10 mg/ml. Specific binding is 1 % of the total added ligand and 80 % of total bound ligand. Assay 100 μl 0.5 M Tris – physiological salts pH 7.7 (buffer 2a) 830 μl H2O 20 μl Vehicle (for total binding) or 0.1 mM clonidine (for nonspecific binding) or appropriate drug concentration. 50 μl 3H-clonidine stock solution 1000 μl tissue suspension. Tissue homogenates are incubated for 20 min at 25 °C with 3 nM 3H-clonidine and varying drug concentrations, and immediately filtered under reduced pressure on Whatman GF-B filters. The filters are washed with 3 five ml volumes of 0.05 M Tris buffer pH7.7, and transferred to scintillation vials. Specific clonidine binding is defined as the difference between total bound radioactivity and that bound in the presence of 1 μM clonidine. EVALUATION IC 50 calculations are performed using log-probit analysis. The percent inhibition at each drug concentration is the mean of triplicate determinations. MODIFICATIONS OF THE METHOD Perry and U’Prichard (1981) described [3H]rauwolscine (α-yohimbine) as a specific radioligand for brain α 2-adrenergic receptors. Goldberg and Robertson (1983) reviewed yohimbine as a pharmacological probe for the study of the α 2-adrenoreceptor. Pimoule et al. (1983) characterized [3H]RX 781094 [(imidazolinyl-2)-2benzodioxane-1,4] as a specific α 2-adrenoceptor antagonist radioligand. Murphy and Bylund (1988) characterized alpha-2 adrenergic receptors in the OK cell, an opossum kidney cell line. Binding of the radioligand [3H]-rauwolscine to the α 2A-adrenoceptor subtype can be measured in membranes prepared from rabbit spleens (Michel et al. 1989). Binding of the radioligand [3H]-yohimbine to the α 2B-adrenoceptor subtype can be measured in membranes prepared from male Wistar rat kidney cortices (Connaughton and Docherty 1989). SUBTYPES OF THE α 2-ADRENOCEPTOR Using 3H-rauwolscine as ligand Broadhurst et al. (1988) studied the existence of two alpha2-adrenoreceptor subtypes. Bylund et al. (1988) used [3H]-yohimbine and [3H]- rauwolscine to study alpha-2A and alpha-2B adrenergic subtypes in tissues and cell lines containing only one subtype. Brown et al. (1990) found that [3H]-yohimbine labels at α 2A- and α 2B-adrenoceptors whereas [3H]- idazoxan labels the α 2A-adrenoceptor and, in addition, an imidazoline binding site. Several subtypes of the α 2-adrenoceptor have been identified by pharmacological means (α 2A-, α 2B-, α 2C-, and α 2D-adrenoceptors; Ruffulo 1990; Uhlén and Wikberg 1990; Gleason and Hieble 1992; Satoh and Takayanagi 1992; Takano et al. 1992;Ruffolo et al. 1993) or by recombinant technology as α 2a-, α 2b-, α 2c-adrenoceptors (Bylund et al. 1994; Hieble et al. 1995; Hieble and Ruffolo 1996; Alexander et al. 2001;Waitling 2006). Gleason and Hieble (1992) reported that the α 2- adrenoreceptors of the human retinoblastoma cell line (Y79) may represent an additional example of the α 2C-adrenoceptor. Marjamäki et al. (1993) recommended the use of recombinant human α 2-adrenoceptors to characterize subtype selectivity of antagonist binding. All three α 2-adrenoceptor types serve as autoreceptors in postganglionic sympathetic neurons (Trendelenburg et al. 2003). Uhlén et al. (1994) found that the α 2-adrenergic radioligand [3H]-MK912 is α 2C-selective among human α 2A-, α 2B- and α 2C-adrenoceptors. Uhlén et al. (1998) tested the binding of the radioligand [3H]RS79948–197 to human, guinea pig and pig α 2A-, α 2B- and α 2C-adrenoceptors and compared the values with MK912, RX821002, rauwolscine and yohimbine. [3H]RS79948–197 was non-selective for the α 2-adrenoceptor subtypes, showing high affinity for all three. A.1.1.3 Electrically Stimulated Release of [3H]Norepinephrine from Brain Slices PURPOSE AND RATIONALE The existence of presynaptic receptors which regulate the evoked release of neurotransmitters has been functionally demonstrated in both peripheral and central nervous system (Langer 1981; Starke 1981; Raiteri et al. 1984; Miller 1998). Presynaptic adrenergic α 2-receptors regulate the evoked release of norepinephrine, comprising a short negative feedback loop. Alpha-2 agonists, such as clonidine and guanabenz, inhibit evoked release and alpha-2 antagonists, such as yohimbine and idazoxan, enhance evoked release. The assay is used as a biochemical screen for agents which enhance or inhibit release of [3H]norepinephrine (3H-NE) and is particularly useful for testing receptor function of α 2-adrenergic agonists and antagonists. The procedures used emphasize delicate care of slices. By treating slices with great care, one is able to incubate at low tracer concentrations of 3H-NE (25 nM), thus minimizing nonspecific labeling of releasable pools other than those in noradrenergic nerve terminals. It also permits the use of low (and more physiological) stimulation parameters,which allow the neurons to recover easily between stimulations and do not flood the synaptic cleft with released NE, which would compete with any applied drug thus decreasing sensitivity. PROCEDURE This assay is based on the method described by Zahniser et al. (1986). A Reagents Krebs-Henseleit bicarbonate buffer, pH7.4 (KHBB): NaCl 118.4 mM KCl 4.7 mM MgSO4 × 7 H2O 1.2 mM KH2PO4 2.2 mM NaHCO3 24.9 mM CaCl2 1.3 mM dextrose (added prior to use) 11.1 mM The buffer is aerated for 60 min with 95 % O2, 5 % CO2 on ice and pH is checked. Levo-[Ring-2,5,6-3H]-norepinephrine (specific activity 40–50 Ci/mmol) is obtained from New England Nuclear. The final desired concentration of 3H-NE is 25 nM. 0.125 nmol is added to 5 ml KHBB. Test compounds For most assays, a 1mMstock solution of the test compound is made up in a suitable solvent and diluted such that the final concentration in the assay is 1 μM. Higher or lower concentrations may be used depending on the potency of the drug. B Instrumentation Neurotransmitter release apparatus consisting of: – oscilloscope B8K, Precision Model 1420, dual-trace microscope (Dynascan Corp.) – constant current unit, Grass model CCU1 (Grass Instr. Co.) – stimulator, model S44, solid state square wave stimulator (Grass Instr. Co.) – pump, Watson-Marlow, model 502 SHR, standard drive module; model 501Mmultichannel pumphead (Bacon Technical Instr.) – circulator, Haake D8 immersion circulator (Haake Buchler Instr. Inc.) – fraction collector, Isco Retriever IV fraction collector (Isco Inc.) C Tissue Preparation Male Wistar rats (100–150 g) are decapitated, cortical tissue removed on ice and 0.4 mm slices are prepared with a McIlwain tissue chopper. The slices are made individually and removed from the razor blade by twirling an artist’s paint brush underneath the slice. Care should be taken not to compress the slice or impale it on the bristles. The slices are placed in cold, oxygenated buffer (10–20 ml) and incubated at 35 °C for 30 min under oxygen. After this incubation, the buffer is decanted, leaving the slices behind. Then 5 ml of cold oxygenated buffer is added, and enough [3H]NE to bring the final concentration to 25 nM. This is then incubated and shaken for 30 min at 35 °C under oxygen. After this step, the buffer is decanted and the “loaded” slices are rapidly placed on the nylon mesh in the stimulation chambers using a cut-off pipetman tip. D Assay To establish a stable baseline, control buffer is pumped through the chamber for 1 h at a flow rate of 0.7 ml/min before the first stimulation. One hour is allowed to pass before the second stimulation. When drugs are used, each concentration is prepared in a separate flask in control buffer and allowed to equilibrate with the tissue slice 20 min before the second stimulation. The experiment is stopped 40 min after the second stimulation. Stimulation parameters are set at 5 Hz (2 ms duration) for 60 s, with 1 ms delay and voltage setting of 440 SIU (25f0Ω). After the experiment is completed, the chambers are washed with distilled water for at least 20 min, then 200 ml of 20 % methanol in distilled water, then distilled water again for at least 20 min. EVALUATION After conversion of dpm, percent fractional release is calculated for each fraction, using the spreadsheet program. Percent fractional release is defined as the amount of radiolabeled compound released divided by the amount present in the tissue at that moment in time. “Spontaneous release” (SP) values are the average of the two fractions preceding and the first fraction in that range after the stimulation period. “Stimulated” (S) are the summed differences between the percent fractional release during stimulation and the appropriate SP value. The effects of drugs can be reported as S2/S1 ratios. To normalize the data, drug effects can be estimated by first calculating S2/S1 values for control and drug-treated slices and then expressing the S2/S1 value for the drug-treated slices as a percentage of the S2/S1 value for the control slices for each experiment.Each condition should be tested in slices from each animal. A.1.1.4 Imidazoline Receptor Binding PURPOSE AND RATIONALE Imidazoline receptors constitute a family of nonadrenergic high-affinity binding sites for clonidine, idazoxan, and allied drugs. Drugs selectively binding to imidazoline receptors are expected to have less side effects than clonidine (Ernsberger et al. 1992, 1997; Molderings et al. 1992; Limon et al. 1992). One major subclass, the I1 receptors, being mainly distributed in the brain and brain stem, partly mediates the central hypotensive action of clonidine-like drugs. The I2 receptors, an other subclass, are mitochondrial, not G protein coupled, and have diversified functions. They may be involved in neuroprotection for cerebral ischemia. Two binding sites of [3H]p-aminoclonidine, α 2 adrenoceptors and imidazoline binding sites, could be separated (Ernsberger et al. 1987;Bricca et al. 1988; Kamisaki et al. 1990). At least 3 subtypes of imidazoline/ guanidinium-receptive sites have been found by photoaffinity labeling (Lanier et al. 1993). Several endogenous ligands for imidazoline receptors, collectively termed clonidine displacing substances (CDSs), have been detected in tissues and serum (Reis et al. 1995; Chan et al. 1997). An endogenous substance with clonidine-like properties originally isolated from brain which binds selectively to imidazoline receptors was described by Atlas and Burstein (1984), Ernsberger et al. (1988), Atlas (1991), Meeley et al. (1992), Dontenwill et al. (1992, Ragunathan and Reis 1996). The endogenous substance agmatine, a decarboxylated arginine, may be the physiological agonist at imidazoline receptors acting as neurotransmitter (Li et al. 1994; Gonzales et al. 1996; Head et al. 1997; Herman 1997; Reis and Regunathan 2000). Further candidates of endogenous ligands are discussed (Reis and Ragunathan 1998). A critical review on imidazoline binding sites is given by Eglen et al. (1998). PROCEDURE Tissue Preparation Whole bovine brains and adrenal glands are obtained from a local slaughterhouse. The lateral medulla oblongata is isolated by a sagittal section through the lateral margin of the pyramids and then bisected. The ventral half is defined as the ventrolateral medulla. Fresh bovine adrenal glands are perfused retrogradely through the adrenal vein twice with 25 ml icecold Krebs-Henseleit bicarbonate buffer. The glands are perfused again with 25 ml ice-cold Krebs-Henseleit buffer containing 0.025 % collagenase (type I, Sigma Chemical), incubated at room temperature for 1 h, then perfused with 25 ml fresh buffer containing collagenase and incubated for 30 min at 35 °C. The digested glands are split, and the medulla is removed from the cortex. Adrenal medullae are minced and incubated while being stirred for 30 min at 37 °C. The digest is filtered and centrifuged at 200 g for 30 min at 20 °C. The cell pellet is resuspended in 30 ml Krebs’ solution without collagenase, recentrifuged, flash-frozen, and stored at −70 °C. Membrane Preparation Fresh bovine ventrolateralmedulla and collagenase-digested rat renal medulla are homogenized with a Polytron (Tekmar Tissumizer; setting 80 for 15 s twice) in 20 vol of ice-chilled HEPES-buffered isotonic sucrose (pH 7.4) containing the protease inhibitors 1,10- phenanthroline (100 μM) and phenylmethylsulfonyl fluoride (50 μM). Bovine adrenomedullary chromaffin cells are homogenized in 15 ml HEPES-buffered isotonic sucrose by 10 strokes in a glass/glass handhold homogenizer. The homogenates are centrifuged at 1000 g for 5 min at 4 °C to remove nuclei and debris. The pellets (P1) are resuspended in 20 ml of homogenization buffer and centrifuged again at 1000 g for 5 min. The supernatants are centrifuged at 48,000 g for 18 min at 4 °C, and the resulting pellet (P2) is resuspended in 10–25 vol 50 mM Tris–HCl buffer (pH 7.7) containing 5 mM EDTA. After recentrifugation at 48,000 g for 18 min, the resulting membrane pellet is resuspended in Tris–HCl containing 25 mM NaCl, preincubated for 30 min at 25 °C, chilled on ice, centrifuged again, resuspended a final time in Tris- HCl alone, centrifuged, flash-frozen, and stored at −70 °C. Binding Assays For determination of specific binding to I1-imidazoline sites and α2-adrenergic receptors radioligand binding assays are performed with [3H]clonidine, [3H]piodoclonidine, or [3H]moxonidine. Membranes are slowly thawed and resuspended in Tris–HCl or Tris- HEPES buffer (pH 7.7, 25 °C). Assays are conducted in a total volume of 250 μl in polypropylene 96well plates (Beckman Macrowell). Each well contains 125 μl membrane suspension, 25 μl radioligand, and 100 μl drug or vehicle. Incubations are initiated by the addition of membrane suspension and carried out for 40 min at 25 °C. Nonspecific binding is defined in the presence of either piperoxan or phentolamine (0.1 mM), which are imidazoline-adrenergic agents. Specific α2-adrenergic binding is defined by epinephrine (0.1 mM). In experiments with catecholamines, all samples contain ascorbic acid in a final concentration of 0.001 %. Incubations are terminated by vacuum filtration over Reeves-Angel or Whatman GF/C fiberglass filters using a cell harvester (Brandel). The filters are washed four times with 5 ml ice-cold Tris–HCl, placed in scintillation vials, covered with 4 ml scintillation cocktail and counted at 50 % efficiency. Protein is assayed by a modified Lowry et al. method (Peterson 1977) using a deoxycholate-trichloroacetic acid protein precipitation technique which provides a rapid quantitative recovery of soluble and membrane proteins from interfering substances even in very dilute solutions. Sodium dodecyl sulfate is added to alleviate possible nonionic and cationic detergent and lipid interferences, and to provide mild conditions for rapid denaturation of membrane and proteolipid proteins. EVALUATION Data are obtained as disintegrations per min and transferred to the Equilibrium Binding Data Analysis program (McPherson 1985). Then, several experiments are analyzed simultaneously with the LIGAND program for non-linear curve fitting (Munson and Rodbard 1980). IC 50 values are estimated from inhibition curves by non-linear curve fitting (Mutolsky and Ransnas 1987). Protein assay data are also analyzed by non-linear curve fitting (McPherson 1985). MODIFICATIONS OF THE METHOD Tesson et al. (1991) defined the subcellular localization of imidazoline-guanidinium-receptive sites by performing binding studies with the radioligand [3H]idazoxan. Lanier et al. (1993) visualized multiple imidazoline/ guanidinium-receptive sites with the photoaffinity adduct 2-[3-azido-4-[125I]iodo-phenoxy]methyl imidazoline. Molderings et al. (1991) characterized imidazoline receptors involved in the modulation of noradrenaline release in the rabbit pulmonary artery pre-incubated with [3H]noradrenaline. Molderings and Göthert (1995) determined electrically or K+-evoked tritium overflow from superfused rabbit aortic strips pre-incubated with [3H]noradrenaline in order to characterize presynaptic imidazoline receptors which mediate noradrenaline release and compared them with I1- and I2-imidazoline radioligand binding sites. Ernsberger et al. (1995) described optimization of radioligand binding assays for I1 imidazoline sites. Munk et al. (1996) reported the synthesis and pharmacological evaluation of a potent imidazoline-1 receptor specific agent. Piletz et al. (1996) compared the affinities of several ligands for [125I]p-iodoclonidine binding at human platelet I1 imidazole binding sites. Several selective ligands for imidazoline I2 receptors have been identified, such as: LSL 60101 (Alemany et al. 1995; Menargues et al. 1995), RS-45041–190 (MacKinnon et al. 1995; Brown et al. 1995), RX801077 ( = 2-BFI = 2-(2-benzofuranoyl)-2-imidazoline and analogues (Jordan et al. 1996; Lione et al. 1996; Alemany et al. 1997; Hosseini et al. 1997; Wiest and Steinberg 1997; Hudson et al. 1997). A.1.1.5 β-Adrenoreceptor Binding PURPOSE AND RATIONALE β-adrenoceptors are widely distributed, found at both central and peripheral sites, and are activated either via norepinephrine released from sympathetic nerve terminals or via epinephrine released from the adrenal medulla. Important physiological consequences of β- adrenoceptor activation include stimulation of cardiac rate and force, relaxation of vascular, urogenital and bronchial smooth muscle, stimulation of renin secretion from the juxtaglomerular apparatus, stimulation of insulin and glucagon secretion from the endocrine pancreas, stimulation of glycogenolysis in liver and skeletal muscle and stimulation of lipolysis in the adipocyte. Three β-adrenoceptor proteins have been cloned, and the characteristics of these recombinant receptors correspond with those of the three well characterized β-adrenoceptors on native tissue, designated as β 1, β 2 and β 3. The possible roles of β 3-adrenoceptors in the cardiovascular system were discussed by Gauthier et al. (2000). An additional β-adrenoceptor modulatingcardiac contractility has been designated as the β 4- adrenoceptor (Kaumann et al. 1998). While it was initially thought that cardiac stimulation involved primarily the β 1-adrenoceptor, it now appears that all of the receptor subtypes may be involved. Bronchodilation appears to be mediated by the β 2-adrenoceptor. The β 3-adrenoceptor is responsible for lipolysis in white adipose tissue and thermogenesis in the brown adipose tissue found in rodents. Renin release appears to be mediated by the β 1-adrenoceptor (Waitling 2006). The β-adrenoceptor population of plasma membranes from bovine heart ventricles consists of 75–80 % β 1- and 20–25 % β 2-adrenoceptors. The use of this tissue allows a parallel investigation of the binding characteristics of drugs at both the β 1- and β 2-adrenoceptors. Both, the β 1- and β 2-adrenoceptors coexist in rat ventricular myocytes, but stimulation of these receptor subtypes elicits qualitatively different cell responses at the levels of ionic channels, the myofilaments, and sarcoplasmic reticulum (Xiao and Lakatta 1993). A constant concentration of the radioligand 3Hdihydroalprenolol (3H-DHA) (4–6 nM) is incubated with increasing concentrations of a non-labeled test drug (0.1 nM–1 mM) in the presence of plasma membranes from bovine heart ventricles. If the test drug exhibits any affinity to β-adrenoceptors, it is able to compete with the radioligand for receptor binding sites. Thus, the lower the concentration range of the test drug, in which the competition reaction occurs, the more effective is the test drug. PROCEDURE Materials and Solutions preparation buffer: Tris-HCl 5 mM MgCl2 × 6H2O 1 mM D(+)-sucrose 250 mM pH7.4 310 mOsm sodium phosphate buffer: pH 7.4 rinse buffer: Tris–HCl 50 mM MgCl2 × 6H2O 10 mM pH 7.4 incubation buffer: Tris–HCl 50 mM MgCl2 × 6H2O 10 mM ascorbic acid 1.6 mM catechol 0.3 mM pH 7.4 radioligand: (–)3H-dihydroalprenolol × HCl (3H-DHA) specific activity 1.48–2.59TBq/mmol (40–70 Ci/mmol) (NEN) for inhibition of 3H-dihydroalprenolol binding in non-specific binding experiments: (–)isoprenaline(+)bitartrate salt (Sigma) Bovine hearts are obtained freshly from the local slaughter house. The lower part of the left ventricle from 5 hearts is separated and kept in ice-cold preparation buffer. In the laboratory, approx. 60 g wet weight from the five ventricle pieces are minced with a scalpel into 2–3 mm pieces. Membrane Preparation Ventricles are homogenized by Ultra-Turrax (1 g tissue/ 10 ml buffer), the homogenate is filtered through gauze and centrifuged at 500 g (4 °C) for 10 min. The pellets are discarded, the supernatant is collected, and centrifuged at 40,000 g for 20 min. The resulting pellets are resuspended in approx. 300 ml 310 mOsm sodium phosphate buffer, homogenized by Ultra-Turrax, and centrifuged as before. The final pellets are dissolved (by Ultra-Turrax) in sodium phosphate buffer corresponding to 1 g ventricle wet weight/2 ml buffer. The membrane suspension is immediately stored in aliquots of 5–20 ml at –77 °C. Protein concentration of the membrane suspension is determined according to the method of Lowry et al. with bovine serum albumin as a standard. At the day of the experiment, the required volume of the membrane suspension is slowly thawed and centrifuged at 40,000 g (4 °C) for 20 min. The pellets are resuspended in a volume of ice-cold rinse buffer, yielding a membrane suspension with a protein content of approx. 2.0 mg/ml. After homogenizing by Ultra- Turrax, themembrane suspension is stirred under cooling for 20–30 min until the start of the experiment. Experimental Course All incubation samples are performed in triplicate. The total volume of each incubation sample is 200 μl (microtiter plates). Saturation Experiments total binding: 50 μl 3H-DHA (12 concentrations, 3 × 10−10–4 × 10–8 M) 50 μl incubation buffer non-specific binding: 50 μl 3H-DHA (4 concentrations, 3 × 10−10–4 × 10–8 M) 50 μl (–)isoprenaline (10–5 M) Competition Experiments 50 μl 3H-DHA (1 constant concentration, 4–6 × 10–9 M) 50 μl incubation buffer without or with non-labeled test drug (15 concentrations 10−10–10−3 M) The binding reaction is started by adding 100 μl membrane suspension per incubation sample (approx. 2 mg protein/ml). The samples are incubated for 60 min in a shaking water bath at 25 °C. The reaction is stopped by rapid vacuum filtration of the total incubation volume over glass fiber filters. Thereby the membranebound radioactivity is separated from the free activity. Filters are washed immediatelywith approx. 20 ml icecold rinse buffer per sample. The retained membranebound radioactivity on the filter is measured after addition of 2 ml liquid scintillation cocktail per sample in a Packard liquid scintillation counter. EVALUATION The following parameters are calculated: total binding non-specific binding specific binding = total binding–non-specific binding The dissociation constant (K i) of the test drug is determined from the competition experiment of 3HDHA versus non-labeled drug by a computer-supported analysis of the binding data. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ K_{\rm i} = \frac{{K_{\rm D} \;^3 {\rm H} \times {\rm IC}_{{\rm 50}} }}{{K_{\rm D} \;^3 {\rm H} + \left[ {^3 {\rm H}} \right]}} $$\end{document} IC 50 = concentration of the test drug, which competes with 50 % of specifically bound 3HDHA in the competition experiment [3H] = concentration of 3H-DHA in the competition experiment. KD 3H = dissociation constant of 3H-DHA, determined from the saturation experiment. The K i-value of the test drug is the concentration, at which 50 % of the receptors are occupied by the test drug. The affinity constant K i [mol/l] is recorded and serves as a parameter to assess the efficacy of the test drug. Standard data propranolol hydrochloride K i = 6–8 × 10–9 mol/l MODIFICATIONS OF THE METHOD Abrahamsson et al. (1988) performed a receptor binding study on the β 1- and β 2-adrenoceptor affinity of atenolol and metoprolol in tissues from the rat, the guinea pig and man with various radioligands, such as [125I](±)hydroxybenzylpindolol, [125I](–)pindolol, [3H](–)dihydroalprenolol, and [3H](–)CGP 12177. Fleisher and Pinnas (1985) used specific binding of (–)[3H]dihydroalprenolol to rat lung membranes for in vitro studies on the relative potency of bronchodilator agents. A.1.1.6 β 1-Adrenoreceptor Binding PURPOSE AND RATIONALE β-adrenergic receptors were differentiated from α- receptors (Ahlquist 1948) and subsequently divided into 2 distinct subtypes, β 1 and β 2 (Lands et al. 1967) based on differing pharmacology in different tissues. β-receptors have been labelled in a number of tissues including heart, lung, erythrocytes and brain using the β-agonists [3H]-epinephrine (U’Prichard et al. 1978), or [3H]-hydroxybenzylisoproterenol (Lefkowitz and Williams 1977) or the β receptor antagonists [3H]- alprenolol (Mukherjee et al. 1975), [3H]-dihydroalprenolol (DHA) (U’Prichard et al. 1978; Bylund and Snyder 1976) and (125I)-iodohydroxypindolol (Weiland et al. 1980). DHA is a potent β-antagonist (Mukherjee et al. 1975), which labels both β 1 and β 2 adrenergic receptors. The binding characteristics of this ligand in brain were described by Bylund and Snyder (1976), who showed that antagonists competed potently and agonists less potently although stereospecificity was maintained. The pharmacology of binding was consistent with β 1-receptor occupancy. Lesioning studies (Wolfe et al. 1982), combined with non-linear regression analysis of data have shown that while β- receptors in rat cerebellum are primarily of the β 2 subtype, the β 1 occurring in rat cerebral cortex are physiologically more significant. The assay can be used to evaluate the direct interaction of drugs with β-receptors labelled by [3H]-dihydroalprenolol. PROCEDURE Reagents Tris buffer, pH8.0 44.4 g Tris HCl q.s. to 1 liter (0.5 M Tris, pH 8.0) 26.5 g Tris base Dilute 1:10 in distilled water. (0.05 M Tris, pH8.0) (–)-[propyl-1,2,3-3H] Dihydroalprenolol hydrochloride (45–52 Ci/mmol) is obtained from New England Nuclear. For IC 50 determinations: A stock solution of 20 nM 3H-DHA is made up in distilled H2O and 50 μl is added to each tube (this yields a final concentration of 1 nM in the 1 ml assay). (±)-propranolol HCl is obtained from Ayerst. A 1 mM propranolol stock solution is made up in distilled water and further diluted 1:20 in distilled water to give 50 μMpropranolol solution. Twenty μl of dilute stock solution is added to 3 tubes to determine nonspecific binding (yields a final concentration of 1 μM in a 1 ml assay). Test compounds: For most assays, a 1 mM stock solution is made up in a suitable solvent and serially diluted, such that the final concentration in the assay ranges from 10–5 to 10–8 M. Seven concentrations are used for each assay. Higher or lower concentrations may be used depending on the potency of the compound. Tissue Preparation Male rats are decapitated and the brains rapidly removed. The cerebral cortices are dissected free, weighed and homogenized in 50 ml of ice-cold 0.05Tris buffer, pH8.0. This homogenate is centrifuged at 40,000 g, the supernatant decanted and the pellet resuspended and recentrifuged at 40,000 g. The final pellet is resuspended in the initial volume of fresh 0.05Tris buffer, pH8.0. This tissue suspension is then stored on ice. The final tissue concentration in the assay is 10 mg/ml. Specific binding is about 3 % of the total added ligand and 80 % of the total bound ligand. Assay 380 μl H2O 50 μl 0.5 Tris buffer, pH 8.0 20 μl Vehicle (for total binding) or 50 μM (±) propranolol (for nonspecific binding) or appropriate drug concentration 50 μl 3H-DHA stock solution 500 μl tissue suspension. The tissue homogenates are incubated for 15 min at 25 °C with 1 nM 3H-DHA and varying drug concentrations. With each binding assay, triplicate samples are incubated with 1 μM (±)-propranolol under identical conditions to determine nonspecific binding. The assay is stopped by vacuum filtration through Whatman GF/B filters which are washed 3 times with 5 ml of icecold 0.05Tris buffer, pH8.0. The filters are counted in 10 ml of Liquiscint scintillation cocktail. EVALUATION The percent inhibition of each drug concentration is the mean of triplicate determinations. IC 50 values are obtained by computer-derived log-probit analysis. MODIFICATIONS OF THE METHOD Dooley et al. (1986) recommended CGP 20712A as a useful tool for quantitating β 1 and β 2 adrenoceptors. A.1.1.7 β 2-Adrenoreceptor Binding PURPOSE AND RATIONALE Lands et al. (1967) classified β-receptors into β 1 and β 2 subtypes according to differences in the action of various catecholamines. Synthesis of more selective β-antagonists has helped to confirm the existence of receptor subtypes. Based on catecholamine pharmacology and differences in the tissue distribution, it has been suggested that the β 1-receptor serves as the receptor for norepinephrine acting as a neurotransmitter and the β 2-receptor serves as a receptor for epinephrine acting as a hormone. (Nahorski 1981; Ariens and Simonis 1983; Lefkowitz et al. 1983; Minneman 1983). Since [3H]-dihydroalprenolol is a nonspecific ligand, it is necessary to select a tissue which is enriched in β 2-receptors in order to convey specificity to this assay. Tissues with predominantly β 2- receptors include lung (U’Prichard et al. 1978; Ariens and Simonis 1983; Lefkowitz et al. 1983), cerebellum (Lefkowitz et al. 1983; Minneman et al. 1983), rat and frog erythrocytes (Mukherjee et al. 1975; Lefkowitz et al. 1983) and ciliary process (Nathanson 1985) whereas, forebrain, heart and avian erythrocytes are relatively enriched in the β 1-subtype (Lefkowitz et al. 1983). Due to poor binding characteristics in cerebellum, rat lung is chosen as the tissue for β 2-adrenergic receptors. A compound with β 2-selectivity would be less likely to produce cardiac effects but more likely to produce bronchiolar constriction. The test is used to determine the affinity of compounds for the β 2-adrenergic receptor subtype. A measure of receptor subtype selectivity can be determined when data are compared with those obtained in the β 1-adrenergic assay in rat cerebral cortex. The present nomenclature of β 1, β 2, and β 3 receptors was reviewed by Alexander et al. (2001). PROCEDURE Reagents Tris buffers, pH 8.0 44.4 g Tris HCl q.s. to 1 liter (0.5 M Tris, pH 8.0) 26.5 g Tris base Dilute 1:10 in distilled water (0.05 M Tris, pH8.0) (−)-[propyl-1,2,3-3H] Dihydroalprenolol hydrochloride (45–52 Ci/mmol) is obtained from New England Nuclear. For IC 50 determinations: A stock solution of 20 nM 3H-DHA is made up in distilled water and 50 μl is added to each tube (this yields a final concentration of 1 nM in the assay) (±)-propranolol HCl is obtained from Ayerst. A 1 mM propranolol stock solution is made up in distilled water and further diluted 1:20 in distilled water to give 50 μMpropranolol solution. Twenty μl of dilute stock solution are added to 3 tubes to determine nonspecific binding (yielding a final concentration of 1 μM in a 1 ml assay). Test compounds: For most assays, a 1 mM stock solution is made up in a suitable solvent and serially diluted, such that the final concentrations in the assay range from 10–5 to 10–8 M. Seven concentrations are used for each assay. Higher or lower concentrations may be used depending on the potency of the compound to be tested. Tissue Preparation Male Wistar rats are sacrificed by decapitation and the lungs removed, weighed and homogenized in 50 volumes of ice-cold 0.05MTris buffer, pH 8.0 using a Tekmar homogenizer. The homogenate is passed through a cheese cloth and centrifuged at 40,000 g for 15 min. The final membrane pellet is resuspended in the original volume of Tris buffer, pH 8.0, and used in the assay. Assay 380 μl H2O 50 μl 0.5 Tris buffer, pH 8.0 20 μl Vehicle (for total binding) or 50 μM (±)-propranolol (for nonspecific binding) or appropriate drug concentration 50 μl 3H-DHA stock solution 500 μl tissue suspension. The tissue homogenates are incubated for 15 min at 25 °C with 1 nM 3H-DHA and varying drug concentrations. In each binding assay, triplicate samples are incubated with 1 μM (±)-propranolol under identical conditions to determine nonspecific binding. The assay is stopped by vacuum filtration through Whatman GF/B filters which are washed 3 times with 5 ml of icecold 0.05 Tris buffer, pH8.0. The filters are counted in 10 ml of Liquiscint scintillation cocktail. EVALUATION The percent inhibition of each drug concentration is the mean of triplicate determinations. IC 50 values are obtained by computer-derived log-probit analysis. MODIFICATIONS OF THE METHOD Dooley et al. (1986) recommended CGP 20712 as a useful tool for quantitating β 1- and β 2-adrenoceptors. McCrea and Hill (1993) described salmeterol as a long-acting β-adrenoceptor agonist mediating cyclic AMP accumulation in the B50 neuroblastoma cell line. Sarsero et al. (1998) recommended (–)[3H]-CGP 12177A as radioligand for the putative β 4-adrenoceptor. McConnell et al. (1991, 1992; Owicki and Parce 1992) used a special apparatus, the ‘cytosensor microphysiometer’ which measures the rate of proton excretion from cultured cells. Chinese hamster ovary cells were transfected with human β 2-adrenergic receptors. The β 2-adrenergic receptor activates adenylate cyclase resulting in an increase in the cyclic AMP concentration within the cell which can be measured as acidification. Addition of 10 μM isoproterenol, 500 μM 8- bromo cyclic AMP, or 10 μg/ml forskolin induced a reversible acidification. Hoffmann et al. (2004) compared human β- adrenergic receptor subtypes using characterization of stably transfected receptors in CHO cells. PROCEDURE cDNA of human β-adrenergic receptors cDNAs coding for human β-adrenergic receptors in pcDNA3 expression vectors were verified by sequencing and comparison with the respective GeneBank entries. The translated amino acid sequences corresponded to the published sequences for the β 1-adrenergic receptor (Frielle et al. 1987), β 2-adrenergic receptor (Schofield et al. 1987), and β 3-adrenergic receptor (Emorine et Y al. 1989). With respect to polymorphisms, the β- adrenergic receptors used in this study corresponded to the following variants: β 1-receptor 49-Ser, 389-Gly; β 2-receptor 16-Arg, 27-Gln, 164-Thr; β 3-receptor 64- Trp. All of the variants correspond to the sequences originally termed wild-type. Stable Transfection of Cells Chinese hamster ovary cells (CHO-K1 cells; CCL61, American Type Culture Collection, Rockville, Md., USA) were transfected with plasmid DNA for stable expression using the calcium phosphate precipitation method (Chen and Okayama 1987) as described for the rat A1 adenosine receptor (Freund et al. 1994). Positive clones were selected with 600 μg/ml of the neomycin analog G-418, and single clonal lines were isolated by limiting dilution. Expression of the receptor was verified by radioligand binding. Cell culture and membrane preparation Chinese hamster ovary cells stably transfected with human β-adrenergic receptor subtypes were grown adherently and maintained in Dulbecco’s Modified Eagle’s Medium with nutrient mixture F12 (DMEM/F12), containing 10%fetal calf serum, penicillin (100 U/ml), streptomycin (100 μg/ml), L-glutamine (2 mM) and geneticin (G-418, 0.2 mg/ml) at 37 °C in 5 % CO2/95 % air. Cells were split 2 or 3 times weekly at a ratio of between 1:5 and 1:15. In order to harvest cells the culture medium was removed, cells were washed twice with PBS and membranes were prepared or cells were frozen on the dishes for later preparation of membranes. Crude membrane fractions were prepared from fresh (measurement of adenylyl cyclase) or frozen cells (radioligand binding). The resulting membrane pellets were resuspended in 50 mM Tris/HCl buffer pH7.4 to give a final protein concentration of 1–2 mg/ml. Radioligand Binding Studies and Adenylyl Cyclase Activity The radioligand binding experiments were performed with membranes prepared as described above. Assays were done in a volume of 200 μl in 50 mM Tris/HCl, pH 7.4 (assay buffer) in the presence of 100 μM GTP to ensure monophasic binding curves for agonists. For saturation binding experiments at human β 1- and β 2- receptors up to 400pM 125I-CYP and for β 3-receptors up to 1,500pM 125I-CYP were used. Non-specific binding was determined in the presence of 10 μM alprenolol. For competition binding, 50 pM 125I-CYP in the case of β 1- and β 2-receptors, or 80 pM 125I-CYP for β 3-receptors were used. For most of the competition binding experiments membranes with intermediate receptor expression (β 1: 367 ± 75 fmol/mg protein, β 2: 282 ± 19 fmol/mg protein, β 3: 377 ± 82 fmol/mg protein) were used. For selected compounds it was demonstrated that higher receptor expression did not affect Ki values (data not shown).Membranes were incubated for 90 min at 30 °C, filtered throughWhatman GF/C filters, and washed 3 times with ice-cold assay buffer. Samples were counted in a γ -counter (Wallac 1480 wizard 3). K D-values for 125I-CYP were calculated by non-linear curve fitting with the program SCTFIT. Ligand IC50 values were calculated using Origin 6.1 (OriginLab Corporation, Northampton, Mass., USA) and were transformed to K i values according to Cheng and Prusoff (1973). Adenylyl cyclase activity in cell membranes was determined according to Jakobs et al. (1976). Membrane protein (50 μg) was added to an incubation mixture with final concentrations of 50 mM Tris/HCl pH 7.4, 100 μM cAMP, 0.2 % BSA, 10 μM GTP, 100 μM ATP, 1 mM MgCl2, 100 μM IBMX, 15 mM phosphocreatine, and 300U/ml of creatine kinase. Membranes were incubated with about 200,000 cpm of [α-32P]-ATP for 20 min in the incubation mixture as described (Klotz et al. 1985). Accumulation of [α-32P]-cAMP was linear over at least 20 min under all conditions. The reaction was stopped by addition of 400 μl of 125 mM ZnAc-solution and 500 μl of 144 mM Na2CO3. Samples were centrifuged for 5 min at 14,000 rpm in a laboratory microcentrifuge. Then, 800 μl of the resulting supernatant wase finally applied to alumina WN-6 (Sigma) columns that were eluted twice with 2 ml of 100 mM Tris/HCl pH7.4. 68 Chapter A · Cardiovascular Activity The eluates were counted in a β-counter (Beckmann LS 1801). Niclauss et al. (2006) compared the ability of three radioligands, [125I]-cyanopindolol, [3H]-CGP 12,177 and [3H]-dihydroalprenolol, to label the three human β-adrenoceptor subtypes. Saturation and competition binding experiments were performed using membrane preparations from Chinese hamster ovary cells stably transfected with the three subtypes. While [3H]- CGP 12,177 had very similar affinity for β 1- and β 2-adrenoceptors (about 40 pM), [125I]-cyanopindolol and [3H]-dihydroalprenolol had four- to sixfold higher affinity for β 2- as compared to β 1-adrenoceptors (10 vs. 45 and 187 vs. 1,021 pM, respectively). The affinity of [125I]-cyanopindolol at β 3-adrenoceptors was considerably lower (440 pM) than at the other two subtypes. The β 3-adrenoceptor affinity of [3H]-CGP 12,177 and [3H]-dihydroalprenolol was so low that it could not be estimated within the tested range of radioligand concentrations (up to 4,000pM and 30,000pM for [3H]-CGP 12,177 and [3H]-dihydroalprenolol, respectively). All three radioligands were ill-suited to labeling β 3-adrenoceptors, particularly in preparations co-expressing multiple subtypes. In the absence of alternatives, [125I]-cyanopindolol appears the least unsuitable for labeling β 3-adrenoceptors. At present, there is still a need for high-affinity radioligands that are selective for β 3-adrenoceptors. A.1.1.8 Adenosine A1 Receptor Binding GENERAL CONSIDERATIONS Adenosine receptors belong to the class of purinoceptors 1990). Purinoceptors are divided into two general 1990). Purinoceptors are divided into two general types on the basis of recognized natural ligands: P1 receptors recognize adenosine and AMP and P2 receptors recognize ATP and AMP. Fredholm et al. (1994), Abbracchio and Burnstock (1994, Jacobson et al. 2000) proposed a nomenclature system which is now widely accepted: two families of P2 purinoceptors, P2X ionotropic ligand-gated ion channel receptors (North 2002) and P2Y metabotropic G-proteincoupled receptors (Costanzi et al. 2004). The nomenclature of seven subtypes of P2X receptors and six subtypes of P2Y receptors has been agreed by the NCIUPHAR Subcommittee (Burnstock 2001; Alexander et al. 2001;Waitling 2006). The effects of adenosine are mediated effects through cAMP (Sattin and Rall 1970; VanCalker et al. 1978). It was discovered that adenosine could either inhibit or stimulate the formation of cAMP. The discovery of dual effects on adenylate cyclase led to the proposal of two distinct adenosine receptors referred to as the A1 and A2 receptors. The A1 subtype of adenosine receptor mediates the inhibition of adenylate cyclase; whereas, the A2 subtype mediates stimulation of adenylate cyclase. The methylxanthines are relatively nonselective inhibitors of adenosine receptor subtypes and their pharmacological properties are thought to be mostly due to antagonism of these receptors. Comparison of adenosine receptors with other Gprotein linked receptors indicates that they comprise a family of G protein coupled receptors that can be grouped by subtypes or by species. Thus, in addition to A1 and A2, several authors described A1a, A1b, A2a, A2b, A3, and A4 receptors with species dependent differences (Jacobson et al. 1992 1996; Zhou et al. 1992; Linden et al. 1993; Salvatore et al. 1993; Linden et al. 1994; Fredholm et al. 1994; Alexander et al. 2001). The nomenclature and classification of adenosine receptors were published by Fredholm et al. (2001) and Waitling (2006). Klotz (2000) reviewed adenosine receptors and their ligands. The four subtypes of adenosine receptors referred to as A1, A2A, A2B, and A3 are members of the superfamily of Gprotein- coupled receptors. The most recently discovered member of the adenosine receptor family, the A3 receptor, has a unique pharmacological profile (Salvatore et al. 1993; Avila et al. 2002). PURPOSE AND RATIONALE The purpose of this assay is to measure the affinity of test compounds for adenosine (A1) receptors. Evidence for an A1 adenosine receptor in the guinea pig atrium was given by Collis (1983). Adenosine plays a physiological role in many systems, including platelet aggregation, lipolysis, steroidogenesis and smooth muscle tone (Daly 1982).The vasodilatory and cardiac depressant effects of adenosine are well known. In addition to cardiovascular effects, adenosine has marked effects in the CNS including depression of electrophysiological activity (Siggins and Schubert 1981), anticonvulsant activity, analgesic properties (Ahlijanian and Takemori 1985) and inhibition of neurotransmitter release (Harms et al. 1979). The agonist, [3H]cyclohexyladenosine (CHA), has affinity for the A1 receptor in the nanomolar concentration range and has proven to be a suitable ligand for A1 receptor assays (Bruns et al. 1980; Bruns et al. 1986). Selective A1 (Schingnitz et al. 1991) and A2 antagonists (Shimada et al. 1992; Jacobson et al. 1993) have been described. Adenosine and its nucleotides have not only a cardiovascular but predominantly a cerebral activity (Phillis and Wu 1981; Daly 1982; Fredholm et al. 1982). PROCEDURE Reagents 0.5 M Tris buffer, pH7.7 0.05 M Tris buffer, pH 7.7 Adenosine deaminase is obtained from Sigma Chemical Co. Adenosine deaminase is added to 0.05 M Tris-HCl buffer, pH7.7 for final resuspension of the membrane pellet, such that the concentration in the assay is 0.1U/ml of tissue. Cyclohexyladenosine, N6-[Adenine-2,8-3H] (specific activity 34 mCi/mmol) is obtained from New England Nuclear. For IC 50 determinations: [3H]CHA is made up to a concentration of 40 nM and 50 μl are added to each tube. This yields a final concentration of 1nM in the assay. Theophylline is obtained from Regis Chemical Co. A 100 mM stock solution is made up in deionized water. 20 μl are added to each of 3 tubes for the determination of nonspecific binding, yielding a 1 mM final concentration in the assay. Test compounds For most assays, a 1 mM stock solution is prepared in DMSO and serially diluted, such that the final concentrations in the assay range from 10–5 to 10–8 M. Seven concentrations are used for each assay. Higher or lower concentrations may be used depending on the potency of the drug. Tissue Preparation Male Wistar rats are sacrificed by decapitation.Whole brains minus cerebellum are removed, weighed and homogenized in 10 volumes of ice-cold 0.05 M Tris buffer, pH7.7. The homogenate is centrifuged at 48,000 g for 10 min, the supernatant decanted, the pellet resuspended in the same volume of buffer and centrifuged again as before. The final pellet is resuspended in 0.05 M Tris buffer containing 0.1U/ml of adenosine deaminase. Assay 1000 μl tissue suspension 930 μl H2O 20 μl Vehicle or theophylline or appropriate concentration of test compound 50 μl 3H-CHA The tubes are incubated for 2 hours at 25 °C. The assay is stopped by vacuum filtration through Whatman GF/B filters which are then washed 3 times with 5 ml of 0.05 M Tris buffer. The filters are then placed into scintillation vials with 10 ml liquiscintillation cocktail, left to soak overnight and counted. EVALUATION Specific binding is defined as the difference between total binding and binding in the presence of 1 mM theophylline. IC 50 values are calculated from the percent specific binding at each drug concentration. The complexity of interaction of adenosine ligands with receptors (Bruns et al. 1986) precludes the simple calculation of K i values by the Cheng–Prusoff equation. MODIFICATIONS OF THE METHOD Stiles et al. (1985) used 125I-labeled N6-2-(4-aminophenyl) ethyladenosine as a selective ligand to probe the structure of A1 receptors. Lohse et al. (1987) described 8-cyclopentyl-1,3- dipropylxanthine (DPCPX) as a high affinity antagonist radioligand for A1 adenosine receptors. Klotz et al. (1989) described 2-chloro-N6- [3H]cyclopentyladenosine ([3H]CCPA) as a high affinity agonist radioligand for A1 adenosine receptors. Von Lubitz et al. (1995) studied the therapeutic implications of chronic NMDA receptor stimulation on adenosine A1 receptors. The partial agonism of theophylline-7-riboside on the adenosine A1 receptor has been reported by Ijzerman et al. (1994). Libert et al. (1992) reported the cloning and functional characterization of a human A1 adenosine receptor. A.1.1.9 Adenosine A2 Receptor Binding PURPOSE AND RATIONALE The A2 receptor is a low-affinity binding site for adenosine (Daly et al. 1981). Activation of the A2 receptor subtype by agonists mediates an increase in adenylate cyclase activity, while the A1 receptor has the opposite effect. Although many of the physiological effects of adenosine seem to correlate with activity at the A1 receptor, the effect on coronary blood flow correlates with activation of A2 receptors (Hamilton et al. 1987). This assay uses 3H-NECA (5′-N-ethylcarboxamido[ 8-3H]adenosine) to label A2 receptors in rat striatum by the method described by Bruns et al. (1986). Comparison of data from this assay and the A1 receptor assay provides a measure of selectivity for these two receptors. PROCEDURE Reagents 0.5 M Tris buffer, pH7.7 0.05 M Tris buffer, pH 7.7 0.05 M Tris buffer, pH 7.7, containing 12 mM CaCl2 (final assay concentration: 10 mM) Adenosine deaminase is obtained from Sigma Chemical Co. Adenosine deaminase is added to 0.05 M Tris–HCl buffer, pH7.7, containing 12mMCaCl2 for final resuspension of the membrane pellet, such that the concentration in the assay is 0.1 U/ml of tissue. 5′-N-Ethylcarboxamido[8-3H]adenosine (specific activity 23–40 mCi/mmol) is obtained from Amersham. For IC 50 determinations: 3H-NECA is made up to a concentration of 80 nM and 50 μl is added to each tube. This yields a final concentration of 4 nMin the assay. Cyclopentyladenosine (CPA) is obtained from Research Biochemicals Inc. A 5 mM stock solution is made up in DMSO. 20 μl are added to each of 3 tubes for the determination of nonspecific binding, yielding a 100 μM final concentration in the assay. Since [3H]NECA is not a specific ligand for A2 receptors, CPA is added to all other tubes to mask the A1 receptors at a final concentration of 50 nM. Test compounds For most assays, a 1 mM stock solution is made up in a suitable solvent and serially diluted, such that the final concentration in the assay ranges from 2 × 10−5 to 2 × 10–8 M. Seven concentrations are used for each assay. Higher or lower concentrations may be used depending on the potency of the drug. Tissue Preparation Male Wistar rats are sacrificed by decapitation. Striata are removed, weighed and homogenized in 10 volumes of ice-cold 0.05 M Tris buffer, pH 7.7. The homogenate is centrifuged at 48,000 g for 10 min, the supernatant decanted, the pellet resuspended in the same volume of buffer and centrifuged again as before. The final pellet is resuspended in 100 volumes of 0.05 M Tris buffer containing 10 mM CaCl2 and 0.1 U/ml of adenosine deaminase. Assay 830 μl tissue suspension 100 μl CPA 20 μl vehicle or CPA or appropriate concentration of test compound 50 μl 3H-NECA The tubes are incubated at 25 °C for 2 hours. The assay is stopped by vacuum filtration through Whatman GF/B filters which are then washed 3 times with 5 ml of 0.05 M Tris buffer. The filters are then placed into scintillation vials with 10 ml Liquiscint scintillation cocktail, left to soak overnight and counted. EVALUATION Specific binding is defined as the difference between total binding and binding in the presence of 100 μM CPA. IC 50 values are calculated from the percent specific binding at each drug concentration. The complexity of interaction of adenosine ligands with receptors precludes the simple calculation of K i values by the Cheng–Prusoff equation. MODIFICATIONS OF THE METHOD Jarvis et al. (1989) reported on [3H]CGS 21 680, a selective A2 adenosine receptor agonist which directly labels A2 receptors in rat brain. [3H]CGS 21 680 binding was greatest in striatal membranes with negligible specific binding obtained in rat cortical membranes. Gurden et al. (1993) described the functional characterization of three adenosine receptor types. Hutchinson et al. (1990) described 2-(arylalkylamino) adenosin-5′-uronamides as a new class of highly selective adenosine A2 receptor ligands. A2A Adenosine receptors from rat striatum and rat pheochromocytoma PC12 cells have been characterized with radioligand binding and by activation of adenylate cyclase (Hide et al. 1992). Nonaka et al. (1994) reported on KF17837 ((E)- 8-(3,4-dimethoxystyryl)-1,3-dipropyl-7-methylxantine), a potent and selective adenosine A2 receptor antagonist. The in vitro pharmacology of ZM 241385, a potent, non-xanthine, A2a selective adenosine receptor antagonist has been reported by Poucher et al. (1955). Monopoli et al. (1994) described the pharmacology of the selective A2α adenosine receptor agonist 2- hexynyl-5′-N-ethylcarboxamidoadenosine. Jacobson et al. (1993) described structure-activity relationships of 8-styrylxanthines as A2-selective adenosine antagonists. Varani et al. (1996) reported pharmacological and biochemical characterization of purified A2a adenosine receptors in human platelet membranes by [3H]-CGS 21680 binding. Van der Ploeg et al. (1996) characterized adenosine A2 receptors in human T-cell leukemia Jurkat cells and rat phaeochromocytoma PC12 cells using adenosine receptor agonists. A.1.1.10 Adenosine A3 Receptor Binding PURPOSE AND RATIONALE The A3 adenosine receptor has been cloned and characterized by Zhou et al. (1992). A possible role in reproduction has been discussed. The role of central A3 adenosine receptors may be the mediation of behavioral depressant effects (Jacobson et al. 1993). The design of selective ligands of A3 adenosine receptors and the therapeutic concepts including effects on locomotor activity, cardiovascular effects, effects in cerebral ischemia (von Lubitz et al. 1994), in cardiac preconditioning and as antagonists in inflammation and asthma has been discussed by Jacobson et al. (1995). Von Lubitz et al. (1995) noticed some anticonvulsive activity of the adenosine A3 receptor selective agonist IB-MECA (N6-(3-iodobenzyl) adenosine-5′-Nmethyl- carboxamide).Stimulation of the A3 adenosine receptor facilitates release of allergic mediators inmast cells (Ramkumar et al. 1993) inducing hypotension in the rat (Hannon et al. 1995). A binding site model and structure-activity relationships for the rat A3 adenosine receptor are described by van Galen et al. (1994). PROCEDURE Cell culture and membrane preparation Chinese hamster ovary (CHO) cells stably expressing the rat A3 adenosine receptor are grown in F-12 medium containing 10 % fetal bovine serum and penicillin/ streptomycin (100 units/ml and 100 μg/ml, respectively) at 37° in a 5%CO2 atmosphere.When cells reach confluency, they are washed twice with 10 ml of ice-cold lysis buffer (10 mM EDTA, pH7.4). After addition of 5 ml of lysis buffer, cells are mechanically scraped and homogenized in an ice-cold Dounce homogenizer. The suspension is centrifuged at 43,000 g for 10 min. The pellet is suspended in the minimum volume of ice-cold 50 mM Tris/10 mM MgCl2/1 mM EDTA (pH 8.26 at 5 °C) buffer required for the binding assay and homogenized in a Dounce homogenizer. Aminodeaminase (ADA, Boehringer Mannheim) is added to a final concentration of 3 units/ml and the suspension is incubated at 37 °C for 15 min; the membrane suspension is subsequently kept on ice until use. Radioligand binding assay Binding of [125I]APNEA (N6-2-(4-aminophenyl)- ethyladenosine) to CHO cells stably transfected with the rat A3 adenosine receptor clone is performed according to Stiles et al. (1985). Assays are performed in 50/10/1 buffer in glass tubes and contain 100 μl of the membrane suspension, 50 μl of inhibitor. Incubations are carried out in duplicate for 1 h at 37 °C and are terminated by rapid filtration overWhatman GF/B filters, using a Brandell cell harvester. Tubes are washed three times with 3 ml of buffer. Radioactivity is determined in a Beckman γ -counter. Non-specific binding is determined in the presence of 40 μM R-PIA = N6-[(R)]- 1-methyl-2-phenylethyl]adenosine. EVALUATION K i values are calculated according to Cheng and Prusoff (1973), assuming a Kd for [125I]APNEA of 17 nM. MODIFICATIONS OF THE METHOD 125I-4-aminobenzyl-5′-N-methylcarboxamidoadenosine has been recommended as a high affinity radioligand for the rat A3 adenosine receptor (Olah et al. 1994). Molecular cloning and functional expression of a sheep A3 adenosine receptor has been reported by Linden et al. (1993). G protein-dependent activation of phospholipase C by adenosine A3 receptors in rat brain was reported by Abbracchio et al. (1995). Molecular cloning and characterization of the human A3 adenosine receptor was reported by Salvatore et al. (1993). The differential interaction of the rat A3 adenosine receptor with multiple G-proteins has been described by Palmer et al. (1995). Baraldi and Borea (2000) described new potent and selective human adenosine A3 receptor antagonists using radioligand binding studies to the human A3 receptor. A.1.1.11 Inhibition of Adenosine Uptake in Human Erythrocytes PURPOSE AND RATIONALE Adenosine regulates multiple physiological functions in animals and humans. It plays a potent neuromodulatory role mainly by inhibiting the presynaptic transmitter release, e. g. of glutamate and aspartate. It is released by synaptic stimulation and during hypoxia in the central and peripheral nervous system. Adenosine plays a neuroprotective role in hypoxia and ischemia since it reduces the excessive stimulation of the NMDA receptors. The use of adenosine uptake inhibitors has been proposed as a new therapeutic strategy for hypoxic/ischemic disease. Due to its vasodilatory action adenosine plays a key role in the regulation of coronary and cerebral blood flow. The rapid cellular uptake of adenosine by erythrocytes is a reason for the short duration of action of adenosine. Human erythrocytes are used as a cellular model to detect adenosine uptake inhibitors. Erythrocytes are treated with test compound and thereafter incubated with 3H-adenosine. The uptake of 3H-adenosine is evaluated in relation to the untreated control group. Dipyridamole is a potent inhibitor of adenosine uptake (IC 50 of 3 × 10–7 M). Standard compounds: theophylline dipyridamole (Persantin) propentofylline (HWA 285) PROCEDURE Materials and solutions isotonic glycyl-glycine buffer, pH 7.4 KCl 5.0 mM NaCl 119.5 mM MgCl2 2.0 mM glycyl-glycine 50 mM Na2HPO4 2.0 mM 2-[3H]-adenosine (specific activity 5 μM 0.2 μCi/μmol) Buffer-washed fresh human erythrocytes are depleted of ATP by incubation in an isotonic glycyl-glycine buffer at 37 °C. Aliquots of the erythrocyte suspensions are incubated for 2 min in fresh glycyl-glycine buffer solution containing additional 10mMglucose and testor standard compound. In screening assays, test compounds are added at a concentration of 5 × 10–4 M. Drugs showing an effect in this assays, are further tested at a concentration range of 10−5–5 × 10–4 M to determine IC 50 values (triplicate samples for each concentration). The suspension is then incubated with 5 μM radioactively labelled 2-[3H]-adenosine for 30 s. The adenosine uptake is stopped by adding cold buffer (4 °C) containing 5 μM adenosine, 10 μM glucose and 7.4 μM dipyridamole. After centrifugation, the tritium radioactivity is determined in the supernatant. EVALUATION The percent change of 3H-adenosine uptake relative to the vehicle control group is determined. The 3Hadenosine uptake of the control group is taken as 100 %; subsequent results are expressed as percentages of this. IC 50 values are determined by plotting the percent inhibition against test compound concentration; IC 50 is defined as the dose of drug leading to a 50 % inhibition of adenosine uptake. Statistical evaluation is performed by means of the Student’s t-test. Standard data: IC 50 of dipyridamole 3 × 10–7 M MODIFICATIONS OF THE METHOD Marangos et al. (1982), Verma and Marangos (1985) recommended [3H]nitrobenzylthioinosine binding as a probe for the study of adenosine uptake sites in brain of various species. The highest density of binding sites were found in the caudate and hypothalamus of human and rat brain. A.1.1.12 Inhibition of Vasopeptidases GENERAL CONSIDERATIONS Vasopeptidase inhibitors (VPIs) inhibit both angiotensin converting enzyme (ACE) and neprilysin (NEP) and can thus reduce the activity of the reninangiotensin system and potentiate the vasodilatory, natriuretic and antiproliferative effects of bradykinin and natriuretic peptides (Burnett 1999; Bralet and Schwartz 2001). Combined inhibition of neutral endopeptidase 24.11 (NEP) and ACE is a candidate therapy for hypertension and cardiac failure (Duncan et al. 1999). Heath et al. (1995) described the quantification of a dual ACE-I-converting enzymeneutral endopeptidase inhibitor and the active thiol metabolite in dog plasma by high-performance liquid chromatography with ultraviolet absorption detection. Dumoulin et al. (1995) studied the metabolism of bradykinin by the rat coronary vascular bed and found that combined treatment with the ACE inhibitor enalaprilate and the NEP inhibitor retrothiorphan reduced bradykinin degradation to lower values than enalaprilate alone. Hubner et al. (2001) reported in-vitro and in-vivo inhibition of rat neutral endopeptidase and ACE with the vasopeptidase inhibitor gemopatrilat. Dumoulin et al. (2001) compared the effects of a vasopeptidase inhibitor with those of neutral endopeptidase and ACE inhibitors on bradykinin metabolism in the rat coronary bed. Crackower et al. (2002) described type-2 ACE (ACE2) as an essential regulator of heart function. In three different rat models of hypertension, ACE2 messenger RNA and protein expression were markedly reduced. Targeted disruption of ACE2 in mice resulted in a severe cardiac contractility defect. A.1.1.12.1 Inhibition of the Angiotensin-Converting Enzyme in Vitro PURPOSE AND RATIONALE An in vitro system can be used to screen potential angiotensin- converting enzyme inhibitors. Fluorescence generated by an artificial substrate in presence or absence of the inhibitor is measured to detect inhibitory activity. PROCEDURE Reagents 50 mM Tris-HCl buffer, pH8.0 + 100 mM NaCl 10 mM potassium phosphate buffer, pH8.3 Substrate: O-aminobenzoylglycyl-p-nitro-L-phenylalanyl- L-proline (molecular weight 482) (Bachem Gentec. Inc., Torrance, California, USA) stock solution: 10 mg substrate in 10 ml 50 mM Tris-HCl buffer, pH8.0 + 100 mM NaCl working solution: 2 ml stock solution is added to 18 ml 50 mM Tris-HCl buffer, pH8.0 + 100 mM NaCl; final concentration in the assay is 170.2 μM. Test compounds Compounds are made up to a concentration of 1 mM in 50 mM Tris–HCl buffer, pH 8.0 + 100 mM NaCl or 10 % methanol in Tris/NaCl if insoluble in aqueous buffer alone. This will give a final concentration in the assay of 0.1 mM. If inhibition is seen, further dilution in Tris/NaCl should be made. Enzyme preparation Lung tissue from 10 rats is diced and homogenized in a blender with 3 pulses of 15 s each. The homogenate is centrifuged at 5000 g for 10 min. The pellet is discarded, the supernatant is dialyzed against three 1 liter changes of 10 mM potassium phosphate buffer, pH 8.3 overnight in the cold and then centrifuged at 40,000 g for 20 min. The pellet is discarded, 390 mg (NH4)2SO4 is added for each ml of supernatant. This will give 60 % saturation. The solution is stirred on ice for 15 min. The pellet formed is dissolved in 15 ml potassium phosphate buffer, pH8.3 and dialyzed against the same buffer overnight in the cold with three 1 liter changes. Some protein will precipitate during dialysis. The suspension is centrifuged at 40,000 g for 20 min and the supernatant is discarded. The final solubilized enzyme preparation can be aliquoted and stored at –20 °C at least 6 months. Enzyme inhibition studies Enzyme activity is measured with a Perkin Elmer LS-5 Fluorescence Spectrophotometer or equivalent at an excitation wavelength of 357 nm and an emission wavelength of 424 nm. Enzyme assay 50 μl vehicle or inhibitor solution and 40 μl enzyme are preincubated for 5 min, then 410 μl substrate working solution is added. Samples are mixed by drawing fluid back up into the pipette and by pipetting into the cuvette. For the initial control run of the day, the auto zero is pushed immediately after placing the sample in the cuvette. EVALUATION The individual fluorescence slope is measured and %inhibition is calculated as follows: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \begin{array}{l} \% \;{\rm inhibition} \\ = \% \;{\rm inhibition} \\ = \left( {100 - \frac{{{\rm slope}\;{\rm in}\;{\rm presence}\;{\rm of}\;{\rm inhibitor}}}{{{\rm control}\;{\rm slope}}}} \right) \times 100 \\ \end{array} $$\end{document} Inhibitor concentrations on either side of the IC 50 should be tested to generate a dose-response curve. The IC 50 is calculated using Litchfield-Wilcoxon logprobit analysis. Standard data: IC 50 values for inhibition of angiotensin I-converting enzyme Compound IC 50 [M] Captopril 6.9 × 10–9 MODIFICATIONS OF THE METHOD Other assays use the cleavage of hippuric acid from tripeptides (Hip-Gly-Gly or Hip-His-Leu) whereby hippuric acid is either tritium labelled or determined spectrophotometrically (Cushman and Cheung 1969, 1971; Friedland and Silverstein 1976; Santos et al. 1985; Hecker et al. 1994). Bünning (1984) studied the binding and inhibition kinetics of ramipril and ramiprilate (Hoe 498 diacid) with highly purified angiotensin converting enzyme using furanacryloyl-Phe-Gly-Gly as substrate. The importance of tissue converting enzyme inhibition in addition to inhibition in plasma has been verified in several studies (Unger et al. 1984, 1985; Linz and Schölkens 1987). Eriksson et al. (2002), Oudit et al. (2003), and Danilczyk et al. (2003, 2004) discussed the role of the homolog of angiotensin-converting enzyme ACE2 in cardiovascular physiology. ACE2 appears to negatively regulate the renin-angiotensin system and cleaves Ang I and Ang II into the inactive Ang 1–9 and Ang 1–7. ACE2 differs in its specificity and physiological role from ACE. A.1.1.12.2 Inhibition of Neutral Endopeptidase (Neprilysin) PURPOSE AND RATIONALE Neutral endopeptidase cleaves various peptides, such as enkephalins, kinins, chemotactic peptide, atrial natriuretic factor, and substance P. Reviews on neutral endopeptidase 24.11 (enkephalinase) were given by Erdös and Skidgel (1989) and by Roques et al. (1993). Structural requirements were investigated by Santos et al. (2002). Several enzymatic assays have been developed for measuring neutral endopeptidase (NEP) activity, such as radiolabeled methods (Vogel and Altstein 1977; Llorens et al. 1982) and colorimetric assays (Almenoff et al. 1981; Almenoff and Orlowsky 1984); fluorometric assay (Florentin et al. 1984; Goudreau et al. 1994). Burell et al. (1997) and Hubner et al. (2001) used the selective NEP inhibitor radioligand 125I-labelled RB104. Cavalho et al. (1995, 1996) described a highly selective assay for neutral endopeptidase based on the cleavage of a fluorogenic substrate related to Leuenkephalin. PROCEDURE A recombinant soluble form of NEP (rNEP) was expressed using a baculovirus/insect-cell system and purified by immunoaffinity. The substrate (10 nmol) was incubated with rNEP (100 ng) in a final volume of 100 μl of 50 mM Tris- HCl buffer, pH 7.4, at 37 °C for 30 min. For the inhibition assays, the enzyme was preincubated with 1 μM thiorphan or 1 μM captopril for 20 min before its incubation with the substrate. The reaction was stopped by heating for 5 min at 100 °C. After centrifugation at 10,000 g for 10 min, the supernatant fraction was injected into an HPLC column and eluted with a 20 %–40 % gradient of acetonitrile containing 0.05 % trifluoroacetic acid over a period of 30 min, at a flow rate of 1 ml/min. The substrate and products, detected by both UV absorbance (220 nm) and fluorescence (λ em = 420 nm, λ ex = 320 nm) with the detectors arranged in series, were collected to identify the cleavage site by amino acid analysis. EVALUATION Kinetic parameters for the NEP-catalyzed hydrolysis were determined from the double-reciprocal Lineweaver-Burkq plots. MODIFICATIONS OF THE METHOD Sulpizio et al. (2004) described the determination of NEP activity in tissues after in vivo treatment of rats with ACE inhibitors. After sacrifice of the animals, approximately 250 mg of kidney tissue was homogenized in 6 volumes of 0.1 M KH2PO4, pH8.3, 0.3 M NaCl, and 1 μM ZnSO4, using a Teflon-glass motor-driven pestle. NEP activity was measured by adding 35 μl of homogenate to wells containing 5 μl buffer or 10 phosphoramidon. Next, 10 μl of 2.5 mM N-dansyl-D-alagly- p-nitro-phe-gly substrate (Florentin et al. 1984) was added to each sample to yield a 0.5 mM final concentration and incubated for 4 min at 37 °C. Subsequently, 100 μl of 10 % TCA was added and plates were centrifuged to pellet precipitated proteins. Then 50 μl of supernatant was added to 100 μl of 100 % ethanol and 50 μl of 1 N NaOH in a black fluorometric plate. After 10 min, plates were read at 590 nm emission, 320 nm excitation in a fluorometer. Zhang et al. (1994) described an ELISA for the neuropeptide endopeptidase 3.4.24.11 in human serum and leukocytes. Gros et al. (1989) studied the protection of atrial natriuretic factor against degradation and the diuretic and natriuretic responses after in vivo inhibition of enkephalinase (EC 3.4.24.11) by acetorphan. Increased tissue neutral endopeptidase 24.11 activity in spontaneously hypertensive hamsters was reported by Vishwanata et al. (1998). Graf et al. (1998) studied regulation of neutral endopeptidase 24.11 in human vascular smooth muscle cells by glucocorticoids and protein kinase C. Pham et al. (1992) described the effects of a selective endopeptidase inhibitor on renal function and blood pressure in conscious normotensive Wistar and hypertensive DOCA-salt rats. NEP is involved in organ systems other than the cardiovascular system, for example the brain and lung. Ratti et al. (2001) studied the correlation between neutral endopeptidase (NEP) in serum and the degree of bronchial hyperreactivity. Shirotani et al. (2001) found that neprilysin degrades both amyloid β peptides 1–40 and 1–42 very rapidly and efficiently. Newell et al. (2003) found that thiorphan-induced neprilysin inhibition raises amyloid β levels in rabbit cortex and cerebrospinal fluid. Facchinetti et al. (2003) described the ontogeny, regional and cellular distribution of metalloprotease neprilysin 2 (NEP2) in the rat in comparison with neprilysin and endothelin-converting enzyme-1. A.1.1.13 Quantitative Autoradiographic Localization of Angiotensin-Converting Enzyme PURPOSE AND RATIONALE Cardiac angiotensin converting enzyme can be quantified in tissue, such as in rat hearts with chronic infarction after left coronary ligation, by computerized in vitro autoradiography (Kohzuki et al. 1996) PROCEDURE Myocardial infarction is induced in Wistar rats by left coronary artery ligation (see A.3.2.2). After various time intervals (1–8 months) the animals are decapitated, the hearts rapidly removed, and snap-frozen in isopentane at –40 °C. Frozen section (20 μm) are cut in a cryostat at –20 °C. The sections are thaw-mounted onto gelatin-coated slides, dried in a desiccator for 2 h at 4 °C and then stored at –80 °C. Quantitative autoradiography Radioligand:MK351A is a tyrosyl derivative of lisinopril, a potent competitive inhibitor of ACE. MK351A is iodinated by the chloramine T method and separated free from 125I by SP Sephadex C25 column chromatography. 125 I-MK351A binding: The sections are preincubated in 10 mmol/L sodium phosphate buffer, pH7.4, containing 150 mmol/L NaCl and 2 % bovine serum albumin for 15 min at 20 °C. The sections are then incubated with 11.1KBq/ml 125I-MK351A in the same buffer for 60 min at 20 °C. Nonspecific binding is determined in the presence of 10–6 mol/L MK351A or lisinopril. Binding isotherms are determined using a set of serial sections incubated with 10−12–10−6 mol/L lisinopril for 60 min. After incubation, the sections are rapidly dried under a stream of cold air, placed in X-ray cassettes, and exposed to Agfa Scopix CR3 X-ray film for 12–72 h at room temperature. After exposure, the sections are fixed in formaldehyde and stained with haematoxylin and eosin. The optical density of the X-ray films is quantified using an imaging device controlled by a personal computer. EVALUATION The optical density of the autoradiographs is calibrated in terms of the radioactivity density in dpm/mm2 with reference standards maintained through the procedure. The apparent binding site concentration (B max) and binding affinity constant (K A) in all the areas (excluding coronary arteries) of the right ventricle, intraventricular septum, the infarcted area in the left ventricle and the non-infarcted area in the left ventricle are estimated by an iterative non-linear model-fitting computer program LIGAND (Munson and Rodbard 1980). A.1.1.14 Angiotensin Antagonism The renin-angiotensin-aldosterone hormonal axis is the major long-term control for regulation of both arterial blood pressure and sodium balance. It supports normotension or hypertension via angiotensin vasoconstriction and angiotensin plus aldosterone-induced renal sodium retention (Laragh 1993;Unger and Schölkens 2004). Volpe et al. (1995)Wagner et al. (1996) showed that regulation of aldosterone biosynthesis by adrenal renin is mediated through AT1 receptors in renin transgenic rats. Easthope and Jarvis (2002) reviewed pharmacological, pharmacokinetic and clinical data on the angiotensin II antagonist candesartan cilexetil. A.1.1.14.1 Angiotensin II Receptor Binding PURPOSE AND RATIONALE Angiotensin II receptor subtypes, AT1 and AT2, have been identified by structurally dissimilar antagonists, by different distribution in organs of various species and with specific radioligands (Chiu et al. 1989, 1990, 1992, 1993; Chang and Lotti 1991; Gibson et al. 1991; Chansel et al. 1992; Steckelings et al. 1992;Aiyar et al. 1993; Barnes et al. 1993; Bossé et al. 1993; Bottari et al. 1993; Dzau et al. 1993; Feuillan et al. 1993; van Meel et al. 1993; Alexander et al. 2001). These two types of receptors have been cloned (Sasaki et al. 1991; Murphy et al. 1991; Mukoyama et al. 1993; Kambayashi et al. 1993). Two other mammalian receptors named AT3 and AT4 have been described (de Gasparo et al. 1998). The functional correlates of angiotensin II receptors have been discussed by Timmermans et al. (1992, 1993; Bernstein and Berk 1993). Most effects of angiotensin are mediated via the AT1 receptors, but a possible role of angiotensin II subtype AT2 receptors in endothelial cells and isolated ischemic rat hearts has been suggested (Wiemer et al. 1993a, b). Clearance studies in dogs indicated that the angiotensin type 2 receptor may be related to water handling in the kidney (Keiser et al. 1992). Evidence for AT1 receptor subtypes (AT1A and AT1B) has been reported (Iwai and Inagami 1992; Kakar et al. 1992; Balmforth et al. 1994; Matsubara et al. 1994; Bauer and Reams 1995; de Gasparo et al. 1998). Chai et al. (2004) described the properties of the angiotensin IV/AT4 receptor. The assay described below is used to determine the affinity of test compounds to the angiotensin II receptor by measuring their inhibitory activity on the binding of 3H-angiotensin II to a plasma membrane preparation from rat or bovine adrenal cortex. PROCEDURE Fresh bovine adrenal glands are obtained from the local slaughter house. For rat adrenal glands, male Sprague–Dawley rats weighing 250–300 g are sacrificed. The adrenals are separated from fat tissue and the medullae removed. The cortices are minced and homogenized in 5 mM Tris buffer containing 1 mM MgCl2 and 250 mM sucrose, pH7.4, using a chilled Potter homogenizer. The homogenate is centrifuged at 3000 g and 4 °C for 10 min. The supernatant is recentrifuged at 39,000 g and 4 °C for 10 min. The pellets are resuspended in 75 mM Tris buffer containing 25 mM MgCl2, pH7.4, and recentrifuged twice at 39,000 g and 4 °C for 10 min. After the last centrifugation, the pellets are suspended in 75 mM Tris buffer containing 25 mM MgCl2 and 250 mM sucrose, pH 7.4. Samples of 0.5 ml are frozen in liquid nitrogen and stored at –70 °C. In the competition experiment, 50 μl 3H-angiotensin II (one constant concentration of 0.5–1 × 10–9 M), and 50 μl test compound (6 concentrations, 10−5–10−10 M) and 100 μl membrane suspension from rat or bovine adrenal cortex (approx. 250 mg wet weight/ml) per sample are incubated in a bath shaker at 25 °C for 60 min. The incubation buffer contains 50 mM HEPES, 0.1 mM EDTA, 100 mM NaCl, 5 mM MgCl2 and 0.2 % bovine serum albumin, pH 7.4. Saturation experiments are performed with 12 concentrations of 3H-angiotensin II (15–0.007× 10–9 M). Total binding is determined in the presence of incubation buffer, non-specific binding is determined in the presence of non-labeled angiotensin II (10–6 M). The reaction is stopped by rapid vacuum filtration through glass fiber filters. Thereby the membranebound radioactivity is separated from the free one. The retained membrane-bound radioactivity on the filter is measured after addition of 3 ml liquid scintillation cocktail per sample in a liquid scintillation counter. EVALUATION OF RESULTS The following parameters are calculated: total binding of 3H-angiotensin II non-specific binding: binding of 3H-angiotensin II in the presence of mepyramine or doxepine specific binding = total binding–non-specific binding %inhibition of 3H-angiotensin II binding: 100–specific binding as percentage of control value The dissociation constant (K i) and the IC 50 value of the test drug are determined from the competition experiment of 3H-angiotensin II versus non-labeled drug by a computer-supported analysis of the binding data (McPherson 1985). MODIFICATIONS OF THE METHOD Olins et al. (1993) performed competition studies in rat uterine smooth muscle membranes and rat adrenal cortex membranes using [125I] labeled angiotensin II. Membranes from cultured rat aortic smooth muscle cells and from human myometrium were used for binding studies with [125I] labeled angiotensin II by Criscone et al. (1993). Wiener et al. (1993) used membrane preparations from rat lung and adrenal medulla for binding studies with [125I] labeled angiotensin II. Bradbury et al. (1993) used a guinea pig adrenal membrane preparation to study nonpeptide angiotensin II receptor antagonists. Cazaubon et al. (1993) prepared purified plasma membranes from rat livers for [125I] AII binding assays. Noda et al. (1993) described the inhibition of rabbit aorta angiotensin II (AII) receptor by a non-peptide AII antagonist. Kushida et al. (1995) tested AT II receptor binding in particulate fractions of rat mesenteric artery and rat adrenal cortex and medulla with 125I-AT II. Chang et al. (1995) used rabbit aorta, rat adrenal and human AT1 receptors in CHO cells and AT2 receptors from rat adrenal and brain to characterize a nonpeptide angiotensin antagonist. Aiyar et al. (1995) tested inhibition of [125I]- angiotensin II or [125I]angiotensin II (Sar1,Ile8) binding in various membrane and cell preparations, such as rat mesenteric artery, rat adrenal cortex, rat aortic smooth muscle cell, human liver, recombinant human AT1 receptor, bovine cerebellum, and bovine ovary. Caussade et al. (1995) tested [125I]Sar1,Ile8-angiotensin II binding to rat adrenal membranes and rat aortic smooth muscle cells. Using [125I]Sar1,Ile8-angiotensin II as radioligand, de Gasparo andWhitebread (1995) compared the affinity constants of valsartan and losartan in liver and adrenal of rat and marmoset, human adrenal and in rat aortic smooth muscle cells. Webb et al. (1993) transfected the vascular angiotensin II receptor cDNA (AT1A) into Chinese hamster ovary cells to generate the stable cell line CHOAT1A and recommended these cells as a useful model to study AT1A receptor domains, which are critical to signaling pathways. Kiyama et al. (1995) used COS cells transfected with a cDNA encoding a human AT1 angiotensin II receptor to evaluate nonpeptide angiotensin II receptor antagonists. Mizuno et al. (1995) used bovine adrenal cortical membranes, Nozawa et al. (1997) membrane fractions from rat aorta, bovine cerebellumand human myocardium and [125I]angiotensin II as radioligand. Renzetti et al. (1995a, b) used membranes from rat adrenal cortex and bovine cerebellum for binding assays with [3H]angiotensin II as radioligand. Inter-species differences in angiotensin AT1 receptors were investigated by Kawano et al. (1998). The angiotensin II receptor subtype having a high affinity for lorsatan has been designated angiotensin AT1 receptor and the receptor having a high affinity for PD123177 (1-(3-methyl-4-aminophenyl) methyl-5-diphenylacetyl-4,5,6,7-tetrahydro-1H-imidazo[3,5- c]pyridine-6-carboxylic acid) as angiotensin AT2 receptor (Bumpus et al. 1991; Nozawa et al. 1994; Chang et al. 1995). In order to determine affinity for the angiotensin AT1 subtype in a radioligand binding assay with 125Isarcosine1, isoleucine8 angiotensin II, Chang and Lotti (1991), Chang et al. 1995), Wong et al. (1995) incubated membranes of tissues with both AT1 and AT2 receptors in the presence of 1 μM PD121981 (which occupied all the AT2 binding sites) and for the angiotensin AT2 subtype in the presence of 1 μM lorsatan (which occupied all the AT1 binding sites). Hilditch et al. (1995) used membranes from rat livers and [3H]-AT II for the determination of binding affinity at AT1 receptors, or membranes from bovinecerebellum and [125I]-Tyr4-AT II for AT2 receptors. Lu et al. (1995) studied the influence of freezing on the binding of 125I-sarcosine1, isoleucine8 angiotensin II to angiotensin II receptor subtypes in the rat. The results suggested that studies of AII receptor subtypes that involve freezing of the tissue underestimate the density and affinity of the AT1 receptor subtype. A.1.1.14.2 AT2 Receptor Binding PURPOSE AND RATIONALE In addition to the AT1 receptor, the AT2 receptor has attracted increasing interest (Gallinat et al. 2000; Nouet and Nahmias 2000). Steckelings et al. (2005) reviewed the knowledge of AT2 receptor distribution, signaling and function with an emphasis on growth/anti-growth, differentiation, and the regeneration of neuronal tissue. Wan et al. (2004a, 2004b) described a porcine myometrial membrane AT2 receptor assay. PROCEDURE Myometrial membranes are prepared from porcine uteri. Nielsen et al. (1997) found that in myometrium from non-pregnant sows, the Ang II receptors were almost exclusively AT2 receptors. A presumable interference by binding to AT1 receptors was blocked by addition of 1 μM losartan. Binding of [125I]Ang II to membranes was conducted in a final volume of 0.5 ml containing 50 mM Tris-HCl (pH 7.4), 100 mM NaCl, 10 mM MgCl2, 1 mM EDTA, 0.025 % bacitracin, 0.2 % BSA, homogenate corresponding to 10 mg of the original tissue weight, [125I]Ang II (80,000–85,000 cpm, 0.03 nM), and variable concentration of test substance. Samples were incubated at 25 °C for 1.5 h, and binding was terminated by filtration through Whatman GF/B glass-fiber filter sheets, which had been pre-soaked overnight with 0.3 % polyethylamine, using a Brandel cell harvester. The filters were washed with 3 × 3 ml of Tris-HCl (pH 7.4) and transferred to tubes. The radioactivity was measured in a γ -counter. All determinations were performed in triplicate. EVALUATION The characteristics of the Ang-II-binding AT2 receptor were determined by using six different concentrations (0.03–5 nmol/l) of the labeled [125I]-Ang II. Non-specific binding was determined in the presence of 1 μM Ang II. The specific binding was determined by subtracting the non-specific binding from the total bound [125I]-Ang II. IC50 was determined by Scatchard analysis of data obtained with Ang II by using GraFit (Erithacus Software, UK). MODIFICATIONS OF THE METHOD Whitebread et al. (1991) described the radioligand CGP 42112A as a high-affinity and highly selective ligand for the characterization of angiotensin AT2 receptors. Heemskerk and Saavedra (1995) performed quantitative autoradiography of Ang II AT2 receptors with [125I]CGP 42112. Heerding et al. (1997) performed mutational analysis of the Ang II type 2 receptor in order to study the contribution of conserved extracellular amino acids. Hoe et al. (2003) reported the molecular cloning, characterization, and distribution of the gerbil Ang II AT2 receptor. Utsunomiya et al. (2005) described Ang II AT2 receptor localization in cardiovascular tissues by its antibody developed in AT2 gene-deleted mice. A.1.1.14.3 Angiotensin II Induced Contraction in Isolated Rabbit Aorta PURPOSE AND RATIONALE The isolated rabbit aorta has been used to evaluate angiotensin II agonists (Liu 1993) and angiotensin II antagonists (Chang et al. 1992, 1994; Noda et al. 1993; Aiyar et al. 1995; Cirillo et al. 1995; Kushida et al. 1995; Mochizuki et al. 1995; Renzetti et al. 1995; Wong et al. 1995; Hong et al. 1998; Kawano et al. 1998). PROCEDURE New Zealand White male rabbits weighing 2–3 kg are sacrificed and exsanguinated. The thoracic aorta is removed and cleaned from adherent fat and connective tissue. The vascular endothelium is removed by gently rubbing the intimal surface of the vessel. Spiral aortic strips (2–3 mm wide and 30 mm long) are prepared and mounted in 5 ml organ baths containing Krebs-Henseleit solution (120 mM NaCl, 4.7 mM KCl, 4.7 mM MgSO4, 1.2 mM KH2PO4, 2.5 mM CaCl2, 25mMNaHCO3, glucose 10 mM, pH7.4).The organ baths are kept at 37 °C and gassed continuously with 95%O2/5%CO2. Strips are attached to isometric transducers connected to a polygraph and a resting tension of 1 g is applied to each strip. Changes in contraction are analyzed with a digital computer. Aortic strips are allowed to equilibrate for 1 h and washed every 15 min. Two consecutive contractile-response curves to cumulative addition of ATII (0.1–300 mM) are constructed. After each curve the strips are washed 4 times and allowed to relax to the baseline tension. Afterward, each strip is incubated for 30 min with the vehicle or with a single concentration of the antagonist (1 – 10 – 100 – 1000 mM) before a third concentrationresponse curve to angiotensin II is obtained. EVALUATION The result of each concentration is expressed as a percentage of maximum response to AII. The pA2 and pD′ 2 values are calculated (van Rossum 1963). MODIFICATIONS OF THE METHOD Isolated guinea pig aortas were used by Mizuno et al. (1995). Cirillo et al. (1995) evaluated the antagonism against AII-induced vasoconstriction in rat isolated perfused kidney. Chang et al. (1992, 1994) determined AII-induced aldosterone release in rat adrenal cells and AII-induced [3H]inositol phosphate accumulation in cultured rat aorta smooth muscle cells. Shibouta et al. (1993) described the pharmacological profile of a highly potent and long-acting Ang II receptor antagonist and its prodrug. Ojima et al. (1997) studied the mechanisms of the insurmountable antagonism of candesartan, an angiotensin AT1 receptor antagonist, on Ang-II-induced rabbit aortic contraction in contraction and binding studies. A.1.1.14.4 Angiotensin II Antagonism in Vivo PURPOSE AND RATIONALE The effect of ATII antagonists on blood pressure has been measured in anesthetized (Olins et al. 1993; Beauchamp et al. 1995; Kawano et al. 1998), in pithed (Cazes et al. 1995; Christophe et al. 1995; Cirillo et al. 1995; Deprez et al. 1995; Häuser et al. 1998) and in conscious (Junggren et al. 1996; Nozawa et al. 1997; Shibasaki et al. 1997; Hashimoto et al. 1998) normotensive and hypertensive rats. PROCEDURE Male Sprague-Dawley rats are anesthetized with 100 mg/kg i.p. Inactin and placed on servo-controlled heating pads to maintain body temperature between 37 °C and 38 °C. PE50 catheters are implanted in the femoral artery and vein to measure arterial blood pressure and administer compounds, respectively. A catheter is placed in the trachea to ensure airway patency. Arterial pressure is measured continuously by connecting the arterial catheter to transducer coupled to a Gould pressure transducer. The output is recorded on a polygraph. Mean arterial pressure is derived electronically. After a 30–45 min stabilization period, autonomic transmission is blocked by treatment with mecamylamine (3 mg/kg i.v.) and atropine (0.4 mg/kg i.v.). After arterial pressure has stabilized, angiotensin is infused i.v. in isotonic saline with a syringe pump. When the pressure response to angiotensin has stabilized, angiotensin II antagonists are given in increasing doses. The doses are given intravenously in a cumulative fashion, i. e., the next highest dose is given at the time of maximum response to the prior dose. EVALUATION Data are presented as percent inhibition of the angiotensin pressor response to each dose of the antagonists and plotted against the log of the cumulative doses of antagonist. Linear regression is used to calculate the dose at which the response to angiotensin is inhibited 50 % (ID 50) for each rat. Means ± SEM are calculated. MODIFICATIONS OF THE METHOD Olins et al. (1993), Cirillo et al. (1995) determined also the antihypertensive effects in conscious spontaneously hypertensive rats and in conscious sodium-deficient dogs. Stasch et al. (1997) studied the long-term blockade of the angiotensin II receptor in renin trangenic rats, salt-loaded Dahl rats, and stroke-prone spontaneously hypertensive rats. Nishioka et al. (1998), Richter et al. (1998) used the (mRen-2)27 transgenic (Tg+) rat, a hypertensive model dependent on increased expression of the renin angiotensin system, to explore the role of angiotensin AT2 receptors in the control of cardiovascular and renal excretory function. Simoes e Silva et al. (1998) evaluated the effects of chronic administration of an angiotensin antagonist on diuresis and natriuresis in normotensive and spontaneously hypertensive rats. Kai et al. (1998) examined the effects of an angiotensin II type 1 antagonist on cardiac hypertrophy and nephropathy using Tsukuba hypertensive mice (THM) carrying both human renin and angiotensinogen genes. Kivlighn et al. (1995a, b), Gabel et al. (1995), studied angiotensin II antagonists in conscious rats, dogs, rhesus monkeys and chimpancees. Keiser et al. (1995) studied arterial blood pressure in conscious renal hypertensive rats, conscious sodium-depleted dogs, conscious sodium-depleted monkeys and conscious renal hypertensive monkeys. Kim et al. (1997) examined the effects of an angiotensin AT1 receptor antagonist on volume overloadinduced cardiac gene expression in rats. Cardiac volume overload was prepared by abdominal aortocaval shunt. Cardiac tissue mRNA was measured by Northern blot analysis with specific probes. Yamamoto et al. (1997), Ogilvie et al. (1998), studied angiotensin II receptor antagonists in acute heart failure induced by coronary artery ligation in anesthetized dogs and in chronic heart failure induced by left ventricular rapid-pacing in conscious dogs. Massart et al. (1998) evaluated the cumulative hypotensive effects of angiotensin II- and endothelin-1- receptor antagonists in a model renovascular hypertension in dogs. Hayashi et al. (1997) examined the hemodynamic effects of an angiotensin II type 1 receptor antagonist in rats with myocardial infarction induced by coronary ligation. Kivlighn et al. (1995c) studied the effects of a nonpeptide that mimics the biological actions of angiotensin II in anesthetized rats. Huckle et al. (1996) evaluated angiotensin II receptor antagonists for their ability to inhibit vascular intimal thickening in a porcine coronary artery model of vascular injury. A.1.1.15 Renin-Inhibitory Activity Using Human Kidney Renin and a Synthetic Substrate PURPOSE AND RATIONALE In contrast to other enzymes, renin shows a rather high species specificity. To be relevant for humans human renin has to be used. One of the reasons that human renin is specific for human angiotensinogen lies in the sequence of human angiotensinogen itself. Inhibition of renin is measured by angiotensinogen formed in the presence of angiotensinase inhibitors. The following procedure is used to determine the effect of potential renin inhibitors on purified human kidney renin without interference from plasma proteins or lipids. PROCEDURE The synthetic substrate represents the first fourteen amino acids of the N-terminus of human angiotensinogen: Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His- Leu-Val-Ile-His-Asn. The assay mixture is composed of phosphate buffer (pH 7.5), bovine serum albumin, 3 mM EDTA, 0.01 mM phenylmethylsulfonyl fluoride (PMSF), 0.002 % Genapol PF 10, test compound (dissolved in DMSO), substrate (3 μM) and purified human kidney renin (Calbiochem GmbH, Frankfurt/M., Germany; cat. no. 553861). The mixture is incubated for two hours at 37 °C. Then the reaction is stopped by transfer of 450 μl into preheated (95 °C) Eppendorf tubes. The amount of angiotensin I liberated is measured by RIA (Renin MAIA kit, Serono Diagnostika GmbH, Freiburg, Germany). Human angiotensinogen (0.2 μM) may be used as a substrate instead of the tetradekapeptide. The pH value of the incubation mixture may be lowered to 6.0 by using a maleic acid buffer; this results in higher renin activity. HEPES (N- 2-hydroxyethylpiperazine-N′-2-ethane sulfonic acid) may be substituted for phosphate in the pH7.5 buffer. EVALUATION Renin activity, i. e. angiotensin I production (ng/ml × 2 h), is corrected for an angiotensin I – like immunoreactivity which can be measured in the assay samples even in the absence of added renin. IC 50 values are determined from a plot of renin activity (as per cent of control) vs. molar concentration of the test compound. MODIFICATIONS OF THE METHOD Wang et al. (1993) described a continuous fluorescence assay of renin activity employing a new fluorigenic peptide substrate. Inhibition of plasma renin activity in blood samples from various species can be determined in order to evaluate the species specificity of a renin inhibitor (Linz et al. 1994) Blood samples are obtained from dogs, sheep and rhesus monkeys by venipuncture. Wistar rats and guinea pigs are anesthetized with Nembutal (60 mg/kg intraperitoneally) and the blood is collected by puncture of the abdominal aorta. Human blood is collected from volunteers (Donafix blood collecting set, Braun Melsungen AG, Melsungen, FR Germany) in cooled bottles. All blood samples are anticoagulated with Na-EDTA (final concentration 10–15 mM). The renin is dissolved in DMSO as 10−2 M stock solution and diluted before each experiment in DMSO. The endogenous formation of ANG I in plasma during incubation at 37 °C is determined as the measure of renin activity. Generation and quantitation of ANG I are performed using a commercial radio immunoassay kit (Renin-MAIA, Serono Diagnostika GmbH, Freiburg, FR Germany). Plasma samples are thawed on ice and centrifuged after addition of 100 μl PMSF solution (kit) per 10 ml. The assay mixture contains 450 μl plasma plus 1 %(v/v) PMSF solution, 45 μl buffer (phosphate buffer, pH = 7.4, + 10−5 M ramiprilate) and 5 μl renin inhibitor solution (diluted in DMSO as required) or pure DMSO for controls. The assay is incubated for an appropriate time (2–3 hours) at 37 °C. ANG I is measured in 100 μl samples (triplicate determinations). Basal ANG I immunoreactivity of the plasma is determined from an unincubated control assay (0 °C). This pre-incubation value is subtracted from all measurements. The renin activity in the presence of the renin inhibitor is calculated as percent activity in relation to control samples containing only DMSO. The IC 50 value is determined from a semilogarithmic plot of percent renin activity versus concentration of the renin inhibitor. Wood et al. (1990) determined the activity of a synthetic renin inhibitor against rat, mouse, dog, guinea pig, rabbit, cat, marmoset and human renin using plasma pools from these species. Plasma from each species was collected using EDTA as an anticoagulant. Samples of plasma were incubated at 37 °C in the presence or absence of varying concentrations of test compound. The ANG I formed was measured by radioimmunoassay. Shibasaki et al. (1991) used squirrel monkeys to study the in vivo activity of a specific renin inhibitor after intravenous and oral application. Bohlender et al. (1996) reconstructed the human renin-angiotensin system in transgenic rats overexpressing the human angiotensin gene TGR(hOGEN) 1623 by chronically injecting human recombinant renin intravenously using Alzet pumps. Salimbeni et al. (1996) tested the in vitro inhibition of human plasma renin activity by two synthetic angiotensinogen transition state analogues. Wood et al. (2003) determined the inhibitory potency of an orally effective renin inhibitor in vitro against human renin. Human recombinant renin (0.33 ng/ml) was incubated with a synthetic tetradecapeptide substrate (TDP, 13.33 μM) corresponding to the 14 terminal amino acids of human angiotensinogen, in 0.33 M Tes buffer, pH7.2, containing 1 % human serum albumin and 0.1 % neomycin sulphate for 1 h at 37 °C. The enzymatic reaction was stopped by adding 1 ml ice-cold 0.1 M Tris-acetate buffer, pH 7.4, containing 0.1 % HSA. The angiotensin generated during the incubation was measured by radioimmunoassay. The oral activity was confirmed in hypertensive patients (Gradman et al. 2005). A.1.1.16 PAF Binding Assay PRINCIPLE AND RATIONALE Injection of platelet activating (PAF) factor induces a wide range of potent and specific effects on target cells, including aggregation of platelets and shock symptoms like systemic hypotension, pulmonary hypertension, increased vascular permeability, neutropenia and thrombocytopenia. Inhalation of PAF causes immediate bronchoconstriction followed by inflammation of the airways (further information see Sect.B.1.9). Hikiji et al. (2004) showed in PAF-deficient mice that the absence of platelet-activating factor receptor protects mice from osteoporosis following ovariectomy, a model of postmenopausal osteoporosis. PAF is also implicated in estrogen-induced angiogenesis via nuclear factor-κB activation (Seo et al. 2004) and in delaying corneal wound healing (Bazan 2005). The PAF receptor belongs to the superfamily of G protein-coupled receptors (Chao and Olson 1993, Izumi and Shimizu 1995). Cloning studies have indicated a single human PAF receptor gene containing an intron at the 5′ flanking region, providing alternative sequences (Ishi and Shimizu 2000). The following procedure is used to detect compounds that inhibit binding of 3H-PAF (platelet activating factor) in rabbit platelets (PAF receptor). PROCEDURE Crude rabbit platelets are incubated in plastic tubes for 15 min at 25 °C in a buffer solution (0.54 g/l KH2PO4, 0.6 g/l Na2HPO4, 5.8 g/l NaCl, 1.0 g/l BSA, pH 7.1) with 1 nM synthetic 3H-labeled PAF (1-O-[1,2- 3 H 2]alkyl-2-O-acetyl-sn-glycero-3-phosphocholine) and various concentrations of test compound. Nonspecific binding is determined in the presence of 10 μM CV 3988. Bound ligand is separated from the incubation medium by rapid filtration through Whatman GF/C glass fibre filters. Following rinsing with ice-cold buffer (3 × 5 ml), the filters are placed in 10 ml scintillation cocktail for radioactivity determination. EVALUATION The following parameters are calculated: total binding of 3H-PAF non-specific binding in the presence of 10 μM CV 3988 specific binding = total binding–non-specific binding % inhibition: 100–specific binding as percentage of the control value Compounds are first tested at a single high concentration (5000nM) in triplicate. For those showing more than 50 % inhibition a displacement curve is constructed using 7 different concentrations of test compound. Binding potency of compounds is expressed either as a “relative binding affinity” (RBA) with respect to the standard compound (CV 3988) which is tested in parallel or as an IC 50. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\rm RBA} = \frac{{{\rm IC}_{50} \;{\rm standard}\;{\rm compound}}}{{{\rm IC}_{50} \;{\rm compound}}} \times 100\% $$\end{document} Standard data: CV 3988 IC 50: 276nM ± 24 (n = 20) MODIFICATIONS OF THE METHOD Several authors (Casals-Stenzel et al. 1987; Dent et al. 1989a, b; Ring et al. 1992; Ukena et al. 1988) used the specific platelet activating factor receptor antagonist [3H]WEB-2086 or [3H]Apafant to identify and characterize the PAF-receptors expressed on the cell surface of platelets, macrophages, and eosinophils. Balsa et al. (1996) characterized [3H]Apafant binding to the PAF receptor on rabbit platelet membranes and compared a microplate filtration system with the standard method. A.1.1.17 Endothelin A.1.1.17.1 General Considerations Endothelin is an endothelium-derived peptide family consisting of three peptides (ET-1, ET-2, and ET-3) with very potent and long-lasting vasoconstrictive activity (Yanagisawa et al. 1988a, b; King et al. 1989; Miller et al. 1989; Yanagisawa and Masaki 1989; Inoue et al. 1989; Shinmi et al. 1989; Vanhoutte et al. 1992; Davenport 2002; Masaki 2004). ET-1 is processed from prepro ET-1, pro-ET-1 to big ET-1, which is converted to ET-1 by the endothelinconverting- enzyme (ECE). Subtypes of endothelin receptors have been described (Takayanagi et al. 1991; Miyazaki et al. 1992). Molecular characterization of the ETA and ETB receptors was reported by Miyazaki et al. (1992), Sakuarai et al. (1992). In addition, the existence of a third type, ETC, was found in Xenopus laevis (Karne et al. 1993). The comparison of recombinant endothelin receptors shows different affinity rank orders to the three endothelins (Masaki et al. 1994). Grant et al. (1997) reported the in vitro expression of endothelin-1 (ET-1) and the ETA and ETB ET receptors by prostatic epithelium and stroma. The ET peptides not only elicit potent and longlasting contractions of isolated strips of various blood vessels in vitro but also increase blood pressure in vivo suggesting that this peptide family may be involved in the pathogenesis of cardiovascular diseases (Simonson and Dunn 1990; Masaki 1991; Doherty 1992; Goto et al. 1996; Gray and Webb 1996; Douglas and Ohlstein 1997). Sarafotoxin S6c, originally isolated from snake venom, is an agonist which distinguishes between endothelin subtypes (Williams et al. 1991). Endothelin is degradeted by vascular smooth muscle cells (Bernmek et al. 1996). A.1.1.17.2 Evaluation of Endothelin Activity PURPOSE AND RATIONALE Most investigators used isolated arteries to evaluate the activity of endothelins and derivatives. Rodman et al. (1989) compared the potency and efficacy of porcine and rat endothelin in rat aortic and pulmonary rings. PROCEDURE Arterial rings are obtained from male Sprague Dawley rats weighing from 300–400 g. Rats are anesthetized with 50 mg/kg i.p. pentobarbital, the chest is opened, 100 units heparin sulfate are injected into the right ventricle, and the rats are exsanguinated. Rings are then isolated from either the descending thoracic aorta or the right main pulmonary artery, cleaned of adventitia, and suspended from Grass FT03 force-displacement transducers in muscle baths containing 10 ml of physiologic salt solution of the following composition ( × 10–3 M): CaCl2 1.80, MgSO4 0.83, KCl 5.3.6, NaCl 116.34, NaH2PO4 0.40, D-glucose 5.50, and NaHCO3 10.04. The solution is maintained at 37 °C and bubbled with 21%O2 and 5%CO2. Endothelium-denuded rings are prepared by gently rubbing the intima with a roughened steel rod. Denudation is confirmed by the absence of relaxation to 10−5 M acetylcholine in rings precontracted with 10−7 M norepinephrine. Resting force is adjusted to the optimum resting tension of 0.75 g for pulmonary artery rings and 1.0 g for aortic rings. Maximum contraction to 8 × 10−2 M KCl is determined and subsequent responses to endothelin are expressed as a percentage of maximum KCl contraction for determination of maximum effectiveness or as a percentage of maximum endothelin contraction for determination of potency. EVALUATION Concentration-response curves are compared using the method of Carpenter (1986). Data are expressed as means ± SEM and statistical comparisons are performed using Student’s t-test, with P < 0.05 considered significant. MODIFICATIONS OF THE METHOD Lembeck et al. (1989) studied the effects of endothelin on the cardiovascular system and on smooth muscle preparations in different species. Reynolds andMok (1990) studied the role of thromboxane A2/prostaglandin H2 receptor in the vasoconstrictor response of rat aorta to endothelin. Pang et al. (1990) studied the cellular mechanisms of action of endothelin in isolated canine coronary arteries. Lüscher et al. (1992) used perfused and pressurized mesenteric resistance arteries of rats and human internalmammary arteries to study the interaction between endothelin and endothelium-derived relaxing factors. Michel et al. (2003) studied the endothelin system in various animal models of pulmonary hypertension. Advenier et al. (1990) studied the contractile activity of three endothelins (ET-1, ET-2 and ET-3) on the human isolated bronchus. Wallace et al. (1989) compared the effects of endothelin- 1 and endothelin-3 on the rat stomach. Aldosterone secretion in cultured calf zona glomerulosa cells was stimulated by ET-1 and sarafotoxin S6b to a similar degree, but less than by angiotensin II (Gomez-Sanchez 1990). Brock and Danthuluri (1992) used cultured vascular smooth muscle cells to study the cellular actions of endothelin. Pigment dispersion in cultured dermal melanophores from Xenopus laevis was used as indicator of ETC receptor mediated responses (Karne et al. 1993). A.1.1.17.3 Endothelin Receptor Antagonism in Vitro PURPOSE AND RATIONALE Competitive endothelin antagonists are of therapeutic interest (Ihara et al. 1991; Fujimoto et al. 1992; Fukuroda et al. 1992; Urade et al. 1992; Breu et al. 1993; Mihara and Fujimoto 1993; Sogabe et al. 1993; Warner 1994; Opgenorth 1995; Brunner 1998). A sensitive sandwich-enzyme immunoassay for human endothelin has been established by Suzuki et al. (1989). PROCEDURE The ventricles of rat hearts are minced with scissors and homogenized in 7 vol of ice-cold 20mMNaHCO3 containing 0.1mMPMSF (Phenylmethylsulfonylfluoride), pH 7.4, with a Polytron homogenizer (Brinkman Instruments Inc., Westberg, NY). The homogenates are centrifuged at 1000 g for 10 min, and then the pellet discarded. The supernatant is centrifuged at 30,000 g for 30 min. The pellet is washed once and resuspended in Tris buffer (50 mM, pH7.4 at 25 °C) containing 0.1 mM PMSF, and stored at –80 °C until use. For binding studies (Gu et al. 1989) cardiac membranes (0.21 mg/ml as protein) are incubated with 25pM [125I]ET-1 or [125I]ET-3 (New England Nuclear) in a final assay volume of 0.1 ml in borosilicated glass tubes, containing 50 mM Tris- HCl, 0.1 mM PMSF, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 10 μg/ml pepstatin A, 250 μg/ml bacitracin, and 10 μg/ml soybean trypsin inhibitor (pH 7.4). Binding is performed for 60 min at 37 °C. The binding reaction is terminated by the addition of 2.5 ml of ice-cold 50 mM Tris-HCl (pH 7.4), followed by a rapid filtration through a Whatman GF/C glass fibre filter (presoaked in 1 % polyethyleneimine) under reduced pressure. The filters are then quickly washed 4 times with 2.5 ml of the buffer. Radioactivity retained on the filter is counted. EVALUATION Non-specific binding is defined in the presence of ET- 1. Specific binding is the difference between total and non-specific binding.K i-values and Scatchard plots are calculated. MODIFICATIONS OF THE METHOD The nomenclature of endothelin receptors has been reviewed by Alexander et al. (2001). Cain et al. (1991) described an endothelin-1 receptor binding assay for high throughput chemical screening using the clonal cell line A10 of smooth muscle cells, derived from embryonic rat thoracic aorta. Functional endothelin/sarafotoxin receptors were described in rat heart myocytes (Galron et al. 1989) and in the rat uterus (Bousso-Mittler 1989). Mihara and Fujimoto (1993) cultured rat aortic smooth muscle A7r5 cells expressing ETA receptors (Takuwa et al. 1990) and human Girardi heart cells expressing ETB receptors (Mihara and Fujimoto 1992). Receptor specificity could be demonstrated. Mihara et al. (1994) characterized the nonpeptide endothelin receptor antagonist 97–139, both in vitro (rat aortic smooth muscle cells and Girardi heart cells) and in vivo (ET1- antagonism in pithed rats) and compared it with another endothelin receptor antagonist (BQ-123). Discrepancies between in vitro and in vivo data were explained by different plasma binding. Aramori et al. (1993) studied the receptor-binding properties and the antagonistic activities of an endothelin antagonist in transfected Chinese ovary hamster cells permanently expressing the two ET receptor subtypes (ETA and ETB). De Juan et al. (1993) characterized an endothelin receptor subtype B in the retina of rats. Clozel et al. (1994) performed binding assay on cells or membranes from baculovirus infected insect cells that expressed recombinant ETA or ETB receptor, CHO cells that expressed recombinant ETA or ETB receptor, cultured human vascular smooth muscle cells from umbilical veins, rat mesangial cells (for ETA), microsomal membranes from human placenta and from porcine cerebellum (for ETB1) and from porcine trachea (for ETB2, using BQ-3020 or sarafotoxin S6C as ligand). Williams et al. (1995) used CHO cells expressing cloned ETA or ETB receptors directly in binding and functional assays without preparing membranes from them. Reynolds et al. (1995) used CHO-K1 cells expressing recombinant human ETB receptor, Ltk − cells expressing human ETA receptor and rabbit renal artery vascular smooth muscle cells expressing rabbit ETA receptor for evaluation of an ETA receptor antagonist. Rat or bovine cerebella were used for differentiation of receptor subtypes (Williams et al. 1991). Peter and Davenport (1995) proposed a selective ligand for ETA receptors. Ihara et al. (1992),Watakabe et al. (1992) described radioligands for endothelin (ETB) receptors. Vigne et al. (1996) described the properties of an endothelin-3-sensitive Eta-like endothelin receptor in brain capillary endothelial cells. The human type-B endothelin receptor was cloned from human lung poly A + RNA and expressed in CHO cells by Chiou et al. (1997). Dissociation characteristics of endothelin receptor agonists and antagonists were determined. Stables et al. (1997) described a bioluminescent assay for agonist activity at G-protein-coupled receptors, such as the endothelin ETA receptor. Transient expression of apoaequorin in CHO cells and reconstitution with the cofactor coelenterazine resulted in a large, concentration dependent agonist-mediated luminescent response following cotransfection with the endothelin ETA, angiotensin ATII, TRH and neurokinin NK1 receptors, all of which interact predominantly with the Gα q-like phosphoinositidase-linkedGproteins. A.1.1.17.4 Endothelin Receptor Antagonism in Vivo PURPOSE AND RATIONALE Various pharmacological models have been used for the characterization of endothelins and endothelin antagonists, such as the isolated porcine coronary artery. (Hickey et al. 1985; Yanagisawa et al. 1988, 1989; Inoue et al. 1989; Kimura et al. 1989; Ihara et al. 1991; Fukuroda et al. 1991). Since the smooth musculature is considered to contain mainly ETA receptors the preparation is used to test ETA antagonists. PROCEDURE Left anterior descending coronary arteries are isolated from fresh porcine hearts. Connective tissues and adherent fat are removed. For removal of vascular endothelium, the intimal surface of spiral strips is rubbed gently with filter paper. The endothelium-denuded arteries are cut into spiral strips about 10 mm long and 1 mm wide. Each strip is suspended in an organ bath containing Krebs-Henseleit solution bubbled with 95%O2/5%CO2 at 37 °C. After equilibration, reference contraction is isometrically obtained with 50 mM KCl. Concentration-response curves for ET-1 are obtained by cumulative additions of ET-1. Antagonists are added 20 min before the cumulative additions of ET-1. EVALUATION The pA2 values and slopes are obtained by analysis of Schild plots. MODIFICATIONS OF THE METHOD Opgenorth et al. (1996) characterized an orally active and highly potent ETA-selective receptor antagonist by in vitro and in vivo methods. Calo et al. (1996) investigated three rabbit vessels, the carotid, the pulmonary artery, and the jugular vein to identify vascular monoreceptor systems, either ET(A) or ET(B), for structure-activity studies of endothelins and their antagonists. Vedernikov et al. (1993) used rings of the left circumflex coronary artery from dogs which were denuded of endothelium and exposed to anoxic periods. August et al. (1989), Urade et al. (1992) used rat aortic smooth muscle denuded of the epithelium and Sogabe et al. (1993) spirally cut strips of rabbit aorta. Williams et al. (1995) used rat aorta, rabbit iliac and pulmonary artery for contractile assays, and anesthetized ferrets and conscious normotensive dogs as in vivo models to characterize a nonpeptidyl endothelin antagonist. Itoh et al. (1993) studied the preventive effect of an ETA receptor antagonist on experimental cerebral vasospasm in dogs using a two-hemorrhage model of subarachnoid hemorrhage. Clozel et al. (1993) performed similar experiments in rats. The vasodilating effect in the isolated perfused rat mesentery which is found after infusion of rat endothelin (Warner et al. 1989) and after the selective ETB receptor agonist sarafotoxin S6c (Williams et al. 1991) can be antagonized by an endothelin receptor antagonist (Clozel et al. 1993). Ercan et al. (1996) found an increase of digoxininduced ectopic ventricular complexes by endothelin peptides in isolated guinea pig hearts, which could be antagonized by an endothelin-A receptor antagonist. The endothelin-induced sustained increase of blood pressure in anesthetized rats was studied by Yanagisawa et al. (1988), Inoue et al. (1989), Ihara et al. (1991). Intravenous bolus injection of endothelin causes a biphasic blood pressure response: a transient decrease, probably mediated from the release of vasodilator mediators (prostacyclin and EDRF), and a sustained increase (Rubanyi and Bothelho 1991). Nishikibe et al. (1993) examined the antihypertensive effect of an endothelin antagonist in a genetic hypertensive model (stroke-prone spontaneously hypertensive rats). Watanabe et al. (1995) characterized the pharmacological profile of a non-selective endothelin receptor antagonist and studied the inhibition of myocardial infarct size in rats. The contractile activity of the isolated guinea pig trachea without epithelium and of the guinea pig longitudinal muscle was used by Urade et al. (1992) for determination of ET B receptor mediated responses. Spinella et al. (1991) assessed bioactivity of a specific endothelin-1 antagonist in an isolated perfused guinea pig lung preparation in which pulmonary artery pressure was monitored. Gosselin et al. (2002) demonstrated the effects of a selective ETA-receptor antagonist in murine models of allergic asthma. Tabrizchi and Ford (2003) studied the haemodynamic effects of the endothelin receptor antagonist tezosentan in anaesthetized rats treated with tumor necrosis factor-alpha. A.1.1.17.5 Quantitative Autoradiographic Localization of Endothelin-1 Receptor PURPOSE AND RATIONALE The endothelin-1 (ET-1) receptor can be quantified in tissue, such as in rat hearts with chronic infarction after left coronary ligation, by computerized in vitro autoradiography (Kohzuki et al. 1996) PROCEDURE Myocardial infarction is induced in Wistar rats by left coronary artery ligation (see A.3.2.2). After various time intervals (1–8 months) the animals are decapitated, the hearts rapidly removed, and snap-frozen in isopentane at –40 °C. Frozen section (20 μm) are cut in a cryostat at –20 °C. The sections are thaw-mounted onto gelatin-coated slides, dried in a desiccator for 2 h at 4 °C and then stored at –80 °C. Quantitative autoradiography Radioligand: Endothelin-1 is iodinated with 125Iodine using Iodogen (Pierce Chemical Co, IL, USA) 125 I-ET-1 binding: The sections are preincubated for 15 min at 20 °C in 20 mmol/L Hepes buffer, pH 7.4, containing 135 mmol/L NaCl, 2 mmol/L CaCl2, 0.2 % BSA, and 0.01 % bacitracin. The sections are then incubated with 11.1KBq/ml 125I-ET-1 in the same buffer for 60 min at 20 °C. Nonspecific binding is determined in the presence of 10–6 mol/L ET-1. Binding isotherms are determined using a set of serial sections incubated with 10–12 to 10–6 mol/L unlabelled ET-1 for 60 min. After incubation, the sections are rapidly dried under a stream of cold air, placed in X-ray cassettes, and exposed to Agfa Scopix CR3 X-ray film for 12–72 h at room temperature. After exposure, the sections are fixed in formaldehyde and stained with hematoxylin and eosin. The optical density of the X-ray films is quantified using an imaging device controlled by a personal computer. EVALUATION The optical density of the autoradiographs is calibrated in terms of the radioactivity density in dpm/mm2 with reference standards maintained through the procedure. The apparent binding site concentration (B max) and binding affinity constant (K A) in all the areas (excluding coronary arteries) of the right ventricle, intraventricular septum, the infarcted area in the left ventricle and the non-infarcted area in the left ventricle are estimated by an iterative non-linear model-fitting computer program LIGAND (Munson and Rodbard 1980). A.1.1.17.6 Inhibition of Endothelin Converting Enzyme PURPOSE AND RATIONALE Endothelin converting enzyme inhibitors suppress the biosynthesis of endothelin are therefore potential antihypertensive drugs (De Lombaert et al. 1994; Trapani et al. 1995; Morita et al. 1994; Bihovsky et al. 1995; Claing et al. 1995; Descombes et al. 1995; Chackalamannil et al. 1996; Jeng 1997; Jeng and De Lombaert 1997; Brunner 1998). Purification of rat and porcine endothelin converting enzyme (ECE) was reported by Ohmaka et al. (1993), Takahashi et al. 1993). Molecular cloning and characterization of the enzyme ECE-1 was performed from rat (Shimada et al. 1994), bovine (Ikura et al. 1994; Schmidt et al. 1994; Xu et al. 1994), and human tissue (Schmidt et al. 1994; Shimada et al. 1995; Yorimitsu et al. 1995). A second enzyme, termed ECE-2, was cloned (Emoto and Yanagisawa 1995). Walkden and Turner (1995) described the expression of endothelin converting enzyme and related membrane peptidases, e. g., the endopeptidase E-24.11, in the human endothelial cell line EA.hy926. IN VITRO ASSAY A rapid and selective in vitro assay for endothelin-converting enzyme was described by Fawzi et al. (1994). The assay is based on the quantitative determination of [125I]endothelin-1 released from (3-[125I]iodotyrosyl13) big endothelin-1 by binding to themembrane bound endothelin receptor. PROCEDURE For the preparation of lung membranes, frozen guinea pig lungs are weighed and homogenized in 10 times gram tissue weight of solution A (50 mM Tris-HCl, pH7.4, 025 M sucrose, and 2 mM EDTA) using a Polytron tissue homogenizer. Homogenization is repeated 4 times with 5- to 8-min intervals between homogenization. Homogenates are spun for 30 min at 2000 g. Supernatants containing membranes are carefully decanted and saved. Pellets are rehomogenized in solution A and homogenates are spun at 2000 g for 30 min. Supernatants are removed, mixed with supernatants from the first spin and spun at 100,000 g for 60 min. Pellets containing membranes are suspended in solution B (10 mM Tris-HCl, pH7.4, and 0.125 M sucrose) using a Dounce homogenizer. Samples are divided into 1-ml fractions, rapidly frozen in a dry icemethanol bath, and stored at −80 °C. Rat liver membranes are prepared with the same method and further purified over a sucrose step gradient. (10 mM Tris-HCl, pH 7.4) containing 44 % sucrose at a protein concentration of 2 mg/ml. Samples of 25 ml are placed in ultraclear centrifuge tubes for the Beckman SW28 rotor, overlaid with 10 ml solution C containing 42.3 % sucrose, and spun for 2 h at 27,000 rpm (100,000 g). Top layers containing membrane are collected and diluted with solution C to obtain an 8 % sucrose concentration. Samples are spun in a 45 Ti rotor (100,000 g) for 1 h. Supernatants are discarded. Pellets containing membrane are suspended in solution B, divided into 1-ml samples, rapidly frozen in dry icemethanol bath, and stored at −80 °C. For the endothelin (ET) binding assay, membrane preparations are incubated with selected concentrations of [125I]endothelin-1 (final reaction volume = 500 μl) in a solution D containing 60 mM Tris-HCl, pH 7.4, 150 mM NaCl and 6 mg/ml BSA for 90 min at 37 °C. Reactions are terminated by the addition of 4 ml of solution E containing 10 mM Tris-HCl, pH 7.4, and 150mMNaCl at 4 °C followed by rapid filtration on Whatman GF/B glass microfiber filters. Filters are presoaked for 1 h at 4 °C in a solution containing 50 mM Tris-HCl, pH 7.4, 10 mg/ml BSA and 0.1 % sodium azide. Test tubes and filters are washed four times with 4 ml of solution E at 4 °C, and radioactivity retained on the filters is counted in a gamma counter. Nonspecific binding is determined in the presence of 1 μM unlabeled ET-1 in the reaction mixture. For the endothelin converting enzyme assay, samples containing 10 μg of protein are incubated in a solution containing 50 mM Tris-HCl, pH7.0, 100 mM NaCl and 5 mg/ml BSA in a final volume of 100 μl. Conversion reactions are initiated by addition of [125I]big endothelin-1 to obtain a final concentration of 500 pM. Samples are incubated for 2 h at 37 °C. To measure [125I]endothelin-1 released from [125I]big endothelin-1 conversion, 50 μg of purified rat liver membranes (as a source of ET receptors) is added to the reaction mixture, and reaction volume is adjusted to 500 μl and solution composition is adjusted to that of solution D of the endothelin binding assay. Following a 90-min incubation at 37 °C to reach equilibrium in binding, reactions are terminated by addition of a solution E at 4 °C followed by rapid filtration on Whatman GF/B glass microfiber filters. Nonspecific binding is determined in the presence of 1 μM unlabeled ET-1 in the reaction mixture. Specific ET-1 binding is used as an index of endothelin converting enzyme activity. To test the effect of endothelin converting enzyme inhibitors, endothelin converting enzyme assays are carried out in the presence of desired concentrations of the compounds. EVALUATION Endothelin converting enzyme activity in the presence of compounds is expressed as a percentage of control endothelin converting enzyme activity in the membrane preparation which is determined simultaneously. The concentration of compounds producing a 50 % inhibition of endothelin converting enzyme activity (IC 50 values) is determined from a plot of the percentage of control endothelin converting enzyme activity versus log concentration of compounds. IN VIVO ASSAY Procedure Male Sprague Dawley rats weighing 300–400 g are anesthetized with ether, spinalized and placed under artificial respiration. The vagus nerves are cut and the carotid arteries ligated. A catheter is placed in one of the carotid arteries to allow measurement of arterial blood pressure. The second catheter in placed into the penile vein to allow infusion or injection of drugs. After stabilization, the animals receive a first injection of either ET-1, big ET-1, norepinephrine, angiotensin I or AT II, The pressor responses are recorded and after return to the baseline, a second injection of the agonist is given either in the presence or the absence of the inhibitor. EVALUATION Data are calculated as mean ± SEM. Student’s t-test for paired and unpaired observations is used to analyze the results. MODIFICATIONS OF THE METHOD Little et al. (1994) developed a two-step protocol for high-throughput assays of endothelin converting enzyme activity. Human umbilical vein and human aorta endothelial cells were found to preferentially convert the big endothelin-1 isopeptide through a membranebound, thiorphan-insensitive, and phophoramidonsensitive zinc metalloendopeptidase. Endothelins are quantified by a separate step using either enzyme immunoassays or radioceptor assays in 96-well formats. The method can be used to either characterize ECE from different tissues or screen for inhibitors of a specific ECE activity. McMahon et al. (1993) tested the effects of endothelin converting enzyme inhibitors and endothelin receptor subtype A antagonists on blood pressure in spontaneously and renal hypertensive rats. Changes of vascular resistance in isolated perfused kidneys were used by Descombes et al. (1995) to characterize a selective inhibitor of big ET-1 responses. The studies were performed on kidneys taken from adult male Wistar rats (300–400 g). The rats were anesthetized with sodium pentobarbital (50 mg/kg i.p.) and the left kidney was prepared for infusion with Tyrode solution. The changes in renal vascular resistance were recorded as changes in perfusion pressure monitored at constant flow (6 ml/min). After stabilization, a bolus injection of ET-1 or big ET-1 was administered and the resulting pressure responses were recorded. On return to baseline levels, a second injection of the endothelins was given either under control conditions or in presence of the putative enzyme inhibitor. Because increasing evidence implicates that endothelin plays a role in the pathophysiology of cerebral insults, Kwan et al. (1997) studied the prevention and reversal of cerebral vasospasm in an experimental model of subarachnoid hemorrhage. Three ml of arterial blood was withdrawn from the ear artery of rabbits and injected into the cisterna magna under anesthesia. Drugs were administered either before or 24 h after this procedure. Forty-eight hours later, the animals were anesthetized again and perfusion fixation was performed with Hank’s balanced salt solution followed by a mixture with 2 % paraformaldehyde and 2.5 % glutaraldehyde. Cross sections of the basilar arteries were analyzed by computer-assisted morphometry. A review on the knowledge of molecular pharmacology of endothelin converting enzymes was given by Turner and Murphy (1996). Johnson and Ahn (2000) developed an internally quenched fluorescent substrate selective for endothelin-converting enzyme-1. Luciani et al. (2001) described highly sensitive and selective fluorescence assays for rapid screening of endothelin-converting enzyme inhibitors. A.1.1.18 Nitric Oxide A.1.1.18.1 General Considerations on Nitric Oxide PURPOSE AND RATIONALE The endothelium releases a labile, diffusable vasorelaxing substance that has been termed endothelium-derived relaxing factor = EDRF endothelium-derived relaxing factor. (Furchgott and Zawadszki 1980). Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor (Palmer et al. 1987; Vanhoutte 1999). Nitric oxide plays a role in a wide range of physiological processes including regulation of blood flow and arterial pressure via endothelium-dependent relaxation of blood vessels (Rees et al. 1989; Moncada et al. 1991; Umans and Levi 1995; Huraux et al. 1999; McIntyre et al. 1999; Zanzinger 1999; Hropot et al. 2003), ischemia/reperfusion injury (Gao et al. 2002; Schulz et al. 2004), peripheral nitregric transmission at smooth muscle (Rand and Li 1995), intracellular communication in the CNS with activation of guanylyl cyclase in target neurons (Southam and Garthwaite 993), experimental stroke (Willmot et al. 2005), learning and memory (Susswein et al. 2004), in neurogenic inflammation (Kajekar et al. 1995), in the regulation of leukocyte recruitment (Hickey 2001), and macrophage defense mechanisms following exposure to bacterial products (Förstermann et al. 1992; Förstermann and Kleinert 1995; Knowles and Moncada 1994). Fiorucci et al. (2002) discussed the effects of nitric oxide-releasing NSAIDs. NO-donor drugs, such as sodium nitrite, sodium nitroprusside, S-nitroso-N-acetyl-D,L-penicillamine (SNAP), 3-morpholino-sydnonimine (SIN-1) are used as vasodilators (Schör et al. 1989; Megson 2000). N G-Nitro-L-argininewas described as an antagonist of endothelium-dependent dilator responses by inhibiting endothelium-derived relaxing factor release (Moore et al. 1990; Lamontagne et al. 1991). Ribero et al. (1992) proposed inhibition of nitric oxide synthesis by long-term treatment of rats with nitro-L-arginine as a new model of arterial hypertension. Excessive production of NO damages DNA and activates poly(ADP-ribose)polymerase (PARP) (Pieper et al. 1999). In cases of massive NO production, neurons enter the PARP-suicide pathway. NO damages DNA via to major pathways: the first involves nitrosation of primary or secondary amines and nucleic acid bases, whereas the second involves the combination of NO with superoxide to from peroxinitrite (Szabó et al. 1996, 1997). The most likely reactive oxidant intermediate responsible for DNA breakage is peroxynitrous acid which rapidly oxidizes sulphydryl groups, and also nitrates and hydroxylates aromatic compounds including tyrosine, tryptophan, and guanosine (Halliwell 1997). Downstream DNA damage that follows excessive NO production results in significant activation of poly(ADP-ribose)polymerase which leads to rapid energy depletion and cell death (Feihl et al. 2001). Davis et al. (2001) reviewed the non-3′,5′-cyclicguanosine-monophosphate-mediated effects of NO including modifications of proteins, lipids, and nucleic acids. Andreadis et al. (2003) described oxidative and nitrosative events in asthma. A.1.1.18.2 Bioassay of EDRF Release PURPOSE AND RATIONALE EDRF release from arterial endothelium can be studied by a sandwich technique using donor tissue with intact endothelium facing with its intimal side the intimal side of a detector tissue. PROCEDURE Rabbits are subjected to various kinds of treatment, e. g., atherogenic diet or drug treatment for prevention of arteriosclerosis. Aorta segments, about 2 cm in length, are prepared, cut open along their longitudinal axis and pinned to a tissue suspender without damaging the endothelium. These segments serve as donor tissue for EDRF. Circumferential aorta strips from the abdominal aorta of untreated control rabbits are de-endothelialized by gently blotting their luminal surfaces on wet filter paper. These denuded abdominal aorta strips are pinned opposite the donor segments (intimal surface facing intimal surface) and function as detector for luminally released EDRF. Each sandwich preparation is suspended in a 40-ml organ bath, filled with oxygenated Krebs-Ringer buffer at 37 °C containing 10 mM indomethacin. After connecting the detector strip to a force transducer, the angle between the detector strip and the donor segment is minimized and the distance between donor and detector tissue standardized. After one hour stabilization, the strips are brought to their optimum length-tension relationship by repeated exposure to 80 mM KCl. When a stable contractile response is established, the strips are precontracted with phenylephrine to 80–100 % of their KCl-induced contraction. After stabilization of plateau phase, cumulative doses of acetylcholine (0.01–10 mM) are added to induce EDRF release from donor tissues. EVALUATION Relaxations of the detector strip induced by EDRF release from treated donor rabbit aortas are compared with aortas from control rabbits. MODIFICATIONS OF THE METHOD An other bioassay for measuring function of cultured endothelial cells using a computer system for the acquisition and analysis of vascular contractility has been published by Winn et al. (1992). A.1.1.18.3 Isolated Arteries with and Without Endothelium PURPOSE AND RATIONALE Endothelial cells are able to synthesize and release potent vasoconstrictive agents, such as endothelin and angiotensin as well as vasodilating agents, such as EDRF. In isolated arterial segments the endothelial surface can be functionally destroyed allowing a differentiation between a direct action of drugs on the smooth muscle cells and an indirect effect via the endothelium. Isolated rings of rabbit or rat aorta are useful models to study the effects of endothelium derived factors such as EDRF or endothelins and their antagonists (Linz et al. 1986; Tracey et al. 1990; Fujimoto et al. 1992; Fukuroda et al. 1992; Wiemer et al. 1992). A survey of the history and on techniques leading to the discovery of endothelium-dependent relaxation was given by Furchgott (1993). PROCEDURE The descending thoracic aorta from rabbits of either sex (weighing 2.5–3.5 kg) is excised and dissected free from connective tissue. Care is taken to avoid damage of the endothelium. The aorta is divided into 2 mm wide rings and cut off in small strips. From some strips, the endothelium is removed by gently rubbing the intimal surfaces between the fingers for approximately 30 s. The strips are suspended in a 25 ml organ bath containing Krebs-bicarbonate solution at 37 °C being gassed continuously with 5%CO2/95%O2. Contractions of the strips are recorded isometrically with a load of 2 g on the tissues. After an equilibration period of 2 h a stable baseline tone is reached. To study the vasodilating effects of a compound, the strips are contracted with norepinephrine (10–8 M), or angiotensin II (10–7 M), or potassium chloride (20 mM). When a stable contraction plateau has been reached, the vasodilating agent is added in various concentrations. In these concentrations, norepinephrine, angiotensin II and KCl evoke a response of 60–80 % of maximal contraction in intact rings of rabbit aorta. Rings without endothelium exhibit a response which is significantly enhanced in comparison with the response of the intact preparation after norepinephrine and angiotensin II precontraction. To indicate the functional removal of the endothelium, the responsiveness of each preparation is tested with the known endothelium-dependent dilator, acetylcholine. In endothelium-intact rings, acetylcholine relaxes contractions induced by norepinephrine or angiotensin II. In precontracted rings devoid of endothelium, acetylcholine does not show any relaxing effect or causes contractions by itself at higher concentrations (Furchgott and Zawadzki 1980). As an example, atriopeptin III causes a similar concentration-dependent relaxation of all precontracted preparations with intact and with functionally destroyed endothelium indicating a direct effect on the smooth muscle cells. The relaxation is accompanied by an increase of cGMP. EVALUATION Statistical analyses are performed by regression analysis of dose response curves to determine EC 50 values. Data are given as means ± standard deviation. CRITICAL ASSESSMENT OF THE METHOD The isolated aortic ring of rabbits with and without functionally intact endothelium is a useful tool to differentiate direct effects on the arterial smooth musculature from effects mediated by the endothelium. MODIFICATIONS OF THE METHOD Fujimoto et al. (1992) used the thoracic aorta from rats to study the effects between endothelin and an endothelin receptor antagonist. In transverse strips from ratthoracic aorta, 2mmwide and 4–5mmlong, the endothelium was removed by gently rubbing the interior surface of the aorta. Concentration-response curves of contractions after ET-1 in the presence and the absence of the inhibitor were compared. Pellisier et al. (1992) perfused the isolated mesenteric vascular bed of the rat with Tyrode solution and measured the perfusion pressure after injection of graded doses of norepinephrine and the dose-dependent relaxation due to acetylcholine in the vascular bed precontracted by norepinephrine infusion. In order to destroy the endothelial layer, the perfusate was changed to a hypotonic Tyrode solution containing all of the constituents present in normal Tyrode solution but in one-tenth of the concentration resulting in disruption of more than 95 % of the endothelial cells. The effect of norepinephrinewas enhanced,whereas the effect of acetylcholine was abolished. Legan and Sisson (1990) described a method to denude rat aortic endothelium in vitro with saponin. Bohn and Schönafinger (1989) used helical strips of pulmonary arteries of guinea pigs in which the endothelium has been removed for biological detection of NO. Fukuroda et al. (1992) used spiral strips from porcine coronary artery and vein and from intrapulmonary artery and vein removing the intimal surface by lightly rubbing with wet filter paper. Concentration-contraction curves for ET-1 and ET-3 were obtained with and without an endothelin antagonist. Hayashi et al. (1988) described functional and anatomical recovery of endothelium after balloon denudation of the left circumflex coronary artery in dogs. Endothelial denudation of the left circumflex coronary artery was used by Chu and Cobb (1987) to study the vasoactive effects of serotonin on proximal coronary arteries in awake dogs. Experiments in isolated rings of the left circumflex or left anterior descending coronary artery of dogs with and without endothelium were performed by Desta et al. (1995). Terrón (1996) analyzed the effects of 5-HT1-receptor antagonists on 5-HT and sumatriptan induced isometric contractions in endothelium denuded segments of canine coronary arteries. Ren et al. (1993) isolated coronary arteries from Japanese monkeys (Macaca fuscata) with and without endothelium to study muscarinic receptor subtypes mediating vasodilatation and vasoconstriction. A.1.1.18.4 Nitric Oxide Formation by Cultured Endothelial Cells PURPOSE AND RATIONALE Endothelial cells are able to synthesize and to release not only potent vasoconstrictor peptides such as angiotensin and endothelin but also potent dilators such as nitric oxide (NO), ATP, substance P, and bradykinin. NO-formation can be assessed by determination of intracellular cyclic GMP in cultured endothelial cells, whereas release of NO from these cells can be measured by the stimulatory effect of NO on the activity of soluble guanylyl cyclase (Lückhoff et al. 1988; Wiemer et al. 1991; Linz et al. 1992; Bogle et al. 1992; review by Moncada et al. 1991). PROCEDURE Endothelial cell culture Bovine or porcine aorta is obtained from local slaughter houses. Endothelial cells are isolated by digestion with dispase (Lückhoff et al. 1988). The cells are seeded on 6- or 24-well plates (e. g., Nunc Intermed, Wiesbaden, Germany) and grown to confluence. Dulbecco’s modified Eagle’s/Ham’s F-12 medium containing 20 % fetal calf serum is supplemented with penicillin (10U/ml), streptomycin (10 μg/ml), L-glutamate (1 mM/l), glutathione (5 mg/ml), and L(+)ascorbic acid (5 mg/ml); (Biotect protection medium). Measurement of cyclic GMP Primary cultures of endothelial cells are used. After removal of the culture medium by aspiration, the monolayer is washed twice with 2 ml HEPES-Tyrode’s solution (37 °C). Thereafter, the cells are preincubated for 15 min at 37 °C with 3-isobutyl-1-methylxanthine (IBMX), (10–4 M/l). After this time, drugs or solvents are added. After predetermined periods, the incubation medium is quickly removed. The cells are then immediately extracted with 0.6 ml 6 % trichloroacetic acid and scraped off with a rubber scraper. The cell suspension is sonicated for 10 s before being centrifuged for 5 min at 4000 g. The supernatants are extracted with four volumes of water saturated diethylether, and the samples frozen (–20 °C) until analysis. The protein contents of the samples are measured according to Lowry et al. (1951). Cyclic GMP can be determined in the acetylated samples by various methods (Heath et al. 1992), e. g., using a commercially available radioimmunoassay (New England Nuclear). Cyclic GMP content is expressed as picomoles GMP per milligram protein. Measurement of NO release Release of NO from endothelial cells is assayed on the basis of the stimulatory effect of NO on the activity of soluble guanylyl cyclase (purified from bovine lung) (Gerzer et al. 1981). The activity of the enzyme is determined in terms of the formation of cyclic [32P]GMP from α-[32P]GTP. Reactions are carried out in a reaction mixture containing 30 mM triethanolamine-HCl (pH 7.4), 1 mM reduced glutathione, 4 mM MgCl2, 1 mM cGMP and 0.1 mg/ml bovine γ -globulin (total volume of 0.18 ml) at 37 °C in the presence of α-[32P]GTP (0.03 mM; 0.2 μCi) and soluble guanylyl cyclase (4 μg). Ten-μl samples are quickly transferred to the reaction mixture. Enzymatic formation of cGMP is allowed to proceed for 60 s and then stopped by the addition of 450 μl zinc acetate (120 mM) and 500 μl sodium carbonate (120 mM). A complete inhibition of cGMP formation can be achieved by preincubation of the monolayers for 30 min with the stereospecific inhibitor of NO synthase, N G-nitro-L-arginine. EVALUATION Time-response curves and dose-response curves after addition of various activators or inhibitors of NO synthase are established. Data are reported as mean values ± SEM of cGMP (pmol/mg protein) or guanylyl cyclase activity (nmol/mg/min). Statistical evaluation is performed with Student’s t-test. MODIFICATIONS OF THE METHOD The clinical pharmacology of L-arginine has been reviewed by Böger and Bode-Böger (2001). Isolation of porcine cerebral capillary endothelial cells has been described by Wiemer et al. (1994). Feelisch and Noack (1987) and Nakazawa et al. (1992) used chemiluminescence techniques for determination of NO. A method for on-line detection of nitric oxide formation in liquid aqueous phase by electron paramagnetic resonance spectroscopy was described by Mordvintcev et al. (1991). Similar methods were used by Ichimori et al. (1992), Lancester et al. (1992), Steel-Goodwin et al. (1992). Hecker et al. (1995) used a cascade superfusion bioassay to characterize a stable L-arginine-derived relaxing factor released from cytokine-stimulated vascular smooth muscle cells. Electrochemical microprobes for direct measurement of NO in tissues have been developed (Shibuki 1990; Ishida et al. 1996; Smits and Lefebvre 1997). Malinski and Taha (1992), Linz et al. (1999) measured nitric oxide release by a porphyrinic-based microsensor with a detection limit of 10 nmol/L. The amperometric signal at a constant potential of 0.67 V was measured with a voltametric analyzer (PAR model 273, Princeton Applied Research) interfaced with an IBM80486 computer with data acquisition and software. Gabriel et al. (1997) developed a method for the detection of intracellular nitric oxide generation in dissociated cerebellar granule cells using dichlorofluorescin diacetate and flow cytometry. Sumpio et al. (1987) found that cyclic mechanical stress stimulates cultured bovine aortic endothelial cells to proliferate. Using this method, Rosales et al. (1997) found that exposure of endothelial cells to cyclic strain induces elevations of cytosolic Ca2+ concentration through mobilization of intracellular and extracellular pools. A.1.1.18.5 Expression of Nitric Oxide Synthase PURPOSE AND RATIONALE Properties of various forms of nitric oxide synthase (NOS) have been described by Mayer et al. (1992), Leone et al. (1992), Hevel et al. (1992), Förstermann et al. (1992, 1995), (Salter et al. 1992), Pollock et al. (1992), Schmidt et al. (1992), and Mungrue et al. (2003), among them type I, which is constitutively expressed in neurons; the inducible type II which is found in macrophages and hepatocytes, but also in the brain (Moro et al. 1998), where it may contribute to NO-mediated neurotoxicity; and type III, which is constitutively expressed in endothelial cells (Knowles and Moncada 1994). NOS can be inhibited by several routes, e. g., competition with L-arginine, NADPH, flavin or tetrahydrobiopterin, interaction of the haeme group of NOS, interference with Ca2+ availability or calmodulin binding to the enzyme (Fukuto and Chaudhuri 1995). A widely used inhibitor is L-NAME (Vargas et al. 1991). Selective inhibition of constitutive NOS can by achieved by 7-nitroindazole (Moore et al. 1993); of the inducible NOS by aminoguanidine hydrochloride (Griffiths et al. 1993) and by 2-amino-5,6-dihydro-6-methyl-4H-1,3-thiazine ( =AMT) (Nakane et al. 1995). Linz et al. (1999) determined NOS in the left cardiac ventricle of hypertensive rats. PROCEDURE Tissues are ground at the temperature of liquid nitrogen using a microdismembranator (Braun). The powders are extracted for 1 h on ice with 10 mmol/l Tris-HCl, pH7.4, containing 1 % SDS and protease inhibitors (complete, Boehringer Mannheim). Debris is removed by a 30-min centrifugation at 4 °C (>100,000 g). 100 μg of total of the protein extracts are subjected to SDS-PAGE electrophoresis and transferred to nitrocellulose membranes (Hybond, Amersham). The eNOS protein is detected by use of a specific antibody (monoclonal anti-NOS III), Transduction Laboratories) and visualized by enhanced chemifluorescence with a commercially available kit (Amersham). As a secondary antibody, an anti-mouse IgG antibody coupled to alkaline phosphatase is used (Jackson ImmunoResearch Laboratories). Chemifluorescence is analyzed and quantified by scanning with a Fluorimager 595-system (Molecular Dynamics). EVALUATION The data are given as mean ± SEM. ANOVA is used followed by Tuckey’s test for post-ANOVA multiple pair comparisons. MODIFICATIONS OF THE METHOD Linz et al. (1997) measured expression of ec-NOS in the carotid artery of hypertensive rats by Western blot analysis. Frozen (–70 °C) vessels were thawed and extracted with guanidium isothiocyanate/phenol/chloroform (Chomczynski and Sacchi 1987). Crude protein fractions were obtained by alcohol precipitation of the phenol phase. A total of 100 μg of the protein extracts was subjected to SDSPAGE and transferred to nitrocellulose membranes (Bio-Rad). Ponceau staining was performed to verify the quality of the transfer and the equipartition of protein in each lane. EcNOS protein was detected with a specific antibody (mouse NOS III, Transduction Laboratories) and visualized by enhanced chemifluorescence with a commercially available kit (Amersham). The autoradiographs were analyzed by scanning densitometry. McCall et al. (1991) identified N-iminoethyl-Lornithine as an irreversible inhibitor of nitric oxide synthase. Bauersachs et al. (1998, 1999) measured vascular reactivity in isolated rat aortic rings mounted in an organ bath (Föhr Medical Instruments, Seeheim Germany) for isometric force measurement and determined superoxide anion production by lucigenin-enhanced chemiluminescence and endothelial nitric oxide synthase and soluble guanylyl cyclase expression by reverse transcription-polymerase chain reaction. Von der Leyen et al. (1995) reported gene therapy inhibiting neointimal vascular lesions in rats. After denudation of the endothelium of carotid arteries by balloon injury, endothelial cell nitric oxidase expression in the vessel wall was restored by using the Sendai virus/liposome in vivo gene transfer technique. Lund et al. (2000) found that gene transfer of endothelial nitric oxide synthase improves relaxation of carotid arteries from diabetic rabbits. Mungrue et al. (2002) discussed lessons from murine genetic models on the role of NOS in heart failure. A.1.1.19 Inhibition of Rho Kinase ... PURPOSE AND RATIONALE Rho is a member of the Ras-related family of small molecular weight GTP-binding proteins, and Rho works as a molecular switch by shuttling between the GDP-bound inactive form and the GTP-bound active form. Rho is involved in cell motility, cell adhesion, cytokinesis, Ras-induced transformation, transcriptional activation, and cell cycle progression. These actions, through Rho signaling, are mediated by downstream Rho effectors, such as the ROCK family of Rho-associated serine/threonine protein kinases. Studies with ROCK-specific inhibitors indicate that the ROCK pathway works in the contraction of vascular smooth muscle. Several studies indicate that Rhokinase may be a novel therapeutic target in the treatment of cardiovascular disease (Kobayashi et al. 2002; Shimokawa 2002; Ito et al. 2003, 2004; Nakakuki et al. 2005; Budzyn et al. 2006;Winaver et al. 2006). Ishizaki et al. (2000) described the pharmacological properties of a specific inhibitor of Rho-associated kinases. PROCEDURE Kinase assay Recombinant ROCK-I, ROCK-II, PKN, or citron kinase was expressed in HeLa cells as a Myc-tagged protein by transfection using lipofectamine, and was precipitated from the cell lysates by the use of 9E10 monoclonal anti-Myc antibody coupled to G protein-Sepharose (Ishizaki et al. 1997). Recovered immunocomplexes were incubated with various concentrations of [32P]ATP and 10 μg of histone type 2 as substrates, in the absence or presence of various concentrations of test compounds at 30 °C for 30 min in a total volume of 30 μl of the kinase buffer containing 50 mM HEPES-NaOH, pH 7.4, 10 mM MgCl2, 5 mM MnCl2, 0.02 % Briji 35, and 2 mM dithiothreitol. PKCα was incubated with 5 μM [32P]ATP and 200 μg/ml histone type 2 as substrates in the absence or presence of various concentrations of test compounds at 30 °C for 10 min in a kinase buffer containing 50 mM Tris-HCl, pH 7.5, 0.5 mM CaCl2, 5 mM magnesium acetate, 25 μg/ml phosphatidyl serine, 50 ng/ml 12-O-tetradecanoylphorbol-13-acetate and 0.001 % leupeptin in a total volume of 30 μl. Incubation was terminated by the addition of 10 μl of 4 × Laemmli sample buffer. After boiling for 5 min, the mixture was subjected to SDS-polyacrylamide gel electrophoresis on a 16 % gel. The gel was stained with Coomassie Brilliant Blue, and then dried. The bands corresponding to histone type 2were excised, and the radioactivity was measured. EVALUATION K i values were either determined by the double reciprocal plot or calculated from the equation K i = IC50/(1 + S/K m), where S and K m are the concentration of ATP and the K m value for ATP, respectively. A.1.1.20 Inhibition of Na+/H+ Exchange ... PURPOSE AND RATIONALE Na+/H+ exchange was first described by Murer et al. (1976) in a study of intestinal and renal brush border vesicles. The plasmamembraneNa+/H+ exchanger is an ubiquitous pH regulating cellular ion transport system. It is driven by the Na+ gradient and extrudes protons from the cytosol in exchange for extracellular Na+ ions (Aronson 1985; Frelin et al. 1988; Fliegel and Dyck 1995; Orlowski and Grinstein 1997; Wakabayashi et al. 1997; Dibrov and Fliegel 1998). Six mammalian Na+/H+ exchangers: NHE1, NHE2, NHE3; NHE4, NHE5 (Attaphitaya et al. 1999; Szabo et al. 2000), and NHE6 have been described (Tse et al. 1994; Orlowski 1999; Counillon and Pouysségur 2000). In cardiac tissue the exchanger has a major role in the control of intracellular pH. At the onset of cardiac ischemia and during reperfusion, Na+/H+ exchange is excessively activated by low intracellular pH. Since the deleterious Na+ influx in this condition was found to originate mainly from Na+/H+ exchange (Frelin et al. 1984; Schömig et al. 1988), the exchanger seems to be responsible for an increase of cytosolic sodium in ischemic cells. The accumulation of intracellular Na+ causes an activation of Na+/K+ ATPase (Frelin et al. 1984; Rasmussen et al. 1989) which in turn increases ATP consumption. During ischemia the aerobic metabolism of glucose terminates in lactic acid. A vicious circle leads to a further decrease of intracellular pH and to a further activation of Na+/H+ exchange, resulting in energy depletion, cellular Na+ overload and finally due to the coupling of Na+ and Ca2+ transport via Na+/Ca2+ exchange, cellular Ca2+ overload (Lazdunski et al. 1985; Tani and Neely 1990; Scholz and Albus 1993). Especially in ischemic cardiac tissue, where Na+/H+ exchange is the predominant pH regulating ion transport system (Weissenberg et al. 1989), these pathological events can lead to increased excitability and precipitation of cellular death. Therefore, it is desirable to find potent and well tolerated inhibitors of Na+/H+ exchange which should be able to interrupt this vicious cycle, to conserve cellular energy stores and to diminish cellular excitability and necrosis during cardiac ischemia. Such effects have been found with relatively weak inhibitors of Na+/H+ exchange at high toxic doses, such as amiloride and ethyl isopropyl amiloride (Scholz et al. 1992). The myocardial Na+/H+ exchanger is regarded as a therapeutic target for the prevention of myocardial ischemic and reperfusion injury and attenuation of postinfarction heart failure (Karmazyn et al. 2001). More potent Na+/H+ exchange inhibitors showed beneficial effects on ischemia/reperfusion injury (see A.5.0.7 and A.5.0.8) in rats (Aye et al. 1997; Myers et al. 1998; Aihara et al. 2000), dogs (Gumina et al. 1998, 2000) and pigs (Portman et al. 2001). Heart hypertrophy and heart failure after myocardial infarction is reduced (Yoshida and Karmazyn 2000; Kusumoto et al. 2001). Ischemia-induced apoptosis in isolated rat hearts is attenuated by sodium-hydrogen exchange inhibitors (Chakrabarti et al. 1997). Linz and Busch (2003) demonstrated the effects of NHE-1 inhibition from protection during acute ischemia/ reperfusion to prevention of myocardial remodeling. A.1.1.20.1 Inhibition of Na+/H+ Exchange in Thrombocytes PURPOSE AND RATIONALE The inhibition of Na+/H+ exchange has been studied in platelets by measuring the optical density after osmotic cell swelling (Rosskopf et al. 1991). PROCEDURE About 5 ml blood is withdrawn by venipuncture from human donors or from the vena jugularis externa of Beagle dogs or from the aorta of anesthetized Wistar rats (weighing 250–350 g). Coagulation is inhibited by 0.8 ml citrate acid dextrose (65 mM citric acid, 11 mM glucose, 85 mM trisodium citrate). Plateletrich plasma (PRP) is obtained by centrifugation of whole blood at 90 g for 10 min at room temperature. Platelet count is measured, e. g., with a Casey 1 multichannelyser (Schärfe System, Reutlingen, Germany). Each of the experiments is performed with 10–50 μl PRP containing 20 × 106 platelets in a volume of 100 μl with saline. To activate Na+/H+ exchange in the platelets by intracellular acidification, 500 μl propionate buffer (135 mM Na-propionate, 1 mM HCl, 1 mM CaCl2, 1 mM MgCl2 , 10 mM glucose, 20 mM HEPES, pH 6.7, 22 °C) are added to the PRP/NaCl solution. Swelling of the platelets results in a decrease of optical density which can be measured with an aggregometer, e. g. with a Turbitimer (Behringwerke, Marburg, Germany). The system is activated photometrically by the addition of the propionate buffer to the cuvette. The experiments are performed with and without the addition of the Na+/H+ exchange inhibitor to be tested. The inhibitors are added in concentrations between 10–4 and 10–8 mol/l. 5-(N-ethyl-Nisopropyl) amiloride (EIPA) is used as standard. During the experiments all solutions are kept at 22 °C in a temperature controlled water bath. EVALUATION Results are given as means ± SD. Student’s t-test is employed for statistical evaluation. IC 50 values are calculated from dose-response curves. A.1.1.20.2 Inhibition of Na+/H+ Exchange in Cholesterol Activated Rabbit Erythrocytes PURPOSE AND RATIONALE The inhibition of Na+/H+ exchange has been studied in cholesterol activated rabbit erythrocytes by flame photometry of sodium (Scholz et al. 1992, 1993). PROCEDURE White rabbits (New Zealand strain, Ivanovas) are fed with a rabbit standard chow with 2 % cholesterol for 6 weeks to increase the Na+/H+ exchange (Scholz et al. 1990) and to make the erythrocytes suitable for measurement of sodium influx via Na+/H+ exchange by flame photometry. Blood is drawn from the ear artery of the rabbits and coagulation prevented with 25 IU/ml potassium heparin. The hematocrit of the samples is determined in duplicate by centrifugation. Aliquots of 100 μl are taken to measure the initial sodium content of the erythrocytes. To determine the amiloride sensitive sodium influx into erythrocytes, 100 μl of each blood sample are added to 5 ml of buffer made hyperosmolar by sucrose (140 mM NaCl, 3 mM KCl, 150 mM sucrose, 0.1 mM ouabain, 20 mM tris-hydroxymethylaminomethane, pH7.4) and incubated for 60 min at 37 °C. Subsequently, the erythrocytes are washed three times in ice-cold MgCl2-ouabain-solution (112 mM MgCl2, 0.1 mM ouabain). For determination of intracellular sodium content, the cells are hemolyzed in distilled water, the cell membranes are centrifuged and the sodium concentration of the haemolysate is measured by flame photometry. Net influx of sodium into the erythrocytes is calculated from the difference between the initial sodium content and the sodium content after incubation. Amiloride-sensitive sodium influx is calculated from the difference between sodium content of erythrocytes incubated with and without amiloride (3 × 10–4 M). Each experiment is done with the erythrocytes from 6 different animals. In each case, the comparison of Na+ contents is based on erythrocytes from the same animal. Doses between 10–4 and 10–7 M of the inhibitor are tested. EVALUATION Statistical analysis of the data obtained is performed with Student’s t-test for paired groups. IC 50 values are calculated from dose-response curves. A.1.1.20.3 Sodium Influx into Cultured Cardiac Myocytes PURPOSE AND RATIONALE The inhibition of Na+/H+ exchange has been studied in cultured cardiac myocytes (Scholz et al. 1992). PROCEDURE Rat myocardial cells are isolated from hearts of neonatal rats by trypsin digestion. The cells are cultured in 35 mm dishes and grown to confluence in Dulbecco’s Minimum Essential Medium (DMEM, GIBCO) in an atmosphere containing 10%CO2. After confluence, the cells are used for measurement of 22Na+ influx. The cells are washed twice with Krebs-Ringer-solution buffered with HEPES/Tris (KRB) in which sodium chloride has been replaced by choline chloride (Choline chloride 130 mM, CaCl2 1.5 mM, KCl 5 mM, MgCl2 1 mM, HEPES 20 mM, pH7.0 with Tris) and then incubated for 20 min at 37 °C in the same buffer with added 0.1 % bovine serum albumin (BSA) and 10 mM/l glucose. The culture dishes are then incubated for another 10 min with Na+-propionate for cytosolic acidification and stimulation of Na+/H+ exchange. The compounds are dissolved in 500 μl/dish KRB in which 50 % of the sodium chloride has been replaced by choline chloride containing additionally 2 μCi/ml 22Na+-bicarbonate, and 5-(N-ethyl-N-isopropyl)amiloride (EIPA). After the stimulation period, sodium influx is terminated by washing the cells twice with ice-cold stop solution (0.1 mM MgCl2, 10 mM Tris, pH 7.0). Subsequently, the cells are lyzed with 250 μl trichloroacetic acid and scraped from the dishes. Radioactivity is determined in a Packard gamma counter. Doses between 3 × 10–4 and 10-8 mM/l of standard and new compounds are tested. Six dishes are used for each concentration of test compounds. EVALUATION Mean values ± SD are compared with Student’s t-test. IC 50 values are calculated from dose–response curves. A.1.1.20.4 Inhibition of Na+/H+ Exchange into Cultured Aortic Endothelial Cells PURPOSE AND RATIONALE The inhibition of Na+/H+ exchange has been studied in endothelial cells (Scholz et al. 1993) by measuring the 22Na+ influx. PROCEDURE Bovine aortic endothelial cells (BAEC) are isolated by dispase digestion form bovine aorta obtained from animals killed at the local slaughter house. The cells are cultured in 35 mm dishes and grown to confluence in Dulbecco’s Minimum Essential Medium (DMEM, GIBCO) in an atmosphere with 10%CO2. Three days after confluence the cells are used for measurement of 22Na+ influx. The cells are washed twice with Krebs-Ringer solution buffered with HEPES/Tris (KRB) in which sodium chloride has been replaced by choline chloride (Choline chloride 130 mM, CaCl2 1.5 mM, KCl 5 mM,MgCl2 1 mM,HEPES 20 mM, pH7.0with Tris) and then incubated for 20 min at 37 °C in the same buffer with added 0.1 % bovine serum albumin (BSA) and 10 mM glucose. To stimulate Na+/H+ exchange the culture dishes are incubated for another 10 min with 500 μl/dish KBR in which all sodium chloride has been replaced by 65 mM each of choline chloride and Na+-propionate or with KBR in which 50 % of the sodium chloride has been replaced by choline chloride for unstimulated controls. In addition, the buffer contains 2 μCi/ml 22Na+ and the test compounds or the standard. After the stimulation period, the sodium influx is terminated by washing the cells twice with ice-cold stop solution (0.1 mM MgCl2, 10 mM Tris, pH7.0). Subsequently, the cells are lyzed with 250 μl trichloroacetic acid and scraped from the dishes. Radioactivity is determined in a Packard gamma counter. Doses between 10–5 and 10–7 mM/l of standard and new compounds are tested. Six dishes are used for each concentration of test compounds. EVALUATION Mean values ± SD are compared with Student’s t-test. IC 50 values are calculated from dose-response curves. MODIFICATIONS OF THE METHOD Ewart et al. (1997) studied lipoprotein lipase activity in cultured rat cardiomyocytes in the presence of insulin and dexamethasone. A.1.1.20.5 NHE Activity Measured by Intracellular pH in Isolated Ventricular Myocytes PURPOSE AND RATIONALE Changes of the intracellular pH of cultured bovine endothelial cells have been fluorometrically monitored using the pH-dye 2′,7′-bis(carboxyethyl)carboxyfluorescein (BCECF) by Kitazano et al. (1988). This method has been used to study the activity of inhibitors of Na+/H+ exchange (Scholz et al. 1995). PROCEDURE For preparation of isolated rat ventricular muscular cells (Yazawa et al. 1990), hearts of male Wistar rats are dissected, mounted on a Langendorff apparatus and perfused first at 37 °C for 3 min with Tyrode solution adjusted to pH7.4, second for 5–7 min with nominally calcium free Tyrode solution and finally with calcium free Tyrode solution containing 0.12–0.2 mg/ml collagenase (Sigma type I). After 15–20 min collagenase treatment, the heart is washed with storage solution (composition in mmol/L: KOH70, l-glutamic acid 50, KCl 40, taurine 20, KH2PO4 20, MgCl2 3, glucose 20, HEPES 10, and EGTA0.5, pH7.4). The ventricles are cut into small pieces and myocytes are dispersed by gently shaking and finally by filtration through a nylon mesh (365 μm). Thereafter, the cells are washed twice by centrifugation at 600–1000 rpm for 5 min and kept at 4 °C until use. For the pH recovery experiment the cells are loaded with the membrane permeable acetoxymethyl ester (AM) form of the fluorescent indicator 2′,7′-bis(carboxyethyl)-5(6)-carboxyfluorescein (BCECF). BCECF-AM is dissolved in DMSO and diluted to a 1.25 μM storage solution. Cardiomyocytes are loaded in this solution for 30 min at room temperature and are then centrifuged and resuspended in storage solution. The measurements are performed in bicarbonate-free NaCl solution (NaCl 140, KCl 4.7, CaCl2 1.3, MgCl2 1, glucose 10, and HEPES 10 mM/L, pH7.4) at 34 °C using an apparatus according to Nitschke et al. (1991). The pHdependent signal of BCECF is obtained by illuminating at 490 and 437 nm and dividing the emitted light signals (520–560 nm). The background signal, determined by closing the shutter, is subtracted from the total signal. The autofluorescence determined by illuminating unloaded cells can be ignored. In order to investigate the function of the Na+/H+ exchange system, the intracellular pH (pHi) of the cells is decreased by the NH4Cl prepulse technique and the rate of return to resting pHi is determined. Test compounds are dissolved in the incubationmedium. For each test concentration, the recovery of pHi is first recorded in control NaCl solution. EVALUATION Data are analyzed by fitting a straight line to the initial (5 min) data points of the pH recovery curve. For statistical presentation, the slopes of the linear curves are demonstrated. All reported data are presented as means ± SEM. Statistical comparisons are made using either a paired or unpaired t-test. MODIFICATIONS OF THE METHOD The pH-sensitive fluorescence dye C-SNARF-1 ( = carboxy-semi-naphtho-rhoda-fluor 1) was used by Yatsutake et al. (1996), Shipolini et al. (1997), and Yokoyama et al. (1998). Fischer et al. (1999) tested new drugs for the Na+/H+ exchanger in Chinese hamster ovary cells which are enriched with the NHE-1 isoform of the Na+/H+ anti-porter. The Na+/H+ exchanger was stimulated with NaCl and the rate of extracellular acidification was quantified with the Cytosensor. A.1.1.20.6 NHE Subtype Specificity PURPOSE AND RATIONALE Molecular identification of mammalian Na+/H+ exchanger subtypes has been pioneered by Pouysségour and coworkers (Sardet et al. 1989) who used genetic complementation of fibroblast cell lines that lack all endogenous NHEs. Schwark et al. (1998) studied an inhibitor of Na+/H+ exchanger subtype 3 in various cell types. PROCEDURE cDNAs for the NHE subtypes human NHE1, rabbit NHE2, rat NHE3 (Pouysségour) or cloned by reverse transcriptase-polymerase chain reaction from human kidney mRNA are used. These cDNAs are cloned into the mammalian expression vector pMAMneo and transferred into the NHE-deficient mouse fibroblast cell line LAP1. Cells expressing the NHE subtypes are selected by the acid load survival method (Sardet et al. 1989). Clonal cell lines for each subtype are used for intracellular pH (pHi) recovery after acid load. For studies of pHi recovery (Faber et al. 1996), cells are scraped off the culture dishes washed and incubated with 5 μmol/l BCECF-AM [2′,7′-bis(2-carboxyethyl)-5,6-carboxy-fluorescein-acetoxy-methyl ester] for 20 min at 37 °C in a buffer containing 20 mM NH4Cl. The cells are then washed to remove extracellular dye and resuspended in the loading buffer without BCECFAM. Intracellular acidification is induced by addition of 975 μl NH4Cl-free and HCO3 –-free solution (socalled recovery medium: HCO3 –-free to inhibit the Na+-dependent Cl–/HCO3 – exchanger of LAP1 cells) to an 25-μl aliquot of cells (≅25,000 cells). The pHi recovery is recorded with a dual-grating Deltascan single-photon counting fluorometer (Photon Technology International, South Brunswick, NJ, USA) with excitation wavelength of 505 nm and 440 nm and an emission wavelength of 535 nm. The measurement time varies between subtypes (120 s for NHE1, 300 s for NHE2, 180 s for NHE3). The inhibitors are first dissolved in DMSO, diluted in recovery medium and added in a volume of 975 μl to this medium. A cloned opossum kidney cell line (Helmle-Kolb et al. 1990) is used additionally. Cells are grown as a monolayer in growth medium (1:1 mixture of nutrient mixture Ham F12 and Dulbecco’s modified medium Eagle with 10 % fetal calf serum). For subcultivation and pH-recovery experiments, the cells are detached from the surface of the culture vessels with trypsin-EDTA solution (2.5 g trypsin + 0.2 g EDTA per liter in Dulbecco’s phosphate-buffered saline) and suspended in growth medium. Measurement time in pHi recovery experiments is 400 s. Porcine renal brush-border membrane vesicles (BBMV) prepared by a Mg2+ precipitation technique are loaded with 150 mmol/l NaCl, 5 mmol/l HEPES/Tris, pH7.0, and pre-incubated for 10 min at 37 °C with various concentrations of NHE inhibitors. Intravesicular acidification through Na+/H+ exchange is started by diluting BBMV into Na+-free buffer (150 mmol/l tetramethylammonium chloride, 5 mmol HEPES/Tris, pH7.0) containing the appropriate concentrations of the NHE inhibitors and the fluorescent ΔpH indicator acridine orange (12 μmol/l). The fluorescence changes of acridine orange are recorded continuously by a Hitachi F-2000 spectrofluorometer at 495 nm excitation and 525 nm emission wavelength. The initial acridine orange fluorescence quenching in controls (no inhibitor) is set to 100 %. EVALUATION Values are presented as means ± SD (four measurement per concentration). The IC 50 values and Hill coefficients are calculated using the Sigma plot software. Statistical significance is calculated by means of the distribution-independent H-test and non-parametric U-test. P < 0.05 is considered as significant. MODIFICATIONS OF THE METHOD Counillon et al. (1993), Scholz et al. (1995) determined the NHE subtype specificity of Na+/H+ antiporters by their ability to inhibit initial rates of amiloride sensitive 22Na+ uptake in fibroblast cell lines separately expressing the NHE-1, NHE-2 and NHE-3 isoforms. Ko et al. (2004) determined the inhibitory effects of flavonoids on phosphodiesterase isozymes from guinea pig and their structure–activity relationships. A.1.1.21 Phosphodiesterases Cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and/or cGMP. They function with adenyl and guanylyl cyclases to regulate the amplitude and duration of responses triggered by the second messengers cAMP and cGMP. The enzyme phosphodiesterase (PDE) exists in various forms. At least 11 families of phosphodiesterases have been identified (Torphy and Page 2000; Francis et al. 2001; Maurice et al. 2003; Lugnier 2006). The properties and functions of GAF domains in cyclic nucleotide phosphodiesterases are reviewed by Zoraghi et al. (2004). Hofmann et al. (2006) reviewed the nomenclature and structure–function relationships of cyclic nucleotide-regulated channels. Mongillo et al. (2004) reported fluorescence resonance energy transfer-based analysis of cAMP dynamics in live neonatal rat cardiac myocytes, revealing distinct functions of compartmentalized phosphodiesterases. Studying real-time monitoring of PDE2 activity in live cells, Nikolaev et al. (2005) found that hormone-stimulated cAMP hydrolysis is faster than hormone-stimulated cAMP synthesis. Snyder et al. (2005) studied the role of cyclic nucleotide phosphodiesterases in the regulation of adipocyte lipolysis. Zhang et al. (2004) desribed a glutamine switch mechanism for nucleotide selectivity by phosphodiesterases. A.1.1.21.1 Inhibition of Phosphodiesterase PURPOSE AND RATIONALE The inhibition of cAMP-PDE and cGMP-PDE by various test compounds can be measured using a two-step radioisotopic procedure. PROCEDURE Materials [8-3H]cAMP (28 Ci/mmol), [8-3H]-cGMP (15 Ci/mmol) and [U14C]guanosine (528 mCi/mmol) are obtained from Du Pont de Nemours (Paris, France). Unlabelled cyclic nucleotides, 5′-nucleotidase (Ophiophagus hannah venom) are from the Sigma Chemical Co.(La Verpillére, France). Tissue preparations Male Sprague-Dawley rats (250–300 g) are decapitated. Hearts are perfused with 0.15 M NaCl through the aorta to remove the blood. The ventricles are minced in 5 vol. of 10 mM Tris-HCl buffer containing 0.32 M sucrose, 1 mM EDTA, 5nM DTT and 0.1 mM PMSF at pH 7.5. The suspension is homogenized in a glass-glass Potter-Elvejhem. The homogenate is then centrifuged at 105,000 g for 60 min. The 105,000 g supernatant is stored at –75 °C until injection on the HPLC column. Isolation of PDEs The cytosolic fraction from rat ventricles (5–8 mg of protein) is loaded at the rate of 1 ml/min on a Mono Q HPLC column which has been previously equilibrated with buffer A (50 mM Tris-HCl, 2 mM EDTA, 14 mM 2-mercaptoethanol, 0.1 mM PMSF, pH7.5). Under these conditions, greater than 95 % of the PDE activity is bound to the column. PDE activity is eluted at a flow rate of 1 ml/min using the following step by step and linear gradients of NaCl in buffer A: 25 ml of 0.16 M NaCl, 20 ml of 0.23 M NaCl, 30 ml from 0.23 to 0.29 M NaCl, 15 ml of 0.29 M NaCl, 30 ml from 0.29 to 0.50 M NaCl. The separation is done at 4 °C. Fractions of 1 ml are collected and stored at –75 °C in the presence of 20 % glycerol. The fractions are tested for PDE activity, and the peaks containing the different isoenzymes are identified. Fractions containing preferentially one isoenzyme are pooled. PDE Assay PDE activity is assayed by a two-step radioisotopic procedure according to Thompson et al. (1974), Boudreau and Drummond (1975), Prigent et al. (1981). cAMP-PDE and cGMP-PDE activities are measured with a substrate concentration of 0.25 μM. To evaluate the cGMP-stimulated PDE activity, assays are performed with 5 μM cAMP in the absence or presence of 5 μM cGMP. Xanthine derivates are dissolved in DMSO. The stock solutions are appropriately diluted with 40 mM Tris-HCl buffer so that the final DMSO concentration in the PDE assay does not exceed 1 %. At this concentration, DMSO has no significant effect on the PDE activity of any of the fractions. The inhibitory potency of the xanthine derivates is examined on each separated isoform. EVALUATION The IC 50 values (concentration of a drug which inhibit 50 % of the enzymatic activity) are calculated by plotting the percentage of residual enzymatic activity versus the logarithmic concentration of the drug. Confidence limits (95 %) for the IC 50 values are determined by linear regression analysis. MODIFICATIONS OF THE METHOD Phosphodiesterase activity can be determined using 32P-labelled GPT (Reinsberg 1999). The reaction is performed using an Eppendorf cup with 10 mM GTP, the test solution and [32P]GTP. The reaction is started with 1 mM sodium nitroprusside solution. After an incubation period of 20 min at 37 °C, the reaction is stopped with 500 μl of 120 mM sodium carbonate and 400 μl of zinc acetate, whereby the zinc carbonate and the substrate GTP are almost (about 90 %) all precipitated, and so separated from cGMP. The precipitate is separated by centrifugation and the supernatant submitted to chromatography on an aluminum oxide column. The column is first treated with Tris HCl buffer. From the supernatant, 900 ml is applied. After two washing periods, the cGMP is eluted in five fractions. These fractions are measured and the highest activities are pooled. The PDE activity is calculated from the difference between applied [32P]GTP minus unaltered [32P]GTP. Description of Phosphodiesterase Isoforms Phosphodiesterase 1 PDE1 family variants are activated upon Ca2+/calmodulin binding (Kakkar et al. 1999; Goraya and Cooper 2005; Sharma et al. 2006). The PDE1 subfamily consists of three different gene products (PDFE1A, PDE1B, and PDE1C) which differ in their regulatory properties, substrate affinities, specific activities for calmodulin, tissue distribution, and molecular weights (Yan et al. 1996; Yu et al. 1997). PDE1 is present in brain, cardiomyocytes, vascular smooth muscle cells, and vascular endothelial cells (Maurice et al. 2003). Inhibition has been described for nimodipine (Epstein et al. 1982) and for vinpocetine (Hagiwara et al. 1984). Phosphodiesterase 2 A single PDE2 gene encodes three PDE2 variants (Rosman et al. 1997). Martinez et al. (2002) studied the crystal structure of murine PD2A and found that the two GAF domains in phosphodiesterase 2A have distinct roles in dimerization and cGMP binding. PDE2 is found in various areas of the brain (Lugnier 2006), in adrenal medulla, heart, rat ventricle (Yanaka et al. 2003), liver, and brown adipose tissue (Coudray et al. 1999). Erythro-9-(2-hydroxy-3-nonyl) adenine (EHNA) was shown to specifically act on PDE2 by inhibiting cCMP-activated PDE2 (Podzuweit et al. 1995). Chambers et al. (2006) described a new chemical tool for exploring the physiological function of the PDE2 isozyme. Phosphodiesterase 3 The PDE3 family is composed of two genes, PDE3A and PDE3B. PDE3A mRNA is enriched in blood vessels, heart, megakaryocytes and oocytes, whereas PDE3B is highest in in adipocytes, hepatocytes, brain, renal collecting duct epithelium, and developing spermatocytes (Reinhardt et al. 1995). PDE3 inhibitors have been extensively investigated and developed as non-glycoside, non-sympathomimetic, cardiotonic agents for the treatment of heart failure. Milrinone is the most studied and most extensively used PDE3 inhibitor and is used in the acute treatment of heart failure (Cruickshank 1993). Trequinsin (HL 725) inhibits PDE3 in a nanomolar range (Ruppert and Weithmann 1982); it also inhibits PDE1, PDE2, and PDE4in submicromolar concentrations (Stoclet et al. 1995). Boswell-Smith et al. (2006) studied the pharmacology of two long-acting trequinsin-like phosphodiesterase 3/4 inhibitors, RPL554 and RPL565. Hambleton et al. (2005) studied isoforms of cyclic nucleotide phosphodiesterase PDE3 and their contribution to cAMP hydrolytic activity in subcellular fractions of human myocardium. Masciarelli et al. (2004) described mice deficient of cyclic nucleotide phosphodiesterase 3A as a model of female infertility. Adachi et al. (2005) reported the effects of a phosphodiesterase 3 inhibitor, olprinone, on rhythmical change in the tension of human gastroepiploic artery. Abbott and Thompson (2006) performed analysis of anti-PDE3 activity of 2-morpholinochromone derivates revealing multiple mechanisms of antiplatelet activity. Phosphodiesterase 4 PDE4 is mainly present in the brain (Houslay et al. 1998), inflammatory cells (Tenor and Schudt 1996), cardiovascular tissues (Stoclet et al. 1995), and smooth muscles, but is lacking in the platelets. Four PDE4 genes (PDE4A–D) yield a large number of distinct PDE4 varaints. These enzymes, which result from the use of alternate promoters and extensive splicing of PDE4 mRNAs, are stratified into long or short forms (Conti et al. 2003). One PDE4A, three PDE4B (PDE4B1, PDE4B2, and PDE4B3), and three PDE4D (PDE4D1, PDE4D2, PDE4D3) variants are expressed in rat and human cardiac tissue (Houslay and Adams 2003). Two PDE4D gene-derived variants, PDE4D3 and PDE4D6, are expressed in human and rat aortic, mesenteric, and femoral contractile/quiescent and synthetic/activated vascular smooth muscle cells (Liu et al. 2000). The role of cAMP-specific PDE4 phosphodiesterases in cellular signaling was reviewed by Houslay and Adams (2003) and Conti et al. (2003). Huai et al. (2003) studied the three-dimensional structures of PDE4D in a complex with roliprams and the implication for inhibitor selectivity. Baillie et al. (2003) found that β-arrestin-mediated PDE4 cAMP phosphodiesterase recruitment regulates β-adrenoceptor switching from Gs to Gi. The antidepressant compound rolipram (ZK 62711) is a selective inhibitor of PDE4 (Schwabe et al. 1976; Komas et al. 1989). O’Donnell and Zhang (2004) described the antidepressant effects of inhibitors of cAMP phosphodiesterase (PDE4).Many analogs were studied as PDE4 inhibitors for treatment of asthma and chronic obstructive pulmonary disease (COPD) as well as anti-inflammatory drugs; however, most failed due to emetic side-effects (Giembycz 2002). Phosphodiesterase 5 Selective inhibitors of cyclic guanosine monophosphate (cGMP) phosphodiesterase type 5 (PDE5) were found to be effective in the treatment of erectile dysfunction in men (Jeremy et al. 1997; Ballard et al. 1998; Chuang et al. 1998; Stief et al. 1998; Corbin and Francis 1999; Turko et al. 1999;Wallis et al. 1999; Hosogai et al. 2001; Rotella 2001; Saenz de Tejada et al. 2001; Ukita et al. 2001). The PDE5 family consists of a single PDE5 gene that can encode three distinct proteins (PDE5A1–3) (Loughney et al. 1998). Wang et al. (2001) characterized type 5 phosphodiesterases in the corpus cavernosum of several species. Qiu et al. (2000) demonstrated that rabbit corpus cavernosum smooth muscle shows a different phosphodiesterase profile than human corpus cavernosum. Kim et al. (2001) compared the inhibition of cyclic GMP hydrolysis in human corpus cavernosum smooth muscle cells by vardenafil with that by sildenafil. The discovery of novel, potent, and selective PDE5 inhibitors was reported by Bi et al. (2001). Corbin et al. (2004) described the structural basis for the higher potency of vardenafil compared with sildenafil in inhibiting cCMP-specific phosphodiesterase-5 (PDE5). PDE5 inhibitors such as sildenafil can be used in the treatment of pulmonary arterial hypertension (Galié et al. 2005). Cohen et al. (1996) found that inhibition of cGMPspecific phosphodiesterase selectively vasodilates the pulmonary circulation in rats made chronically hypoxic by exposure to a simulated high altitude. Chronic hypoxia augments protein kinase G-mediated Ca2+ desensitization in pulmonary vascular smooth muscle through inhibition of RhoA/Rho kinase signaling (Jernigan et al. 2004). Thompson et al. (2001) studied the effect of sildenafil on corpus cavernosal smooth muscle relaxation and cGMP formation in the diabetic rabbit. Tantini et al. (2005) found an antiproliferative effect of sildenafil on human pulmonary artery smooth muscle cells. Other Phosphodiesterases The families of PDE6 to PDE11 have been identified as a result of bioinformatics-based genomic screening (Soderling and Beavo 2000). The search for inhibitors is just beginning. Gillespie and Beavo (1989) discussed inhibition and stimulation of photoreceptor phosphodiesterases (later on termed PDE6) by dipyridamole and M&B 22,948. D’Armours et al. (1999) investigated the potency and mechanism of action of E4021, a type 5 phosphodiesterase isozyme-selective inhibitor, on the photoreceptor phosphodiesterase. Zhang et al. (2005) described the efficacy and selectivity of phosphodiesterase-targeted drugs in inhibiting photoreceptor phosphodiesterase (PDE6) in retinal photoreceptors. Smith et al. (2004) reported the discovery of a selective inhibitor of phosphodiesterase 7. The discovery of thiadiazoles as a novel structural class of potent and selective PDE7 inhibitors was reported by Vergne et al. (2004a, 2004b). Lorthiois et al. (2004) and Bernadelli et al. (2004) described spiroquinazolinones as potent and selective PDE7 inhibitors. The first potent and selective PDE9 inhibitor was characterized by Wunder et al. (2005) using a cGMP reporter cell line. A.1.1.22 Stimulation of Heart Membrane Adenylate Cyclase ... PURPOSE AND RATIONALE Metzger and Lindner (1981) discovered that the positive inotropic and vasodilatory effects of forskolin were correlated with the stimulation of adenylate cyclase and cAMP-dependent protein kinase. Subsequent studies by Seamon (1981) demonstrated that forskolin, unlike hormones, guanine nucleotides, fluoride or cholera toxin could stimulate cyclase activity in the absence of the guanine nucleotide regulatory protein. Since those reports, hundreds of papers have been published on the effects of forskolin in numerous mammalian organ and cell systems. Several comprehensive review articles have also been published (Seamon and Daly 1981, 1983; Daly 1984). While forskolin has proven to be an invaluable research tool for investigations of adenylate cyclase systems (Salomon et al. 1974; Seamon et al. 1981, 1983), reports on its effects on cardiovascular (Lindner et al. 1978), pulmonary (Chang et al. 1984) and ocular physiology (Caprioli and Sears 1983; Caprioli 1985) suggest a therapeutic potential (Seamon 1984) as well. Described here is an in vitro assay which can be used to compare the potency of forskolin, forskolin analogs or other direct or indirect adenylate cyclase activators for the stimulation of adenylate cyclase in heart membranes. The purpose of this assay is to determine and compare the potency of direct or indirect activators of adenylate cyclase for an ability to stimulate heart membrane adenylate cyclase in vitro. PROCEDURE The hearts of theWistar rat, Hartley guinea pig, golden Syrian hamster or cardiomyopathic hamster (CHF-146) are used as a source of adenylate cyclase for this assay. Reagents 0.5 M Tris buffer, pH7.4 0.05 M Tris buffer, pH 7.4, containing 0.1 M CaCl2 Tris buffer mixture 0.05 M Tris buffer, containing 1 mM IMBX (isobutylmethylxanthine), 0.2 mM EGTA, 5 mM MgCl2, 0.5 mM ATP (Na2 ATP × 3 H2O) and 20 mM creatine phosphate (Na2 Creatine-PO4 × 5H2O) (final concentrations in the incubation media). Creatine phosphokinase (ATP:Creatine N-Phosphotransferase, EC 2.73.2), type I, from rabbit muscle is obtained from Sigma Chemical Co. The concentration of enzyme in the incubation media is 40U/ml. Test compounds For most assays, a 30 mM stock solution is made up in a suitable solvent (ethanol, ethyl acetate or DMSO for most forskolin analogs). Serial dilutions are made such that the final concentration in the assay ranges from 3 × 10–4 to 3 × 10–7 M. The concentration of vehicle in the assay is 1 %. Tissue Preparation One entire heart from rat, guinea pig or hamster is dissected, weighed and homogenized in 50 volumes of ice-cold 0.05 M Tris buffer, pH 7.4 containing 0.1 mM CaCl2 (reagent 2) using a Brinkman Polytron (setting 7 for 15 s). The homogenate is centrifuged at 10,000 g for 20 min at 4 °C. The resulting pellet is resuspended in 50 volumes of homogenizing buffer and recentrifuged as before. The supernatant of this spin is discarded and the resulting pellet is finally resuspended in 10 volumes of the homogenizing buffer, for rat and hamster and 60 volumes for guinea pig tissue. This final preparation is filtered through a thin layer of gauze and kept on ice until used in the assay. The protein concentration is approximately 250–350 mg/ml. Protein concentrations from an aliquot of the tissue suspension are determined on the day of the experiment by the method of Bradford (1976) using the Bio-Rad assay kit. Assay 300 μl Tris buffer mixture, pH 7.4 (reagent 3) 50 μl creatine phosphokinase 5 μl vehicle or appropriate concentration of test drug 95 μl H2O 50 μl tissue suspension The tubes are incubated for 5 min at 37 °C and the reaction is then stopped by placing the tubes into a boiling water bath for 4 min. The tubes are then centrifuged at 1000 g for 10 min and cAMP levels determined in a 15 μl aliquot of the supernatant using a radioimmunoassay kit (Code TRK432) obtained from Amersham according to the manufacturer’s protocol. Test principle: The method is based on the competition between unlabeled cAMP and a fixed quantity of 3H-labelled cAMP for binding to a protein which has high specificity and affinity for cyclic AMP. The amount of labelled cAMP–protein complex formed is inversely related to the amount of unlabelled cAMP present in the assay sample. The concentration of cAMP in the unknown is determined by comparison with a linear standard curve. EVALUATION The data are expressed as pmol cAMP/mg protein/min and dose-response stimulation curves are subjected to logic analysis to determine the concentration of compound which exhibits 50 % of maximal stimulation (ED 50). The β-blocking activities of compounds can be determined by their activities, by which they counteract the isoproterenol and GTP induced stimulation of rat heart membrane bound adenylate cyclase (Greenslade et al. 1979). A.1.1.23 3H-Forskolin Binding Assay ... PURPOSE AND RATIONALE This assay is used to identify compounds which demonstrate high affinity [nM] for association with forskolin binding sites in vitro as a preliminary screen in conjunction with stimulation of adenylate cyclase to determine the potential for cardiac chronotropic and inotropic and other effects of forskolin. Guinea pig heart tissue and rat brain tissue are used as sources of binding assays. PROCEDURE FOR GUINEA PIG HEART TISSUE A. Reagents 0.05 M Tris-HCl buffer, pH 7.4 0.05 M Tris-HCl, pH 8.0 containing 1 mM EGTA, 1 mM MgCl2 and 0.32 M sucrose [3H]-Forskolin (specific activity 31.6 Ci/mmol) is obtained from New England Nuclear. Final concentration in the assay is approximately 15 nM. Forskolin and test compounds Forskolin and forskolin analogs are diluted to 40 μM. A 100 μl addition of this solution to the final incubate of 200 μl tissue and 100 μl 3H-forskolin results in a final concentration of 10–5 M. Appropriate serial dilutions of this stock solution are made such that the final concentrations in the assay range from 10–5 to 10–11 M with each concentration being done in triplicate. B. Tissue preparation Male Hartley guinea pigs (300–350 g) are sacrificed by decapitation. The heart is immediately removed, weighed, rinsed, diced and homogenized in 10 volumes of ice-cold 0.05 M buffer(reagent2) using a Polytron homogenizer (setting 10, 30 s). The resulting homogenate is centrifuged at 12,000 g for 15 min at 4 °C. The clear supernatant of this spin is discarded, the remaining pellet (P2) is resuspended in 5 volumes of the same ice-cold buffer and rehomogenized. This final suspension (approximately 0.8–1.0 mg protein/ml) is kept on ice until use. Protein concentrations are estimated according to the method of Lowry et al. (1951). C. Binding assay To generate a dose-response inhibition curve, 3H-forskolin binding is performed according to the method of Seamon et al. (1984) with minor modifications. 200 μl tissue suspension 100 μl 3H-forskolin 100 μl appropriate concentration of forskolin or forskolin analog, or buffer Tubes are incubated at 30 °C for 10 min. The incubate is then diluted with 5 ml of ice-cold 0.05 M Tris-HCl buffer, pH7.4 (reagent 1) and immediately vacuum filtered through glass fiber filters (Whatman GF/B) by using a Brandel Cell Harvester. The filters are rapidly washed 3 times with 5 ml aliquots of Tris-HCl buffer (reagent 1), added to 10 ml scintillation cocktail and analyzed for radioactivity. PROCEDURE FOR RAT BRAIN TISSUE A. Reagents 0.32 M sucrose buffer 0.05 M Tris-HCl buffer, pH 7.5 [3H]-Forskolin (specific activity 31.6 Ci/mmol) is obtained from New England Nuclear. Final concentration in the assay is approximately 10 nM. Forskolin and test compounds Forskolin and forskolin analogs are diluted to 40 μM. A 100 μl addition of this solution to the final incubate of 200 μl tissue and 100 μl 3H-forskolin results in a final concentration of 10–5 M. Appropriate serial dilutions of this stock solution are made such that the final concentrations in the assay range from 10–5 to 10–11 M with each concentration being done in triplicate. B. Tissue preparation Male Sprague-Dawley rats (200–250 g) are sacrificed by decapitation. The brain is rapidly removed and dissected on ice. Striata are homogenized in 50 volumes of ice-cold 0.32 M sucrose buffer (reagent 1) using a Polytron homogenizer (setting 7, 15 s). The resulting homogenate is centrifuged at 1000 g for 10 min at 0–4 °C. The supernatant is retained and recentrifuged at 20,000 g for 10 min at 0–4 °C. The clear supernatant of this spin is discarded and the remaining pellet (P2) is resuspended in ice-cold Tris-HCl buffer, pH7.5 such that the final protein concentration is approximately 3.0–4.0 mg/ml. Protein concentrations are estimated according to the method of Lowry et al. (1951). C. Binding assay To generate a dose-response inhibition curve, 3Hforskolin binding is performed according to the method of Seamon et al. (1984) with minor modifications. 200 μl tissue suspension 100 μl 3H-forskolin 100 μl appropriate concentration of forskolin or forskolin analog or buffer Tubes are incubated at 23 °C for 60 min. The incubate is then diluted with 5 ml of ice-cold 0.05 M Tris-HCl buffer, pH7.4 (reagent 2) and immediately vacuum filtered through glass fiber filters (Whatman GF/B) by using a Brandel Cell Harvester. The filters are rapidly washed three times with 5 ml aliquots of Tris-HCl buffer (reagent 2), added to 10 ml scintillation cocktail and analyzed for radioactivity. EVALUATION Specific binding is defined as the difference between binding of 3H-forskolin in the absence and presence of 10 μM forskolin and represents 85–90 % of total binding at 10 nM 3H-forskolin. Results of the dose-response inhibition curves are analyzed by determining the concentration of competing compound which inhibits 50 % of the 3H-forskolin binding sites (IC 50). This value is determined by computer-derived log-probit analysis. The activity of various forskolin analogs are based on IC 50 values and are categorized as follows: IC 50[M] 0 = Not determined 1 = No activity >10 –5 2 = Slight activity 10–5–10–6 3 = Moderate activity 10–6–10–7 4 = Marked activity < 10–7 To compare the activity of various compounds from experiment to experiment, an inhibition constant (K I) is determined as described by Cheng and Prusoff (1973). The K I is determined from the equation: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ K_{\rm I} = IC_{50} /1 + LC/K_{\rm D} $$\end{document} IC 50 = concentration of competing compound which inhibits 50 % of the 3H-forskolin binding sites LC = determined 3H-forskolin concentration (approximately 10 nM) K D = dissociation of affinity constant for 3Hforskolin determined previously to be approximately 13.4 nM for rat striatum and 196nM for guinea pig heart Standard data: Binding inhibition values for forskolin Striatum Heart IC 50 43.1 ± 4.9 nM 34.2 ± 5.0 nM K I 26.0 ± 3.1 nM 31.6 ± 4.6 nM A.1.1.24 Patch Clamp Technique2 ... PURPOSE AND RATIONALE The introduction of the patch clamp technique (Neher and Sakmann 1976) revolutionized the study of cellular physiology by providing a high-resolution method of observing the function of individual ionic channels in a variety of normal and pathological cell types. By the use of variations of the basic recording methodology, cellular function and regulation can be studied at a molecular level by observing currents through individual ionic channels (Liem et al. 1995; Sakmann and Neher 1995). The most intriguing method is called the “on-cell” or “cell-attached” configuration, because ion channels can be recorded on an intact cell (Jackson 1993). This mode is well suited for investigation of ion channels that are activated by hormonal stimulation and triggered by intracellular second messengers. Another versatile mode is the “cell-excised” configuration (Hamill 1993). It is obtained by suddenly removing the patch pipette from the cell, so that the membrane patch is pulled off the cell. This mode easily allows the investigator to expose the channel proteins to drugs by changing the bath solution. The single channel currents are recorded on a videotape and are analyzed off-line by a computer system. Various parameters are evaluated, such as the single channel conductance, open and closed times of the channel, and the open-state probability, which is the percentage of time the channel stays in its open state. In addition to these modes, which enable the recording of single channel currents, it is also possible to measure the current flowing through the entire cell. This “whole-cell mode” is obtained by rupturing the membrane patch in the cell-attached mode (Hamill et al. 1981; Dietzel et al. 1993). This is achieved by applying suction to the interior of the patch pipette. The “whole-cell mode” allows not only the recording of electrical current, but also the measurement of cell potential. Moreover, the cell interior is dialyzed by the electrolyte solution contained in the patch pipette. The fabrication of patch clamp pipettes has been described by Sakmann and Neher (1995) and Cavalié et al. (1993). Variations of the patch clamp technique have been used to study neurotransmitter transduction mechanisms (Smith 1995). High throughput methods are required when developing drugs that work on ion channel function (Mathes 2003; Bennett and Guthrie 2003). Patch clamping suffers from low throughput, which is not acceptable for drug screening. Fertig et al. (2002) and Brueggemann et al. (2004, 2006) presented nanopatch clamp technology, which is based on a planar, microstructured glass chip, which enables automatic whole-cell patch clamp experiments. Planar glass substrates containing a single microaperture produced by ion track etching are used to record currents through ion channels in living mammalian cells. Falconer et al. (2002) reported high throughput screening for ion channel modulators setting up a Beckman/Sagian core system to fully automate functional fluorescence-based assays that measure ion channel function. Voltage-sensitive fluorescent probes were applied and the activity of channels was measured using Aurora’s Voltage/Ion Probe Reader (VIPR). The system provides a platform for fully automated high throughput screening as well as pharmacological characterization of ion channel modulators. Schroeder et al. (2003) described a high throughput electrophysiology measurement platform consisting of computer-controlled fluid handling, recording electronics, and processing tools capable of voltage clamp whole-cell recordings from thousands of individual cells per day. The system uses a planar, multiwell substrate (a PatchPlate). The system positions one cell into a hole separating two fluid compartments in each well of the substrate. Voltage control and current recordings from the cell membrane are made subsequent to gaining access to the cell interior by applying a permeabilizing agent to the intracellular side. Willumsen’s group recommended ion channel screening with QPatch (Asmild et al. 2003; Kutchisky et al. 2003; Krzywkowski et al. 2004). This system claims to allow fast and accurate electrophysiological characterization of ion channels, e. g., for determination of IC50 values for ion channel blockers. The system comprises 16 parallel patch clamp sites, each based on a silicon chip with a micro-etched patch clamp hole. Intra- and extra-cellular fluids are administered by laminar flow through integrated miniature flow channels. A.1.1.24.1 Patch Clamp Technique in Isolated Cardiac Myocytes PURPOSE AND RATIONALE The generation of an action potential in heart muscle cells depends on the opening and closing of ion-selective channels in the plasma membrane. The patch clamp technique enables the investigation of drug interactions with ion-channel-forming proteins at the molecular level. PROCEDURE Isolated cells from ventricular muscle of rat and guinea pig are prepared as described by Yazawa et al. (1990). Animals are sacrificed by cervical dislocation. Hearts are dissected and mounted on a Langendorfftype apparatus and perfused first with Tyrode solution (in mM: 143NaCl, 5.4KCl, 1.8CaCl2, 0.5MgCl2, 0.25NaH2PO4, 5 HEPES, pH adjusted to 7.4with NaOH) at 37 °C for 3 min at a hydrostatic pressure of 60–70cmH2O, then with nominally Ca2+- free Tyrode solution (no Ca2+ is added) for 5–7 min, and finally with nominally Ca2+-free Tyrode solution containing 0.12–0.2 mg/ml collagenase (Sigma, type I). After 15–20 min of collagenase treatment, the heart is now soft and is washed with storage solution (in mM: 70KOH, 50 L-glutamic acid, 40KCl, 20 taurine, 20KH2PO4, 3MgCl2, 10glucose, 10 HEPES, 0.5 EGTA, pH adjusted to 7.4with KOH). The ventricles are cut into pieces (about 5 mm × 5 mm) and poured into a beaker. The myocytes are dispersed by gently shaking the beaker and filtration through a nylon mesh (365 μm). Then, the myocytes are washed twice by centrifugation at 600–1000 rpm (about 90 g) for 5 min and kept at room temperature. The rod shape of the cell and the clear striations of sarcomeres are important criteria for selecting viable cells for the assay. Experiments are performed at 35 °C–37 °C. For investigation with the patch clamp technique (Neher and Sakmann 1976; Hamill et al. 1981), the isolated cells are placed into a thermostat-controlled chamber, mounted on the stage of an inverted microscope equipped with differential interference contrast optics. Under optical control (magnification 400×) a glass micropipette, having a tip opening of about 1 μm, is placed onto the cell. The patch pipettes are fabricated from borosilicate glass tubes (outer diameter 1.5 mm, inner diameter 0.9 mm) by means of an electrically heated puller. In order to prevent damage of the cell membrane, the tip of the micropipette is fire polished, by moving a heated platinum wire close to the tip. The patch pipette is filled with either high-NaCl or KCl solution and is mounted on a micro manipulator. A silver chloride wire connects the pipette solution to the head stage of an electronic amplifier. A second silver chloride wire is inserted into the bath and serves a ground electrode. After establishing contact with the cell membrane, a slight negative pressure is applied to the inside of the patch pipette by means of a syringe. Consequently, a small patch of membrane is slightly pulled into the opening of the micro pipette and close contact between the glass and membrane is formed, leading to an increase of the electrical input resistance into the giga-ohm range (about 1010 Ohm). This high input resistance enables the recording of small electrical currents in the range of picosiemens (10–12 S), which flow through channel-forming proteins situated in the membrane patch. The electrical current is driven by applying an electrical potential across the membrane patch, and/or by establishing an appropriated chemical gradient for the respective ion species. The patch clamp methods allows one to investigate the interaction of drugs with all ion channels involved in the functioning of the heart muscle cell (K+, Na+, Ca2+ and eventually Cl– channels). Moreover, the different types of K+ channels existing in cardiomyocytes can be distinguished by their different single-channel characteristics or by appropriate voltage-pulse protocols in the whole-cell mode. EVALUATION Concentration–response curves of drugs which inhibit or activate ion channels can be recorded either at the single channel level or by measuring the whole-cell current. IC50 and EC50 values (50 % inhibition or activation, respectively) can be obtained with both methods. MODIFICATIONS OF THE METHOD The patch clamp technique has been used for evaluation of anti-arrhythmic agents (Bennett et al. 1987; Anno and Hondeghem 1990; Gwilt et al. 1991). Gögelein et al. (1998) used isolated ventricular myocytes from guinea pigs to study a cardioselective inhibitor of the ATP-sensitive potassium channel. Multiple types of calcium channels have been identified by patch clamp experiments (Tsien et al. 1988). The effects of potassium channel openers have been measured (Terzic et al. 1994). Ryttsén et al. (2000) characterized electroporation of single NG108–15 cells with carbon-fiber microelectrodes by patch clamp recordings and fluorescence microscopy. Monyer and Lambolez (1995) reviewed themolecular biology and physiology at the single cell level, discussing the value of the polymerase chain reaction at the single cell level and the use of patch pipettes for collecting the contents of a single cell on which the reverse transcription is performed. The patch clamp technique was found to be very versatile in the investigation of ion channels in atrial myocytes, especially from dogs or humans. Cell were obtained from atria either in sinus rhythm or in atrial fibrillation (reviewed in Bosch et al. 1999). A.1.1.24.2 Voltage Clamp Studies on Sodium Channels PURPOSE AND RATIONALE The epithelial Na+ channel plays an important role in epithelial Na+ absorption in the distal colon, urinary bladder, salivary and sweat ducts, respiratory tract and, most importantly, in the distal tubules of the kidney (Catterall 1986; Palmer 1992). Regulation of this epithelial Na+ channel has a major impact on Na+ balance, blood volume, and blood pressure. Inhibition of epithelial Na+ channel expression is used for the treatment of hypertension (Endou and Hosoyamada 1995). Busch et al. (1995) studied the blockade of epithelial Na+ channels by triamterenes using two-microelectrode voltage clamp experiments in Xenopus oocytes expressing the three homologous subunits (α, β, and γ ) of the rat epithelial Na+ channel (rENaC). PROCEDURE Xenopus laevis oocytes are injected with the appropriate cRNA encoding for the α, β, and γ -subunits (Canessa et al. 1993) of the rat epithelial Na+ channel (rENaC). The cRNA for the wild-type α-subunit and its deletion mutant Δ278–273 is always coinjected with an equal amount of β and γ -subunit cRNA (10 ng/oocyte). Then, 2–8 days after cRNA injection, the two-microelectrode voltage clamp method is used to record currents from Xenopus oocytes. Recordings are performed at 22 °C using a Geneclamp amplifier (Axon Instruments, Foster City, Calif., USA), and MacLab D/A converter and software for data acquisition and analysis (AD Instruments, Castle Hill, Australia). The ND96 solution (control) contains (mM): NaCl 96, KCl 2, CaCl2 1.8, MgCl21, HEPES5, pH7.0. In some experiments, Na+ is replaced by N-methyl-Dglucamine (NMDG) solution. The microelectrodes are filled with 3 M KCl solution and have resistances in the range 0.5–0.9MΩ. Chemicals (e. g., triamterene as standard) are added at concentrations between 0.2 and 100 μM. The amplitude of the induced currents varies considerably, depending on the day of channel expression and the batch of oocytes. The mutant channel induces considerably smaller currents than the wild-type channel. The total Na+ current amplitude is determined at least once for each experimental day by superfusion with NMDG solution, or with 3 μM or 5 μM amiloride solution at the beginning and at the end of each set of experiments. EVALUATION Data are presented as means ± SEM. A paired Student’s t-test is used. The level of statistical significance is set at P < 0.05. MODIFICATIONS OF THE METHOD Nawada et al. (1995) studied the effects of a sodium, calcium, and potassium antagonistic agent on the sodium current by the whole cell voltage clamp technique (tip resistance = 5MΩ[Na]i and [Na]o 10 mmol/l at 20 °C) in guinea pig isolated ventricular cells. Sunami and Hiraoka (1996) studied the mechanism of cardiac Na+ channel block by a charged class I antiarrhythmic agent, in guinea pig ventricular myocytes using patch clamp techniques in the whole-cell, cellattached and inside-out configurations. Erdõ et al. (1996) compared the effects of Vinca derivatives on voltage-gated Na+ channels in cultured cells from rat embryonic cerebral cortex. Effects on Na+ currents were measured by applying voltage steps (20 ms duration) to –10 mV from a holding potential of –70 mV every 20 s. Steady-state inactivation curves were obtained by clamping the membrane at one of a series of 15-s prepulse potentials, followed 1 ms later by a 20-ms test pulse to –10 mV. Ragsdal et al. (1993) examined the actions of a Na+ channel blocker in whole-cell voltage clamp recordings from Chinese hamster ovary cells transfected with a cDNA encoding the rat brain type IIA Na+ channel and from dissociated rat brain neurons. Taglialatela et al. (1996) studied cloned voltage-dependent Na+ currents expressed in Xenopus oocytes upon injection of the cRNA encoding α-subunits from human and rat brain. Wang et al. (1997) investigated pharmacological targeting of long QT mutant sodium channels. Eller et al. (2000) measured the effects of a calcium antagonist on inward Na+ currents (I Na) in GH3-cells with the whole-cell configuration of the patch clamp technique. I Na was recorded after depolarization from a holding potential of –80 mV to a test potential of +5 mV. Initial “tonic” block (resting statedependent block) was defined as peak I Na inhibition during the first pulse 2 min after drug application as compared with I Na in the absence of drug. “Use-(frequency-) dependent” block of I Na was measured during trains of 5- or 50-ms test pulses (3Hz) applied from –80 mV to a test potential of +5 mV after a 2-min equilibrium period in the drug-containing solution. Use-dependent block was expressed as the percentage decrease of peak I Na during the last pulse of the train as compared with I Na during the first pulse. Khalifa et al. (1999) characterized the effects of an antidepressant agent on the fast inward current (I Na) in isolated guinea pig ventricular myocytes. Currents were recorded in the whole-cell configuration of the patch clamp technique in the presence of Ca2+ and K+ channel blockers. Haeseler et al. (1999) measured the effects of 4-chloro-m-cresol, a preservative added to a wide variety of drugs, on heterologously expressed wild-type, Paramyotonia congenita (R1448H) and hyperkalemic periodic paralysis (M1360V) mutant α-subunits of human muscle sodium channels using whole-cell and inside-out voltage clamp experiments. Song et al. (2000) studied the effects of Nethyl-maleimide, an alkylating agent to protein sulfhydryl groups, on tetrodotoxin-sensitive (TTX-S) and tetrodotoxin-resistant (TTX-R) sodium channels in rat dorsal root neurons using the whole-cell configuration of the patch clamp technique. Rats at the age of 2–6 days were anesthetized with isoflurane and the spinal cord was removed and cut longitudinally.Dorsal root ganglia were plucked from the area between the vertebrae of the spinal column, and incubated in phosphate-buffered saline solution containing 2.5 mg/ml trypsin at 37 °C for 30 min. After enzyme treatment, ganglia were rinsed with Dulbecco’s Modified Eagle Medium supplemented with 10 % horse serum. Single cells were mechanically dissociated by trituration with a fire-polished Pasteur pipette and plated on poly-L-lysine-coated glass coverslips. Cells attached to the coverslips were transferred into a recording chamber on the stage of an inverted microscope. Ionic currents were recorded under voltage clamp conditions by the whole-cell patch clamp technique. The solution in the pipette contained (in mM): CsCl 125, NaF 20, HEPES 5, EGTA5. The pH was adjusted to 7.2 with CsOH and the osmolarity was 279 mosmol/l on average. The external solution contained (in mM): NaCl 50, choline chloride 90, tetramethylammonium chloride 20, D-glucose 5, HEPES 5, MgCl2 1, CaCl2 1.Lanthanum (LaCl3, 10 μM) was used to block calcium channel current. The solution was adjusted to pH 7.4 with tetramethylammonium hydroxide and the osmolarity was 304 mosmol/l on average. An Ag–AgCl pellet/3 M KCl-agar bridge was used for the reference electrode. Membrane currents were recorded using an Axopatch-1D amplifier. Signals were digitized by a 12-bit analog-to-digital interface, filtered with a lowpass Bessel filter at 5 kHz and sampled at 50 kHz using pCLAMP6 software (Axon Instruments) on an IBMcompatible PC. Series resistance was compensated 60 %–70 %. Capacitative and leakage currents were subtracted by using a P + P/4 procedure (Bezanilla and Armstrong 1977). The liquid junction potential between internal and external solutions was on average –1.7 mV. TTX (100 nM) was used to separate TTX-R sodium currents from TTX-S sodium currents. For the study of TTX-S sodium channels, cells that expressed only TTX-S sodium channels were used. TTX-S sodium channels were completely inactivated within 2 ms when currents were evoked by depolarizing steps to 0 mV, while TTX-R sodium channels persisted for more than 20 ms. The difference in kinetics was used to identify the type of sodium current. Abriel et al. (2000) described the molecular pharmacology of the sodium channel mutation DI790G linked to long QT syndrome. Makielski et al. (2003) showed that a ubiquitous splice variant and a common polymorphism affect heterologous expression of recombinant human SCN5AS heart sodium channels. Viswanathan et al. (2001) studied gating mechanisms for flecainide action in SNCN5A-linked arrhythmia syndromes. A.1.1.24.3 Voltage Clamp Studies on Potassium Channels PURPOSE AND RATIONALE Potassium channels represent a very large and diverse collection of membrane proteins which participate in important cellular functions regulating neuronal and cardiac electrical patterns, release of neurotransmitters, muscle contractility, hormone secretion, secretion of fluids, and modulation of signal transduction pathways. The main categories of potassium channels are gated by voltage or an increase of intracellular calcium concentration (Escande and Henry 1993; Kaczorowski and Garcia 1999; Alexander et al. 2001). For ATP-sensitive potassium channels see Sect.K.6.6.12. The delayed outward potassium current in heart muscle cells of several species is made up of a rapidly (I Kr) and a slowly (I Ks) activating component (Sanguinetti and Jurkiewicz 1990; Wang et al. 1994; Gintant 1996; Lei and Brown 1996; Carmeliet and Mubagawa 1998). Several potent and selective blockers of the I Kr channel have been shown to prolong the effective refractory period, but have a reverse rate-dependent activity with both normal and elevated extracellular potassium concentrations (Colatsky et al. 1990). Inhibitors of the slow component IKs were developed in order to circumvent the negative rate dependence of I Kr channel blockers in the effective refractory period (Busch et al. 1996; Suessbrich et al. 1996, 1997; Bosch et al. 1998). Gögelein et al. (2000) studied the effects of a potent inhibitor of I Ks channels in Xenopus oocytes and guinea pig ventricular myocytes. PROCEDURE Studies in Xenopus oocytes are performed with the two-microelectrode voltage clamp method. For isolation of the oocytes, the toads are anesthetized using a 1 g/l solution of 3-aminobenzoic acid ethyl ester and placed on ice. A small incision is made to retrieve sacs of oocytes and is subsequently closed with absorbable surgical suture. On waking up, the toads are placed back into the aquarium. The ovaries are cut up into small pieces and the oocytes are washed in Ca2+-free Or-2 solution (82.5 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM HEPES; pH 7.4) and subsequently digested in Or-2 containing collagenase A (1 mg/ml, Worthington, type II) until follicles are not longer detectable on the oocyte’s surface. The oocytes are stored at 18 °C in recording solution ND-96 (NaCl 96 mM, KCl 2 mM, CaCl2 1.8 mM, MgCl2 1 mM, HEPES 5 mM, pH 7.4)with added sodium pyruvate (275 mg/l), theophylline (90 mg/l), and gentamicin (50 mg/l). For electrophysiological recordings, the two-microelectrode voltage clamp configuration is used to record ion currents from Xenopus oocytes. Injection of cRNA is performed according to Methfessel et al. (1986) and Golding (1992). Oocytes are injected individuallywith cRNA encoding for the human protein minK, guinea pig Kir2.1, human Herg, human Kv1.5, mouse Kv1.3, or human HNC2. In the case of minK the functional potassium channel is a heteromultimer composed of the endogenous (Xenopus) KvLQT1 and the injected human minK. This heteromultimeric potassium current in then called I Ks (Barhanin et al. 1996; Sanguinetti et al. 1996). The electrophysiological recordings are performed at room temperature, using a Geneclamp amplifier (Axon Instruments), and MacLab D/A converter. The amplitudes of the recorded currents are measured at the end of the test voltage steps. To amplify the inward potassium current through Kir2.1 and HNC2, the external potassium concentration is raised to 10 mM KCl and the NaCl concentration lowered to 88 mM (ND-88). The microelectrodes are filled with 3 M KCl and have a resistance between 0.5MΩ and 1MΩ. During the recordings the oocytes are continuously perfused with ND-96 (or ND-88 in the case of Kir2.1 and HCN2). The test compounds are dissolved in dimethylsulfoxide (DMSO) and added to the buffer ND-96 or ND-88. The current amplitude is determined after 5 min of wash-in time. For the isolation of ventricular myocytes, guinea pigs (weight about 400 g) or Sprague-Dawley rats of either sex are sacrificed by cervical dislocation. The hearts are dissected and perfused retrogradely via the aorta at 37 °C: first with nominally Ca2+-free Tyrode solution (in mmol/l): 143 NaCl, 5.4 KCl, 0.5MgCl2, 0.25NaH2PO4, 10 glucose, 5HEPES, pH 7.2, then with Tyrode solution containing 20 mmol/l Ca2+ and 3 mg/ml collagenase type CLS II (Biochrom, Berlin Germany). After 5–10 min collagenase treatment the ventricles are cut up into small pieces in the storage solution (in mmol/l): 50 L-glutamic acid monopotassium salt, 40KCl, 20 taurine, 20KH2PO4, 1MgCl2, 10 glucose, 0.2 EGTA, pH 7.2. The myocytes are then dispersed by gentle shaking followed by filtration through a nylon mesh (365 μm). The cells are finally washed twice by centrifugation at 90 g for 5 min and kept in the storage solution at room temperature. Whole-cell currents are recorded in the tight-seal whole-cell mode of the patch clamp technique, using an EPC-9 amplifier (HEKA Elektronik, Lambrecht, Germany). Patch pipettes are pulled from borosilicate glass capillaries (wall thickness 0.3 mm, outer diameter 1.5 mm) and their tips are fire-polished. Series resistance is in the range of 1–10MΩ and 50 % compensated by means of the EPC’s compensation circuit. The I Ks, I Kr, and I K1 currents in guinea pig ventricular myocytes are investigated. The voltage pulses for recording the current components are as follows: I Ks current: holding potential –80 mV to –50 mV (200 ms) to +60 mV (3 s) to –40 mV (2 s) to –80 mV; I Kr current: holding potential –80 mV to –50 mV (200 ms) to –10 mV (3 s) to –40 mV (2 s) to –80 mV. I Kr is evaluated as the tail current evoked by a voltage pulse from –10 mV to –40 mV; I K1: holding potential –80 mV to –120 mV (200 ms) to –80 mV. In order to suppress the L-type Ca2+ current, 5 mmol/l nifedipine is added to the bath solution. EVALUATION All average data are presented as means ± SEM. Student’s t-test is used to determine the significance of paired observations. Differences are considered as significant at P < 005. MODIFICATIONS OF THE METHOD Using the whole-cell configuration of the patch clamp technique, Grissmer et al. (1994) analyzed the biophysical and pharmacological properties of five cloned voltage-gated K+ channels stably expressed in mammalian cell lines. Sanchez-Chapula (1999) studied the block of the transient outward K+ channel (I to) by disopyramide in isolated rat ventricular myocytes using whole-cell patch clamp techniques. Using the patch clamp technique, Cao et al. (2001) investigated the effects of a centrally acting muscle relaxant and structurally related compounds on recombinant small-conductance Ca2+-activated K+ channels (rSK2 channels) in HEK mammalian cells. Tagliatela et al. (2000) discussed the block of the K+ channels encoded by the human ether-á-go-gorelated gene (HERG), termed KV(r), which are the molecular determinants of the rapid component of the cardiac repolarizing current I K(Vr), involved in the cardiotoxic potential and CNS effects of first-generation antihistamines and may be therapeutic targets for antiarrhythmic agents (Vandenberg et al. 2001; Zhou et al. 2005). Chabbert et al. (2001) investigated the nature and electrophysiological properties of Ca2+-independent depolarization-activated potassium currents in acutely isolated mouse vestibular neurons using the wholecell configuration of the patch clamp technique. Three types of currents were identified. Furthermore, Longobardo et al. (1998) studied the effects of a quaternary bupivacaine derivative on delayed rectifier K+ currents stably expressed in Ltk − cells using the whole-cell configuration of the patch clamp technique. Moreno et al. (2003) studied the effects of a selective angiotensin II type 1 receptor antagonist on cloned potassium channels involved in human cardiac repolarization. Sanchez-Chapula et al. (2002) investigated the voltage-dependent block of wild-type and mutant HERG K+ channels by the antimalarial compound chloroquine. Anson et al. (2004) published molecular and functional characterization of common polymorphism in HERG (KCNH2) potassium channels. For more information on the evaluation of HERG potassium channels in safety pharmacology see Chap. I.D by Brian D. Guth. A.1.1.24.3.1 Studies on Kv1.5 Channel PURPOSE AND RATIONALE Treatment of atrial fibrillation/flutter with available potassium channel blockers (Class III antiarrhythmic agents which mainly block the delayed rectifier current I kr) is associated with ventricular proarrhythmia. Prolongation of ventricular repolarization leads to early after-depolarization from which torsades de pointes can evolve. Therefore, blockade of a cardiac current of exclusive relevance in the atria is highly desirable as it is expected to be devoid of ventricular proarrhythmic effects. The ultrarapid delayed rectifier potassium current (I kur) seems an ideal atrial antiarrhythmic target since it is found to contribute to the action potential in the atrium but not in the ventricle. The molecular correlate of the human cardiac ultrarapid delayed rectifier potassium current is the potassium channel Kv1.5, which therefore gained much interest (Li et al. 1996; Longobardo et al. 1998; Perchenet and Clément-Chomienne 2000; Caballero et al. 2000, 2001, 2004; Bachmann et al. 2001; Kobayashi et al. 2001; Matsuda et al. 2001; Choi et al. 2002; Moreno et al. 2003; Choe et al. 2003; Fedida et al. 2003; Godreau et al. 2002, 2003; Peukert et al. 2003, 2004; Plane et al. 2005). For in vivo studies on atrial fibrillation see A.5.0.9, A.5.0.9.1, A.5.0.9.2, A.5.0.9.3. Gögelein et al. (2004) studied the effects of the antiarrhythmic drug AVE0118 on cardiac ion channels. PROCEDURE Molecular Biology and Cell Culture Human Kv1.5 cDNA was subcloned into the eukaryotic expression vectors pcDNA3.1 and pcDNA3.1/zeo (Invitrogen, Groningen, the Netherlands), cDNA encoding human Kv4.3 long (Kv4.3 l; Dilks et al. 1999) was subcloned into pcDNA3.1, and the cDNA encoding human KChIP2 short (KChIP2.2; Decher et al. 2001) was subcloned into pcDNA3.1/zeo expression vector. Chinese hamster ovary (CHO) cells were transfected with either hKv1.5 or hKv4.3 and KChIP2.2 expression constructs. Transfection was carried out using lipofectamine (Life Technologies/Gibco BRL, Karlsruhe, Germany) according to the manufacturer’s instructions. To boost Kv1.5 channel expression, CHO cells were consecutively transfected with both Kv1.5 expression constructs. Both hKv1.5 and hKv4.3 + hKChIP2.2 were stably expressed in CHO cells, which were maintained in ISCOVE’s medium (Biochrom KG, Berlin, Germany), supplemented with 10 % fetal bovine serum, 2 mM L-glutamine, 350 μg/ml Zeocin (Invitrogen) and 400 μg/ml G418 (PAA Laboratories). HERG, the potassium channel underlying I Kr currents in human hearts, was cloned and transfected into CHO cells as described previously (Rampe et al. 1997). Cells used for patch clamping were seeded on glass or plastic coverslips 12–36 h before use. Northern blot analysis of Kv1.5 in the pig heart and cloning of pig Kv1.5 Polyadenylated RNA was isolated from pig cardiac tissues with the Oligotex mRNA purification kit (Qiagen) and 10 μg per tissue was resolved by denaturing formaldehyde electrophoresis and blotted on a positively charged nylon membrane. The membrane was hybridized with a DIG-labeled riboprobe (DIG RNA labeling kit, Roche) encompassing the entire coding sequence of human Kv1.5 and exposed on a Lumi-Imager (Roche). The pig Kv1.5 was cloned by 5′-rapid amplification and 3′-rapid amplification of cDNA ends (RACE) reactions.An adapter ligated, double-stranded cDNA library was prepared from pig heart mRNA with theMarathon cDNA amplification kit (Clontech). The 5′-RACE and 3′-RACE reactions were performed with oligonucleotide primers derived from a partial pig Kv1.5 nucleotide sequence (GenBank accession number AF348084). Overlapping cDNA clones were obtained by repeated reactions and the DNA sequence determined by automated DNA sequencing on both strands (ABI 310, Perkin Elmer). A full-length cDNA clone was established by recombinant PCR. It encodes an open reading frame of 1,083 bp and a protein with 86 % overall sequence similarity to the human Kv1.5 protein. The sequence of the pig Kv1.5 cDNA was submitted to GenBank (accession number: AY635585). For Xenopus oocyte expression, cDNAs encoding Kv1.5, Kv4.3, and KChip2.2 were cloned into the oocyte expression vector pSGEM (Villmann et al. 1997), and capped cRNA was synthesized using the T7 mMessage mMachine kit (Ambion, Austin, Tex., USA). Voltage-clamp experiments in Xenopus Oocytes Handling and injection of Xenopus oocytes were performed according to Bachmann et al. (2001). Adult female Xenopus laevis frogs were anesthetized with 3-aminobenzoic acid ethyl ester solution (1 g/l) and intact ovary lobes were removed. The oocytes were defolliculated by treatment with 40 mg collagenase dissolved in 20 ml buffer (in mM: NaCl 82.5, KCl 2, MgCl2 1, HEPES 5, titrated to pH7.5 with NaOH) for 120–150 min at 18 °C. Oocytes were injected with 50 nl cRNA using a microinjector (World Precision Instruments, Sarasota, Fla., USA). Oocytes were stored under gentle shaking at 18 °C in a buffer containing (in mM): NaCl 96, KCl 2, CaCl2 1.8, MgCl2 1, HEPES 5, Na-pyruvate 2.5, theophylline 0.5, gentamicin 50 μg/ml, titrated to pH7.5 with NaOH. They were used for experiments 1–3 days after injection. Two-electrode voltage clamp recordings were performed at room temperature in a medium containing (in mM): NaCl 96, KCl 2, CaCl2 1.8, MgCl2 1, HEPES 5, pH7.5 with NaOH. Microelectrodes were pulled from filament borosilicate glass capillaries (Hilgenberg, Malsfeld, Germany) using a horizontal microelectrode puller (Zeitz, Augsburg, Germany). After filling with 3 M KCl, pipettes had a resistance of 0.3–1.3MΩ. To activate hKv1.5 and hKv4.3 channels, oocytes were clamped from a holding potential of –80 mV to 40 mV for 500 ms. Data were recorded with a Turbo Tec 10CX amplifier (NPI, Tamm, Germany) using an ITC-16 interface (Instrutech Corporation, Long Island, USA) and the Pulse software (HEKA Elektronik, Lambrecht, Germany). Patch Clamp Experiments with CHO Cells Cells expressing Kv1.5 or Kv4.3 plus KChIP2.2 were assayed using the standard whole-cell patch clamp technique (Hamill et al. 1981). Cells were mechanically removed from the tissue culture flask and placed in a perfusion chamber with a solution containing (in mM): NaCl 140, KCl 4.7, CaCl2 2, MgCl2 1.1, HEPES 10, pH adjusted to 7.4 with NaOH. Patch pipettes were pulled from borosilicate glass capillaries and heat polished. After filling with (in mM): NaCl 10, KCl 120, EGTA 1, HEPES 10, MgCl2 1.1 (pH 7.2 with potassium hydroxide, KOH), pipettes had resistances of 2–3MΩ. Experiments were carried out at 36 ± 1 °C. For the recording of hKv1.5, voltage pulses of 450 ms duration were applied from the holding potential of –30 mV to +20 mV at a frequency of 1Hz. For recording of the hKv4.3 + KChIP2.2, the holding potential was –50 mV and test pulses of 200 ms duration were applied to –10 mV at a frequency of 1Hz. Data were recorded with an EPC-9 patch clamp amplifier (HEKA Elektronik) and the Pulse software (HEKA Elektronik) and stored on a PC for later analysis. Series resistance was in the range of 4–9MΩ and was compensated by 80 % by means of the EPC9’s compensation circuit. The experiments were performed under continuous superfusion of the cells with solution heated to 36 ± 1 °C. HERG channel currents were recorded at room temperature using the whole-cell configuration of the patch clamp technique with an Axopatch 200B amplifier (Axon Instruments). Briefly, electrodes (3–6MΩ resistance) were fashioned from TW150F glass capillary tubes (World Precision Instruments) and filled with pipette solution (in mM: potassium aspartate 120, KCl 20, Na2ATP 4, HEPES 5, MgCl2 1, pH 7.2 adjusted with KOH). HERG currents were initiated by a positive voltage pulse (20 mV) followed by a negative pulse (–40 mV) and were recorded for off-line analyses. Once HERG current from a cell perfused with control external solution (in mM: NaCl 130, KCl 5, sodium acetate 2.8, MgCl2 1, HEPES 10, glucose 10, CaCl2 1 at pH7.4 adjusted with NaOH) was stabilized, the cell was perfused with external solution containing the compound at a specific concentration for percentage inhibition. For each concentration from each cell, peak amplitude of the steady-state HERG tail current at –40 mV was measured. The peak amplitude for each concentrationwas compared with that for the control solution from the same cell and expressed as percent control. Isolation of Porcine Atrial Myocytes Male pigs weighing 15–30 kg of the German Landrace were anesthetized with pentobarbital exactly as described previously (Wirth and Knobloch 2001). After a left thoracotomy the lung was retracted, the pericardium incised and the heart was quickly removed and placed in oxygenated nominally Ca2+-free Tyrode solution containing (in mM): NaCl 143, KCl 5.4, MgCl2 0.5, NaH2PO4 0.25, HEPES 5 and glucose 10, pH adjusted to 7.2 with NaOH. The hearts were then mounted on a Langendorff apparatus and perfused via the left circumflex coronary artery with Tyrode solution (37 °C) with constant pressure (80 cmH2O). All coronary vessels descending to the ventricular walls were ligated, ensuring sufficient perfusion of the left atrium. When the atrium was clear of blood and contraction had ceased (≈5 min), perfusion was continued with the same Tyrode solution, which now contained 0.015 mM CaCl2 and 0.03 % collagenase (type CLS II, Biochrom KG, Berlin, Germany), until atrial tissue softened (≈20 min). Thereafter, left atrial tissue was cut into small pieces and mechanically dissociated by trituration. Cells were then washed with storage solution containing (in mM): L-glutamic acid 50, KCl 40, taurine 20, KH2PO4 20, MgCl2 1, glucose 10, HEPES 10, EGTA 2 (pH 7.2 with KOH) and filtered through a nylon mesh. The isolated cells were kept at room temperature in the storage solution. Isolation of Guinea Pig Ventricular Myocytes Ventricular myocytes were isolated by enzymatic digestion according to Gögelein et al. (1998). Dunkin Hardley Pirbright White guinea pigs (weight about 400 g) were sacrificed by cervical dislocation. The hearts were dissected and perfused retrogradely via the aorta at 37 °C with the same solutions as used for isolation of pig atrial myocytes. Electrophysiological Recordings from Cardiac Myocytes Whole-cell currents were recorded with an EPC-9 patch clamp amplifier (HEKAElektronik) as described above for CHO cells. A small aliquot of cell-containing solution was placed in a perfusion chamber and after a brief period allowing for cell adhesion to the chamber, the cells were perfused with (in mM): NaCl 140, KCl 4.7, CaCl2 1.3, MgCl2 1.0, HEPES 10, glucose 10, pH adjusted to 7.4 with NaOH. Patch pipettes were pulled from borosilicate glass capillaries and heat polished. After filling with (in mM) KCl 130, MgCl2 1.2, HEPES 10, EGTA 10, K2ATP 1,GTP 0.1, and phosphocreatine 5 (pH 7.2 with KOH) pipettes had a resistance of 2–3MΩ. Series resistance was in the range of 6–12MΩ and was compensated by 60 %–70 %. Offset voltages generated when the pipette was inserted in NaCl solution (1–5 mV) were zeroed before formation of the seal. Effects of AVE0118 on the I KACh were recorded from pig left atrial myocytes by applying voltage pulses of 500 ms duration from the holding potential of –80 mV to –100 mV. Carbachol (10 μM) was added in order to evoke the I KACh. After stabilization of the I KACh (3 min), AVE0118 was added in increasing concentrations in the continuous presence of carbachol. The current was measured at the end of the pulse after 3 min of incubation at each concentration and inhibition of the carbachol-activated current was calculated. In some experiments,AVE0118was washed out before application of the next higher concentration. Also the L-type Ca2+ current was investigated in pig left atrial cells. In these experiments, KCl in the pipette was replaced by CsCl and voltage pulses of 300 ms duration were applied from the potential of –40 mV to 0 mV. Possible effects of AVE0118 on the currents I K1, I Ks, I Kr and I KATP were investigated in guinea pig ventricular myocytes. I K1 currents were recorded by a voltage step from –80 mV to –120 mV lasting for 200 ms. When I Ks and I Kr currents were recorded, 1 μM nisoldipine was added to the bath to block the L-type Ca2+ current. I Ks was assessed by voltage pulse to +60 mV for 3 s, starting from –40 mV. I Kr was evaluated as the tail current evoked by a voltage pulse from –10 mV to –40 mV. I KATP was evoked by adding 1 μM rilmakalim (Krause et al. 1995) to the bath and by applying voltage ramps from –130 mV to +80 mV for 500 ms. The rilmakalim-activated current was recorded at the potential 0 mV. All patch clamp experiments were performed under continuous superfusion of the cells with solution heated to 36 ± 1 °C. EVALUATION All averaged data are presented as the mean ± SEM. The Student’s t-test was used to determine the significance of paired or unpaired observations. Differences were considered significant at P < 0.05. The values for half-maximal inhibition (IC50) and the Hill coefficient were calculated by fitting the data points of the concentration–response curves to the logistic function: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ f(x) = (a - d)/\left[ {1 + (x/c)^n } \right] + d $$\end{document} where a represents the plateau value at low drug concentration and d the plateau value at high drug concentration; c represents the IC50 value and n the Hill coefficient. The curve-fitting and the Student’s t-test were performed with the computer program Sigma-Plot 5.0. A.1.1.24.4 Voltage Clamp Studies on Calcium Channels PURPOSE AND RATIONALE Calcium influx through voltage-gated Ca2+ channels mediates a range of cytoplasmatic responses, including muscle contraction, release of neurotransmitters, Ca2+ dependent gene transcription and the regulation of neuronal excitability has been reviewed by several authors (Augustine et al. 1987; Bean 1989; Miller 1987; Zamponi 1997; Snutch et al. 2001). In addition to their normal physiological function, Ca2+ channels as calcium antagonists are also implicated in a number of human disorders (see also A.4.0.1). Using patch clamp techniques, the structure and regulation of voltage-gated Ca2+ channels has been studied by many authors (Sculptoreanu et al. 1993; Peterson et al. 1997; Catterall 2000). Berjukow et al. (2000) analyzed the role of the inactivated channel conformation in molecular mechanism of Ca2+ channel block by a dihydropyridine derivative in L-type channel constructs and mutants in Xenopus oocytes and described the electrophysiological evaluation. PROCEDURE Inward barium currents (I Ba) are studied with two microelectrode voltage-clamp of Xenopus oocytes 2–7 days after microinjection of approximately equimolar cRNA mixtures of constructs of L-channel mutants. All experiments are carried out at room temperature in a bath solution with the following composition: 40 mM Ba(OH)2, 50 mM NaOH, 5 mM HEPES, 2 mM CsOH (pH adjusted to 7.4 with methanesulfonic acid). Voltage recording and current injecting microelectrodes are filled with 2.8 M CsCl, 0.2 M CsOH, 10 mM EGTA, 10 mM HEPES (pH 7.4) with resistances of 0.3–2MΩ. Resting channel block is estimated as peak I Ba inhibition during 100-ms test pulses from -80 to 20 mV at a frequency of 0.033Hz until steady state is reached. The dose response curves of I Ba inhibition were fitted using the Hill equation: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \frac{{I_{{\rm Ba,}\;{\rm drug}} }}{{I_{{\rm Ba,}\;{\rm control}} }}(\% ) = \frac{{100 - A}}{{1 + \left( {\frac{C}{{{\rm IC}_{50} }}} \right)^{nH} }} + A $$\end{document} where IC 50 is the concentration at which I Ba inhibition is half-maximal, C is the applied drug concentration, A is the fraction of I Ba that is not blocked, and nH is the Hill coefficient. Recovery from inactivation is studied at a holding potential of -80 mV after depolarizing Ca2+ channels during a 3-s prepulse to 20 mV by applying 30-ms test pulses (to 20 mV) at various time intervals after the conditioning prepulse. Peak I Ba values are normalized to the peak current measured during the prepulse, and the time course of I Ba recovery from inactivation is fitted to a mono- or biexponential function \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ I_{{\rm Ba,}\;{\rm recovery}} = A \times \exp \left( {\frac{{ - t}}{{\tau _{{\rm fast}} }}} \right) + B \times \exp \left( {\frac{{ - t}}{{\tau _{{\rm slow}} }}} \right) + C $$\end{document} Voltage dependence of inactivation under quasi-steady state conditions is measured using a multi step protocol to account for run-down (less than 10 %). A control test pulse (50 ms to 20 mV) is followed by a 1.5-s step to-100 mV followed by a 30-s conditioning step, a 4-ms step to -100 mV, and a subsequent test pulse to 20 mV (corresponding to the peak potential of the I-V curves). Inactivation during the 30 s conditioning pulse is calculated as follows. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ I_{{\rm Ba,}\;{\rm inactivation}} = \frac{{I_{{\rm Ba,}\;{\rm test}} (20\,{\rm mV})}}{{I_{{\rm Ba,}\;{\rm control}} (20\,{\rm mV})}} $$\end{document} The pulse sequence is applied every 3 min from a holding potential of -100 mV. Inactivation curves are drawn according to the following Boltzmann equation. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ I_{{\rm Ba,}{\rm inactivation}} = I_{{\rm SS}} + (1 - I_{{\rm SS}} )\left( {1 + \exp \left( {\frac{{V - V_{0.5} }}{k}} \right)} \right) $$\end{document} where V is the membrane potential, V 0.5 is the midpoint voltage, k is the slope factor, and I SS is the fraction of non inactivating current. Steady state inactivation of the mutate channels at -80 mV is estimated by shifting the membrane holding potential from -80 to -100 mV. Subsequent monitoring of the corresponding changes in I Ba amplitudes until steady state reveals the fraction of Ca2+ channels in the inactivated state at -80 mV. Steady state inactivation of different L-type channel constructs at -30 mV is estimated by fitting time course of current inactivation to a biexponential function. The I Ba inactivation time constants are estimated by fitting the I Ba decay to a mono- or biexponential function. EVALUATION Data are given as the means ± SE. Statistical significance is calculated according to Student’s unpaired ttest. MODIFICATIONS OF THE METHOD Besides Xenopus oocytes (Waard and Campell 1995; Hering et al. 1997;Kraus et al. 1998), several other cell types and constructs, such as CHO cells (Sculptoreanu et al. 1993; Stephens et al. 1997), HEK293 (human embryonic kidney) cells (Lacinová et al. 1999), tsA-201 cells, a subclone of HEK293, (Peterson et al. 1997; McHugh et al. 2000), cardiac myocytes from rats (Scamps et al. 1990; Tohse et al. 1992; Gomez et al. 1994) and rabbits (Xu et al. 2000), isolated atrial myocytes from failing and non-failing human hearts (Cheng et al. 1996), skeletal muscle myotubes from mice and rabbits, (Johnson et al. 1994), myocytes of guinea pig mesentery artery (Morita et al. 1999), dendrites from rat pyramidal and olfactory bulb neurons (Markram and Sakmann 1994; Stuart and Spruston 1995; Koester and Sakmann 1998; Margie et al. 2001), rat amygdala neurons (Foehring and Srcoggs 1994; Young et al. 2001) were used to study the function of calcium channels. Using the whole-cell variation of the patch-clamp technique, Yang et al. (2000) studied cellular T-type and L-type calcium channel currents in mouse neuroblastoma N1E115 cells. The cells were cultured in Dulbecco’s modified Eagle’s medium containing 10 % fetal bovine serum at 37 °C in a humidified atmosphere of 5%CO2 in air. The medium was changed every 3–4 days. After mechanical agitation, 3 × 104 cells were replanted in 35-mm tissue culture dishes containing 4 ml of bath solution. After cell attachment, the dish was mounted on the stage of an inverted phasecontrast microscope for Ca2+ channel current recording. These cells expressed predominantly T channel currents. In experiments where L channels were specifically sought, the cells were grown and maintained at confluence for 3–4 weeks under the same culture conditions with the addition of 2 % dimethylsulfoxide (Narahash et al. 1987). Three to 5 days before use, the cells were replanted with the same medium. These cells expressed predominantly L channel currents. A small number of these cells also expressed T channel currents. Hence, cells were selected so that at a holding potential of –40 mV, the T channel component was very small and the inward current measured was conducted predominantly by L channels. By using whole-cell and perforated patch-clamp techniques, Wu et al. (2000) showed that mifrabidile, a non-dihydropyridine compound, has an inhibitory effect on both T- and L-type Ca2+ currents in pancreatic β-cells. A.1.1.24.5 Patch Clamp Studies on Chloride Channels PURPOSE AND RATIONALE Cl− channels are a large, ubiquitous and highly diverse group of ion channels involved in many physiological key processes including: regulation of electrical excitability; muscle contraction; secretion; and sensory signal transduction. Cl− channels belong to several distinct families characterized in detail: voltage-gated Cl− channels, the cAMP-regulated channel CFTR (cystic fibrosis transmembrane conductance regulator), ligand-gated Cl− channels that open upon binding to the neurotransmittersGABA or glycine, and Cl− channels that are regulated by the cytosolic Ca2+ concentration (Jentsch and Günther 1997; Frings et al. 2000). Cliff and Frizel (1990) studied the cAMP- and Ca2+-activated secretory Cl− conductances in the Cl− secreting colonic tumor epithelial cell line T84 using the whole-cell voltage-clamp technique. PROCEDURE T84 cells are used 1–3 days after plating on collagencoating coverslips. The cells are maintained at 37 °C. At this temperature, the responsiveness of the cells to secretagogues, particularly to cAMP-dependent agonists, is improved. Increases in Cl− and K+ conductances are the major electrical events during stimulation of Cl− secretion. Accordingly, bath-pipette ion gradients are chosen so that transmembrane Cl− and K+ currents can be monitored independently at clamp voltages equal to the reversal potentials of these ions. The pipette solution is: 115MM KCl, 25 mM N-methyl-D-glucamine (NMDG) glutamate, 0.5 mM EGTA, 0.19 mM CaCl2, 2mMMgCl2, 2mMNa2ATP, 0.05 mM Na3GPT, 5 mM HEPES, pH7.2. The bath solution is: 115 mM NaCl, 40 mM NMDG glutamate, 5mMpotassium glutamate, 2mMMgCl2, 1 mM CaCl2, 5 mM HEPES, pH 7.2. Bath Na+ and Cl− concentrations are reduced by substituting NMDG chloride or sodium glutamate for NaCl. When Na+ and K+ free solutions are used, Na+ and K+ are replaced by NMDG+, andCl− is reduced by replacing Cl− by glutamate. During whole-cell recording, the membrane potential is clamped alternately to three different voltages, each for 500-msec duration. Computer-controlled voltage-clamp protocols are used to generate current-voltage (I-V) relations when the transmembrane currents are relatively stable by stepping the clamp voltage between −100 and +100 mV at 20 mV intervals. Test drugs (e. g., 8-(4-chlorophenylthio) adenosine 3′,5′-cyclic monophosphate, A23187, forskolin, or ionomycin) are solubilized in stock solutions (ethanol of DMSO) and diluted. EVALUATION Instantaneous relations are constructed from currents recorded 6 msec after a voltage step. MODIFICATIONS OF THE METHOD Maertens et al. (2000) used the whole-cell patch-clamp technique to study the effect of an antimalarial drug on the volume-regulated anion channel (VRAC) in cultured bovine pulmonary artery endothelial cells. They also examined the effects on other Cl− channels, i. e., the Ca2+ activated Cl− channel and the cystic fibrosis transmembrane conductance regulator to assess the specificity for VRAC. Pusch et al. (2000) characterized chloride channels belonging to the ClC family. Chiral clofibric acid derivates were tested on the human ClC-1 channel, a skeletal muscle chloride channel, after heterologous expression in Xenopus laevis oocytes by means of two microelectrode voltage clamp recordings. A.1.1.25 Inhibition of Hyperpolarization-Activated Channels ... PURPOSE AND RATIONALE The hyperpolarization-activated cation currents (termed I f, I h, or I q) play a key role in the initiation of cardiac and neuronal pacemaker depolarizations. Unlike most voltage-gated channels, they are activated by hyperpolarizing voltage steps to potentials negative to –60 mV, near the resting potential of most cells. This property earned them the designation of I f for “funny” or I q for “queer.” The funny current, or pacemaker (I f) current, was first described in cardiac pacemaker cells of the mammalian sino-atrial node as a current that slowly activates on hyperpolarization at voltages in the diastolic voltage range, and contributes to the generation of cardiac rhythmic activity and to its control by sympathetic and parasympathetic innervations (DiFrancesco et al. 1986; Accili et al. 1997, 2002; Robinson and Siegelbaum 2003}; Baruscotti et al. 2005). In sino-atrial cells, f-channels are modulated by cAMP independently of phosphorylation, through a mechanism involving direct interaction of cAMP with the intracellular side of the channels (DiFrancesco and Tortora 1991; Bois et al. 1996). A significant advancement in the study of molecular properties of pacemaker channels was achieved when a new family of channels was cloned, the HCN (hyperpolarization-activated, cyclic nucleotide gated) channels (Ishii et al. 1999; Kaupp and Seifert 2001; Biel et al. 2002; Macri et al. 2002). The HCN family is related to the cyclic nucleotide-gated channel and eag potassium channel family and belongs to the superfamily of voltage-gated cation channels. HCN channels are characterized by six membrane-spanning segments (S1–S6) including voltage-sensing (S4) and pore (between S5 and S6) regions. In the C-terminal region they contain a consensus sequence for binding of cyclic nucleotides. In the heart, neurotransmitterinduced control of cardiac rhythm is mediated by I f through its second-messenger cAMP, whose synthesis is stimulated and inhibited by β-adrenoceptor and muscarinic agonists, respectively. Inhibition of the I f channel was recommended for induction of bradycardia and treatment of coronary disease (Thollon et al. 1994, 1997; Simon et al. 1995; Bois et al. 1996; Deplon et al. 1996; Acilli et al. 1997; Rocchetti et al. 1999; Monnet et al. 2001, 2004; Bucchi et al. 2002; Cerbai et al. 2003; Rigg et al. 2003; Vilaine et al. 2003; Albaladejo et al. 2004; Colin et al. 2004; DiFrancesco and Camm 2004; Moreno et al. 2004; Mulder et al. 2004; Vilaine 2004; Chatelier et al. 2005; Leoni et al. 2005; Romanelli et al. 2005; Schipke et al. 2006). Romanelli et al. (2005) reported the design, synthesis and preliminary biological evaluation of zatebradine analogs as potential blockers of hyperpolarization-activated current and Chatelier et al. (2005) described that a calmodulin antagonist directly inhibits f-type current in rabbit sino-atrial cells. PROCEDURE Sino-atrial Cell Isolation Sino-atrial node myocytes of the rabbit were isolated (DiFrancesco et al. 1986). Cells were allowed to settle in Petri dishes, and were superfused with normal Tyrode solution containing (mM): NaCl 140, KCl 5.4, CaCl2 1.8, MgCl2 1, D-glucose 5.5, Hepes–NaOH 5; pH 7.4. Electrophysiology In macro-patch experiments the temperature was kept at 27 °C–28 °C and the patch pipette solution contained (mM): NaCl 70, KCl 70, CaCl2 1.8, MgCl2 1, BaCl2 1, MnCl2 2, Hepes–KOH 5; pH 7.4. The control solution perfusing the intracellular side of the membrane patches contained (mM): potassium aspartate 130, NaCl 10, CaCl2 2, EGTA 5, Hepes–KOH 10; pH 7.2, pCa = 7. In some experiments, the calcium concentration of the bath solution was reduced to 0.1 nM according to the calculation of Fabiato and Fabiato (1979) and the correction of Tsien and Rink (1980). Macro-patches containing hundreds of f-channels were formed using a large-tipped pipette (0.5 to 2MΩ) (DiFrancesco and Tortora 1991). The test compound or calmodulin (Calbiochem) was dissolved in either distilled water and ethanol (50/50) or distilled water, respectively, divided into aliquots, and stored at −20 °C until use. Ethanol was added to control solutions at the same concentration used in test solutions (lower than 0.1 %). EVALUATION The time course of macro-patch I f under the influence of the modifying compounds was recorded by applying hyperpolarizing steps of 3 s duration at a frequency of 1/15Hz. At steady-state, the voltage dependence of I f was described by the equation: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ I_{\rm f} (E) = g_{\rm f} (E) \cdot (E - {\rm vE}_{\rm f} ) = g_{\rm fmax } \cdot {\rm y}_\infty (E) \cdot (E - E_{\rm f} ) $$\end{document} , where g f is the conductance, g fmax the fully activated conductance, y∞ (E) the steady-state activation parameter and E f the reversal potential (DiFrancesco and Noble 1985). Steady-state current/voltage (I/V) curves were measured by applying 1-minlong hyperpolarizing voltage ramps with a rate of −115 mV/min from a holding potential of −35 mV. Conductance–voltage (g f/E) relations were then obtained from the above equation as ratios between steady-state I/V curves (i f/E) and E − E f, where E f was set to −12.24 mV (DiFrancesco and Mangoni 1994). Conductance curves were fitted by Boltzmann function: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ g_{\rm f} (E) = g_{\rm fmax } \cdot y_\infty (E) = g_{\rm fmax } \cdot 1/[1 + \exp (E - E_{1/2} )/p] $$\end{document} where E 1/2 is the half-maximal voltage of activation and p is the inverse-slope factor. This allowed estimation of the shifts of the voltage dependence of conductance (i. e., of the activation parameter y∞) measured as changes in E 1/2. Shifts of the I f activation curve caused by cAMP were also determined by a quicker method not requiring measurement of the conductance–voltage relation (Accili and DiFrancesco 1996). Shifts were obtained by applying hyperpolarizing steps from −35 mV to near the mid-point of the I f activation curve and adjusting the holding potential (−35 mV in the control solution) until the cAMP-induced change in I f was compensated and the control I f magnitude fully restored. Since the compensation involved a change of the test voltage (from E to E + s m, where s m is the measured displacement of the holding potential in mV), a correction was introduced to obtain the shift of the activation curve (s, mV), according to the relation: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ s = s_{\rm m} \cdot [ + (y_\infty /({\rm d}y_\infty /{\rm d}E)]/(E - E_{\rm f} ). $$\end{document} . When comparing different sets of data, statistical analysis was performed with either the Student’s t-test or analysis of variance (ANOVA). Values of P < 0.05 were considered significant. Statistical data were given as mean ± SEM values. A.1.1.26 Measurement of Cytosolic Calcium with Fluorescent Indicators ... PURPOSE AND RATIONALE Intracellular free Ca-concentration can be measured in cultured endothelial cells with a fluorometric methods (Tsien et al. 1982; Grynkiewicz et al. 1985; Lückhoff et al. 1988; Busse and Lamontagne 1991; Hock et al. 1991). PROCEDURE Cultured endothelial cells from the pig are seeded on quartz coverslips and grown to confluence. The cells are loaded with the fluorescent probe indo-1 by incubation with 2 μmol indo-1/AM and 0.025 % Pluronic F-127, a non-ionic detergent. Thereafter, the coverslips are washed and transferred to cuvettes, filled with HEPES buffer. EVALUATION Fluorescence is recorded in a temperature controlled (37 °C) spectrofluorophotometer (excitating wavelength 350 nm, emission wavelength simultaneously measured at 400 and 450 nm). MODIFICATIONS OF THE METHOD Lee et al. (1987) measured cytosolic calcium transients from the beating rabbit heart using indo-1 AM as indicator. Yangisawa et al. (1989) measured intracellular Ca2+ concentrations in coronary arterial smooth muscle of dogs with fura-2. Makujina et al. (1995) measured intracellular calcium by fura-2 fluorescence simultaneously with tension in everted rings of porcine coronary artery denuded of endothelium. Hayashi and Miyata (1994) described the properties of the commonly used fluorescent indicators for intracellular calcium: Fura-2, Indo-1, and Fluo-3. Monteith et al. (1994) studied the Ca2+ pumpmediated efflux in vascular in spontaneously hypertensive rats. A.1.1.27 Measurement of Contractile Force of Isolated Cardiac Myocytes ... PURPOSE AND RATIONALE Eschenhagen et al. (1997) developed a method for culturing embryonic cardiomyocytes in a collagen matrix to produce a coherently contracting 3-dimensional model heart tissue that allows direct measurement of isometric contractile force. PROCEDURE Ventricles from 9–11 day incubated chicken embryos (Cavanaugh 1955) are minced in Dulbecco’s minimal essential medium (DMEM), washed once with 0.25 % trypsin/0.1 % EDTA in phosphate buffered saline (PBS), pH7.45, and then digested in fresh trypsin/EDTA for 15 min at 37 °C. The supernatant is discarded and the pellet is subjected to digestion with 0.1 % collagenase (144U/mg) in PBS, pH7.45, for 30 min at 37 °C. This supernatant is discarded and the pellet digested further with several cycles of collagenase for 10–20 min each until the pellet is completely digested. DNase I (40 μl, 1 mg/ml in PBS) is added between cycles depending on the presence of viscousDNA. The isolated cells are kept in Petri dishes in DMEM supplementedwith 15 % heat-inactivated fetal calf serum in the CO2 incubator. After completion of the digestion, the cells are incubated for another 30–60 min in the CO2 incubator (preplating). The cell suspension is centrifuged at 250 rpm (12 g). The pellet is resuspended in 10 ml culture medium (DMEM, 10 % inactivated horse serum, 2 % chicken embryo extract (Gibco BRL), 2 mmol/l glutamine, 10 μg/ml streptomycin, and 100 U/ml penicillin G, recentrifuged at 250 rpm, and finally resuspended in culture medium at 2–3 × 106 cells per ml. For casting cardiomyocyte-populated collagen gels, strips of Velcro are glued with silicone rubber to glass tubes (13 mm length, 3 mm outer diameter, 2 mm inner diameter). Pairs of Velcro-coated tubes, kept at a fixed distance by a stainless steel wire spacer, are placed in rectangular wells (15 × 17 × 4 mm) cut into a layer of silicone rubber in a 100 mm polymethylenepentene Petri dish. This assembly is autoclaved before use. For each gel, 1 ml of an ice-cold collagen/cell mixture is poured into each well between the Velcro-coated glass tubes. This mixture has the same composition as the culture medium and contains in addition to 1 mg neutralized collagen I from rat tail (Upstate Biotechnology, Inc.), 1 × 106 cardiomyocytes, the acetic acid in the collagen solution, and the NaOH to neutralize it. Themixture is allowed to gel at 37 °C for 60 min before culture medium is added to the dish. Medium changes are performed after overnight and then every other day. After 6–11 days in culture, the gels are removed from the culture dish, the spacers are withdrawn, and one of the glass tubes is mounted on a fixed electrode; the other tube is connected by an inelastic silk string to an isometric force transducer attached to a Wekagraph thermal array recorder (Föhr Instruments, Heidelberg, Germany). The preparation is adjusted to its original (spacer) length before it is immersed in a convential water bath filled with modified Tyrode’s solutionmaintained at 35 °C and continuously gassed with 95 % O2 and 5 % CO2. After a 30–60 min equilibration period without pacing, force and frequency reaches a stable value. Gels are then electrically stimulated with rectangular pulses (10 ms, 20–40 V) at a standard frequency of 1.5Hz. Preload is stepwise adjusted to L max, the length at which the preparation develops maximal force. Cumulative doses of inotropic compounds, e. g. isoprenaline or forskoline, are added. All gels are exposed to a concentration-response curve for calcium (1.8–12.6 mmol/l) and one or two additional inotropic stimuli. EVALUATION All values are presented as arithmetic means ± SEM. Student’s t-test for paired observations is used to compare force of contraction, resting tension, or beating frequency before and after other interventions. MODIFICATIONS OF THE METHOD Ferrara et al. (1997) studied the role of Gi-proteins and β-adrenoceptors in the age-related decline of contraction in guinea-pig ventricular myocytes. The isolated myocytes were placed in Krebs-Henseleit solution in a Perspex chamber on the stage of a Zeiss IM inverted microscope and superfused with Krebs-Henseleit solution containing 1 mmol/l Ca2+ at 2 ml/min and 32 °C. Cells were selected using the following criteria: rod shaped, without sarcolemmal blebs, no spontaneous contractions, stable baseline contraction to electrical stimulation at 0.5Hz and sarcomere length not shorter than 1.67 μm. The image of the cells was displayed on a TV monitor and the length change measured with a video motion detector. Contraction amplitude and velocity was expressed as change in sarcomere length, calculated from the change in length of the myocyte and its original sarcomere length. Using a similar technique, Harding et al. (1988) studied contractile responses of isolated rat and rabbit myocytes to isoproterenol and calcium, and Harding et al. (1992) isolated ventricularmyocytes from failing and non-failing human heart. A.1.1.28 Adrenomedullin A.1.1.28.1 General Considerations Adrenomedullin is a 52-amino acid peptide originally discovered in human adrenal pheochromocytoma by monitoring the elevating activity of platelet cAMP (Kitamura et al. 1993). Molecular cloning of rat adrenomedullin was reported by Sakata et al. (1993). The genomic structure of human adrenomedullin gene was reported by Ishimitsu et al. (1994). Adrenomedullin and proadrenomedullin Nterminal 20 peptide (PAMP) which are both hypotensive and bronchodilating, are derived from preproadrenomedullin (Kanazawa et al. 1995; Iwasaki et al. 1996; Shimosawa and Fujita 1996; Hinson et al. 1998; Samson 1998; Autelitano and Tang 1999; Jimenez et al. 1999; Lopez et al. 1999; Tajima et al. 1999). Adrenomedullin is found ubiquitously in tissues and organs, especially in cardiovascular tissues and in the kidney, lung, brain and endocrine glands (Wimalawansa 1996; Van Rossum et al. 1997; Eto et al. 1999; Jougasaki and Burnett 2000; Kitamuro et al. 2000). The main biological effect is vasodilatation (Ishiyama et al. 1993; Nikitenko et al. 2002). A hypotensive effect has been found in rats (Khan 1997), rabbits (Fukuhara et al. 1995), and man (Lainchbury et al. 1997). Adrenomedullin belongs to the calcitonin gene-related peptide/calcitonin peptide family as it shares approximately 25 % homology with calcitonin gene-related peptide (Kitamura et al. 1993). Several pharmacological studies are related to the vasodilating effect of adrenomedullin, e. g., in mouse aorta (Ashton et al. 2000), in the mesenteric vascular bed (see A.8.2.5), (Santiago et al. 1995), in the hind limb vascular bed (see A.8.2.1), (Santiago et al. 1994; Champion et al. 1996, 1997), in the pulmonary vascular bed (see A.8.2.6), (DeWitt et al. 1994; Lippton et al. 1994; Heaton et al. 1995; Nossaman et al. 1995), on cerebral blood flow in dogs (Baskaya et al. 1995) and in cats (Takao et al. (1999), on renal hemodynamics in dogs (see A.8.2.3) (Ebara et al. 1994; Yukawa 1998), or on vasodilation in perfused rat kidneys (Hayakawa et al. 1999). Intravenous infusion of adrenomedullin exerted diuresis and natriuresis without major changes in blood pressure and produced beneficial hemodynamic and renal vasodilator effects in rats with compensated heart failure (Vari et al. 1996; Nagaya et al. 1999). In isolated perfused, paced rat heart preparations, adrenomedullin showed a dose-dependent inotropic effect (Szokodi et al. 1998). Pulmonary vasodilator responses and vasorelaxant effects in isolated pulmonary artery rings were found by Gumusel et al. (1998). Adrenomedullin is a growth-promoting factor for cultured vascular smooth muscle cells (Iwasaki et al. 1998) and fibroblasts (Isumi et al. 1998). Willenbrock et al. (1999) showed a beneficial effect of adrenomedullin on renal function in rats with aortocaval shunt. Adrenomedullin inhibits gastric secretion in rats with chronic gastric fistula (see J.3.1.3), (Rossowski et al. 1997) and inhibits reserpine-induced gastric lesions in rats (Clementi et al. 1998). Tsuchida et al. (1999) found an inhibition of cholecystokinin-stimulated amylase secretion by adrenomedullin in rat pancreatic acini. Rademaker et al. (2003) discussed the role of adrenomedullin in the pathophysiology of heart failure. Lewis et al. (1998) described a specific and sensitive radioimmunoassay for human adrenomedullin. Ohta et al. (1999) developed an one-step direct assay for adrenomedullin with monoclonal antibodies. N-terminal fragments of adrenomedullin show vasopressor activities (Watanabe et al. 1996). Adrenotensin, an other adrenomedullin gene product, contract in an endothelium-dependent manner pulmonary blood vessels (Gumusel et al. 1996). Receptor Binding of Adrenomedullin ... PURPOSE AND RATIONALE Muff et al. (1995), Poyer (1997) reviewed the binding characteristics of the structurally related hormones calcitonin, calcitonin gene-related peptide, amylin, and adrenomedullin. Vine et al. (1996) compared in vitro binding of adrenomedullin, calcitonin gene-related peptide and amylin. Specific adrenomedullin binding sites were described in human brain (Sone et al. 1997), in the rat spinal cord (Owji et al. 1996), in cultured brain cells (Zimmermann et al. 1996), and in cultured rat mesangial cells (Osajima et al. 1996). PROCEDURE Human brain is obtained at autopsy. For preparation of membranes, tissues are homogenized in ice-cold 50mM HEPES buffer, pH 7.6; containing 0.25M sucrose, 10 μg/ml soybean trypsin inhibitor, 0.5 μg/ml pepstatin, 0.5 μg/ml leupeptin, 0.5 μg/ml antipain, 0.1 mg/ml benzamidine, 0.1 mg/ml bacitracin, and 30 μg/ml aprotinin. The homogenates are centrifuged at 1500 g for 20min at 4°C. The pellets are resuspended in 10 vol of the above buffer without sucrose and centrifuged at 100,000 g for 1 h at 4°C. The final pellets are resuspended to a concentration of 2–10 mg protein/ml, aliquoted, and stored at –80°C. For the receptor binding assay, brain membranes (100 μg protein) are incubated at 4°C in 0.5 ml binding buffer (20 mM HEPES buffer, pH 7.4, containing 5 mM MgCl2, 10 mM NaCl, 4 mM KCl, 1 mM EDTA, and 0.3% BSA) containing 0.3 nM 125I- human adrenomedullin in siliconized microcentrifuge tubes. Pellets are washed with 0.5 ml binding buffer at 4°C and counted in a γ-counter. EVALUATION Nonspecific binding is determined in the presence of 200 nM unlabeled human adrenomedullin. Specific binding is defined as total binding minus nonspecific binding. Data are calculated as mean ± SEM. MODIFICATIONS OF THE METHOD Eguchi et al. (1994) studied the binding of human adrenomedullin and analogs and the adenylate cyclase activity in cultured rat vascular smooth muscle cells. Zimmermann et al. (1995) showed that adrenomedullin and calcitonin gene-related peptide interact with the same receptor in cultured human neuroblastoma SK-N-MC cells. Moody et al. (1997) investigated the binding affinity of adrenomedullin in C6 glioma cells. Findings of Belloni et al. (1998) suggested the existence of different receptor subtypes for adrenomedullin in the human adrenal cortex. Mazzocchi et al. (1999) found abundant [125I]-adrenomedullin binding sites in both zona glomerulosa and adrenal medulla in the rat adrenal gland. A.1.1.29 Atrial Natriuretic Factor (ANF) A.1.1.29.1 General Considerations PURPOSE AND RATIONALE The atria of mammalian hearts synthesize and secrete peptides with potent natriuretic and vasoactive properties known as ANF = atrial natriuretic factor (de Bold et al. 1981). The atrial natriuretic peptide hormonal system consists of a 126-amino acids prohormone synthesized within myocytes of the heart and stored in storage granules within the heart before release into circulation (Kangawa and Matsuo 1984; Oikawa et al. 1984; Vesely 1992). This hormonal system contains several peptides from the 126-amino acid-prohormone with blood pressure lowering, natriuretic, diuretic and/or kaliuretic properties (Martin et al. 1990; Vesely et al. 1994). Thus, peptides consisting of amino acid 1 to 30 (LANP = long-acting natriuretic peptide), 31 to 67 (vessel dilator), 79 to 98 (kaliuretic peptide) and 99 to 126 (ANF) each have blood pressure lowering, natriuretic, diuretic and/or kaliuretic properties both in humans and in animals. Human and rat atria predominantly secrete a peptide of 28 amino acid residues, ANF-(99–126), which represents the Cterminus of a precursor sequence of 126 amino acid residues. In addition, vessel dilator and LANP circulate as distinct entities after having been proteolytically cleaved from the rest of the amino terminus by proteases (Ackerman et al. 1997). Plasma immunoreactive ANF-(99–126) concentration increases in normal rats after volume expansion, while infusion of the peptide lowers blood pressure in several animal models of hypertension. An international standard for atrial natriuretic factor was established by an international collaborative study (Poole et al. 1988). Human ANF-(99–126) was synthesized, highly purified and distributed to several laboratories, who performed radioimmunoassays, radioreceptor assays and an in vitro assay using the vasorelaxant activity in precontracted rat aortic strips. The C-type natriuretic peptide is a 22-amino acid peptide that was initially identified in the central nervous system (Ogawa et al. 1992;Barr et al. 1996;Amin et al. 1996). The distribution of C-type natriuretic peptide, which has structural homology with atrial and brain natriuretic peptides and also similar activities, is wide and includes the endothelium, myocardium, gastrointestinal and genitourinary tracts. Brain natriuretic peptide has been described as a novel cardiac hormone (Nakao et al. 1991). Yasue et al. (1994) studied the localization and mechanism of secretion of B-type natriuretic peptide in comparison with those of A-type natriuretic peptide in normal subjects and patients with heart failure. N-terminal pro-brain natriuretic peptide became a diagnostic screening tool to differentiate between patients with normal and left ventricular systolic function (Bay et al. 2003; Gardner et al. 2003). Jiao and Baertschi (1993) reviewed the neural control of the endocrine rat heart. Stimulation of cardiac sympathetic nerves potently stimulates ANF secretion. ANF inhibits proliferation in non-myocardial cells and is anti-hypertrophic in cardiomyocytes. Silberbach et al. (1999) reported that activation of an extracellular signal-regulated protein kinase is required for the antihypertrophic effect of atrial natriuretic factor in neonatal rat ventricular myocytes. A.1.1.29.2 Bioassay for ANF PURPOSE AND RATIONALE Matsui et al. (1987) described a rapid bioassay for quantification of atrial natriuretic polypeptides in rats with continuous recording of the conductivity of the urine, urine flow and blood pressure. PROCEDURE Male Sprague Dawley rats weighing 180–240 g are anesthetized with 60 mg/kg i.p. pentobarbital sodium. Anesthesia is maintained by injection of supplemental doses of pentobarbital sodium. After tracheotomy, catheters are placed into the left jugular vein and the right carotid artery for injection of samples or infusion of 10 % mannitol in 0.9 % saline and for blood pressure recording. Through a small suprapubic incision the bladder is cannulated for collection of urine, and the cannula is connected to a device for continuous measurement of urine conductivity, by which the electrolyte concentration is estimated. Urine flow rate is recorded using a drop counter, and urine samples are collected in a plastic tube. After completion of surgery, 0.6–0.8 ml of 10 % mannitol in 0.9 % saline is administered into the jugular vein and is continuously infused at a rate of 4.0 ml/h by a syringe pump. Following an equilibration of 45–60 min, the bioassay is started when the urine flow is increased to 50–75 μl/min. All test samples with a volume of 100 μl are directly injected into the jugular vein followed by a wash injection of `30 μl of saline. Mean arterial blood pressure, urine conductivity, and urine flow rate are simultaneously recorded. For dose–response curves, serial dilutions of human ANF (α-hANP) and of test substance are prepared. Vehicle and various doses of α-hANP or test substance are injected in a randomized sequence. Immediately after the injection, urine is collected for 10 min. Urine volumes are determined by weighing, and urinary sodium and potassium concentrations are measured by flame photometry. EVALUATION Linear-regression analyses by the method of least squares are used for evaluating dose–response relationship. One-way analysis of variance for repeated measures and the Newman-Keuls test are used to detectstatistical differences. MODIFICATIONS OF THE METHOD Petersen et al. (1988) determined atrial content and plasma levels of atrial natriuretic peptides in rats with chronic renal failure. The natriuretic activity in the bioassay was estimated as the increase in Na excretion in urine samples from the control period to the maximal natriuretic response. Allen and Gellai (1987) measured cardioinhibitory effects of atrial peptide in conscious chronically instrumented rats. The hemodynamic and renal excretory responses were measured with and without replacement of urinary fluid losses. Thibault et al. (1984) characterized the biological activities of atrial natriuretic factor-related peptides in vivo by a natriuretic bioassay and in vitro by relaxation of contracted intestinal smooth muscle (chick rectum). Schiller et al. (1986) tested synthetic analogs of atrial natriuretic peptide in the rabbit aorta assay and in a bioassay monitoring suppression of aldosterone secretion from bovine zona glomerulosa cells. Dlouha and McBroom (1986) measured diuretic and natriuretic activity of atrial extracts of taurinetreated normal and cardiomyopathic hamsters by urine flow and Na + excretion in the rat bioassay. St.-Louis and Schiffrin (1988) measured vasorelaxant effects of different atrial natriuretic peptides on rat aortic andmesenteric artery rings and compared the results with the potency of the same peptides to displace 125I-labeled ANP on membrane preparations of aorta and of mesenteric vein bed. Kohse et al. (1992) described a bioassay for quantitative determination of natriuretic peptides in human biological samples using bovine aortic and bovine kidney epithelial cultured cells. The amount of cyclic AMP produced by these cells was measured by radioimmunoassay. Kecskemeti et al. (1996) studied the effects of atrial natriuretic peptide (ANP) on action potential characteristics in various (human, rabbit, guinea-pig) atrial and guinea pig ventricular papillary muscles. The data suggested that ANP inhibits the slow inward Ca2+ channel activity and facilitates the K+ channel activity. Salt-sensitive hypertension was found in ANP knockout mice (Melo et al. 1998). A.1.1.29.3 Receptor Binding of ANF PURPOSE AND RATIONALE Schiffrin et al. (1985) described receptors for atrial natriuretic factor in the rat. PROCEDURE Synthetic ANF-(99–126) is iodinated with 125I by a modification (Gutskowska et al. 1984) of the chloramine T method (Greenwood and Hunter 1963). Separation of radiolabeled ANF from free iodine is achieved by immunoaffinity chromatography followed by C-18 reverse phase high pressure liquid chromatography. For preparation of membranes, Sprague Dawley rats weighing 300 g are sacrificed by decapitation. The atria, ventricles, renal arteries, mesentery, the mesentery vascular bed, and adrenals are processed for binding studies. Adrenal capsules are separated by manual compression. The tissues are immersed in 0.25 M sucrose solution, finely minced with scissors, and homogenized in a Polytron (setting 8, 10 s twice). The homogenate is centrifuged at 1550 g for 10 min at 4 °C; the supernatant is decanted and recentrifuged. The final supernatant is filtered through a cheesecloth, then centrifuged at 10,400 g for 30 min. The pellet is resuspended in a 0.05MTris-HCl buffer, pH 7.4, containing 120 mM NaCl, 5 mM MgCl2, 0.5 mM phenyl methyl sulfonyl fluoride, 0.1 % bacitracin, and 1 μM aprotinin. Proteins are measured by the Coomassie blue method (Spector 1978). Next, bovine serum is added at a concentration of 0.2 %, and the membranes are diluted to a protein concentration of 0.25 to 1 mg/ml in the Trisbuffer containing 0.2 % albumin. The 125I-AFN binding assay uses 30–50pM of labeled ANF and 10–13 to 10–6 unlabeled ANF in competition experiments. In saturation experiments, increasing concentrations of 125I-AFN (6–200pM) are used, and nonspecific binding is determined by incubation in the presence of 1 μM unlabeled ANF for each point of the saturation curves. Incubation is done with 25–100 μg of receptor protein per tube, at 4 °C for 60 min. All assays are performed in duplicate. Separation of bound and free radioactivity is achieved by rapid filtration through polyethylenimine-treated Whatman GF/C filters soaked with the assay buffer. The filters are washed twice with 3 ml of 0.9 % NaCl, then are allowed to dry and are counted in a gamma counter. EVALUATION Binding data are analyzed by computer assisted nonlinear regression analysis using the LIGAND program (Munson and Rodbard 1980). The inhibition constantK i is calculated according the Cheng and Prussoff equation. MODIFICATIONS OF THE METHOD Misono (2000) found that the binding of atrial natriuretic factor to its receptor is dependent on chloride concentration. A.1.1.29.4 ANF Gene Expression PURPOSE AND RATIONALE Production of atrial natriuretic factor and brain natriuretic peptide can be measured by gene expression using total RNA extraction and Northern blot analysis and the quantitative competitive reverse transcription polymerase chain reaction (Hama et al. 1995; Ogawa et al. 1996, 1997, 1998, 1999). PROCEDURE Extraction of Plasma and Tissue Samples Plasma samples are acidified by adding 100 μl/ml of 1 mol/l HCl and passed through Sep-Pak C18 cartridges (Millipore) that are pre-wetted with 5 ml of 80 % acetonitrile in 0.1 % trifluoroacetic acid (TFA) and 10 ml of 0.1 % TFA. The cartridges with the absorbed peptides are washed with 20 ml of 0.1 % TFA and eluted with 3 ml of 60 % acetonitrile in 0.1 % TFA. Tissue samples are homogenized in 10 vol of an extracting mixture consisting of 0.1 N HCl, 1.0 mol/l acetic acid, and 1 % NaCl and centrifuged at 10,000 g for 30 min at 4 °C. The supernatants are then extracted with the use of Sep-Pak C18 cartridges by elution with 80 % acetonitrile in 0.1 % TFA. The eluates from tissue or plasma are freeze-dried and processed for RIA. Total RNA Extraction and Northern Blot Analysis Atrial and ventricular tissue samples from individual rats are extracted using Trizol (GIBCO BRL). Total RNA from the atrium (10 μg) and ventricle (20 μg) are electrophoretically separated in an agarose-formaldehyde gel followed by blotting to nylon membranes (Hybond N+, Amersham) overnight. Membranes are prehybridized in 2.5 × Denhardt’s solution, 5 × SSC, 50 % formamide, 25 mmol/l KH2PO4, pH6.4, 0.2 % SDS, and 0.2 mg/mL herring sssDNA for 3 h at 42 °C for cDNA probes, or prehybridized in 5 × Denhardt’s solution, 6 × SSC, 50 mmol/l NaH2PO4, 0.5 % SDS, and 0.2 mg/ml herring sssDNA for 3 h at 5 °C below the calculated T m for oligonucleotide probes. Hybridization is then carried out for 16 h at the same temperature and the same solution as the prehybridization condition except for the presence of the radiolabeled probes. Five cDNA probes and two oligonucleotide probes are used. The cDNA probes used are as follows: (1) a 900- bp EcoRI/HindIII fragment containing the full-length rat ANF cDNA, (2) a 595-bp SalI fragment containing full-length rat BNP cDNA, (3) a 5-kb EcoRI/SalI fragment of the mouse 28S rRNA cDNA probe, (4) a 2-kb BamHI/BglII fragment of the mouse PGK gene cDNA, and (5) rat α 1-III collagen cDNA containing 1300 bp of the 3′ noncoding and coding regions. The two oligonucleotide probes are 39 and 24 base fragments specific for unique regions in the 3′ untranslated regions of the rat α-MHC and β-MHC genes. The α-sequence is 5′GGGATAGCAACAGCGAGGCTCT TTCTGCTGGACAGGTTA-3′(T m = 60 °C),and the β-sequence is 5′-CTCCAGGTCTCAGGGCTTCACAGG-3′ (T m = 52 °C). The cDNAs are labeled with 5′-[α 32P]dCTP (3000 Ci/mmol, Amersham) using the Megaprime DNA labeling system (Amersham). The oligonucleotides are labeled with [γ -32P]ATP (3000 Ci/mmol, Amersham) using a 5′-end-labeling kit (Amersham). At the end of hybridization, themembranes are washed twice at 42 °C with 2 × SSC and 1 % SDS and twice at 55 °C with 1 × SSC and 0.1 % SDS for the cDNA probes or are washed once at 30 °C with 5 × SSC and 0.1 % SDS and twice at the sa.me temperature as the hybridization with 1 × SSC and 0.1 % SDS for the oligonucleotide probes. Before additional probing, bound counts are completely stripped from the membranes by washing twice in 10 mmol/l sodium citrate, pH 6.8, 0.25 % SDS for 10 min at 100 °C. Autoradiographs are scanned with an Ultrascan XL laser densitometer (LKB Produckter) and LKB 2400 Gelscan XL software package. The scanning values of ANF, BNP, collagen-III, and α-MHC and β-MHC mRNAs are normalized to 28S ribosomal RNA or PGK mRNA as internal controls to correct for differences in the amount of RNA applied and transfer efficiency. Plasma and cardiac tissue concentrations of immunoreactive ANF and BNP are determined by RIA with anti-rat ANF99–126 and anti-rat BNP64–95 sera, respectively, from Peninsula Laboratories. Quantitative competitive reverse transcription polymerase chain reaction RNA samples are reverse transcribed with Super Script II RNase H 2 Reverse Transcriptase and oligo(dT)12–18 primer with the use of a reverse transcription kit (GIBCO BRL). An aliquot of the cDNA product is used for PCR amplification with ANF primers. A dilution series of total RNA (5 mg) aliquots is prepared for each sample. Each dilution is spiked with competitor RNA. After the PCR, aliquots (5 ml) of the PCR product are electrophoresed on a 2 % agarose gel and visualized by ethidium bromide staining. Photographs are taken with Polaroid 55 film, and the negatives are scanned with the use of an Ultrascan XL laser densitometer and Gelscan XL 2000 software package. The ratio of the density of the competitor RNA to the target RNA is plotted against the amount of the competitor RNA added to each reaction. EVALUATION All results are expressed as mean ± SEM. A level of P < 0.5 is considered significant. ANOVA is performed to determine statistical differences among multiple groups. When significance is obtained by ANOVA, Fisher’s least squares difference post hoc analysis is used to determine pairwise differences. MODIFICATIONS OF THE METHOD Ramirez et al. (1997) reported that the nuclear δ B isoform of Ca2+/calmodulin-dependent protein kinase II regulates atrial natriuretic gene expression in cultured neonatal rat ventricular myocytes. Thuerauf et al. (1998) found that the p38 mitogenactivated protein kinase mediates the transcriptional induction of the atrial natriuretic factor gene through a serum response element and discussed the potential role for the transcription factor ATF6. Kakita et al. (1999) studied p300 protein as a coactivator of the transcription factor GATA-5 in the transcription of cardiac-restricted atrial natriuretic factor gene. Bianciotti and de Bold (2000) investigated the effect of selective ETA receptor blockade on natriuretic peptide gene expression in DOCA-salt hypertension in rats. A.1.1.29.5 Radioimmunoassay for ANF PURPOSE AND RATIONALE Gutkowska et al. (1984) developed a direct radioimmunoassay of atrial natriuretic factor (ANF) method uses a synthetic 26-amino-acid fragment (8–33ANF) of the native peptide. PROCEDURE Because 8–33 ANF is a small molecule, it is necessary to covalently conjugate the peptide to a larger protein (bovine thyroglobulin) for immunization. To 50 mg thyroglobulin dissolved in 2 ml distilled water, pH 7.4, 30 mg CDI [1-ethyl-3-(3-dimethylaminopropyl) carbodiimide HCl] is added in 1 ml distilled water, pH 7.4. Then 5 mg 8–33 ANF in water is added dropwise while stirring. The solution is kept overnight at 4 °C, then another 30 mg CDI is added and the mixture is kept for 2 h at room temperature with constant stirring. The cloudy mixture is dialyzed for 24 h at 4 °C against 0.9 % saline. The dialyzed material is then fractionated and stored at −70 °C. For immunization, 100 μg of the ANF-thyroglobulin complex are suspended in 1 ml saline, thoroughly mixed with 1 ml complete Freund’s adjuvant and injected into the shaved backs of New Zealand white rabbits. Each animal receives also 0.5 ml Bordetella pertussis vaccine subcutaneously with the primary immunization. The animals are reimmunized at monthly intervals with 100 μg of antigen in incomplete Freund’s adjuvant and bled by ear artery 10 days after the booster injection. For iodination, 5 μg ANF in 5 μl 0.01 M ammonium acetate, pH 5.0 is introduced in a 1.5 ml Eppendorf vial followed by the addition of 1 mCi Na 125I in a volume of 25 μl. Chloramine T 10 μg/10 μl is added to the reaction vial and 30 s later sodium metabisulfide (20 μg/10 μl) is added. Each addition is followed by mixing. Purification of the iodinated tracer is achieved by HPLC on a μBondapax C18 column, eluted with a linear gradient of 20 to 50 % acetonitrile with 0.1 % trifluoroacetic acid with a slope of 0.5 %/min and a flow rate of 1 ml/ min.\ The radioimmunoassay procedure is performed in polystyrene tubes at 4 °C by mixing 100 μl of standard or sample, 100 μl of antiserum diluted 1:4000, 100 μl of 125I-ANF and 300 μl of the same buffer containing 1 % BSA. After incubation for 24 h at 4 °C the free from antigen-bound 125I-ANF is separated by dextrancoated charcoal. One ml of dextran-charcoal suspension is added to each tube. After 5 s agitation the tubes are centrifuged at 4000 rpm at 4 °C for 10 min. The supernatant is decanted and the radioactivity counted in a gamma counter. EVALUATION Dose–response curves are prepared and Scatchard analysis is performed. MODIFICATIONS OF THE METHOD Radioimmunoassays were also developed for longacting natriuretic peptide and vessel dilator (Vesely et al. 1994;Winters et al. 1989). A.1.1.30 Urotensin II A.1.1.30.1 General Considerations PURPOSE AND RATIONALE Urotensin II is a cyclic peptide originally isolated from the urophysis, the hormone storage-secretion organ of the caudal neurosecretory system of teleost fishes, such as Gillichthys mirabilis (Pearson et al. 1980; Maguire and Davenport 2002). Several structural forms of urotensin II have been reported in different species (Grieco et al. 2004). These peptides show smooth muscle contracting activity. Itoh et al. (1987) reported contraction of major artery segments of rat, especially of the thoracic aorta, by urotensin II. Human urotensin II is an 11-amino-acid peptide that retains the cyclic portion typical of fish urotensin II. It has been found in vascular and cardiac tissues and is a very potent constrictor of certain human isolated arteries and veins as well as of several vessels of other species (Douglas et al. 2000; Douglas 2003). The potency of urotensin II as a vasoconstrictor is an order of magnitude greater than that of endethelin- 1, making human urotensin II the most potent vasoconstrictor identified so far. Human urotensin II is also a potent endothelium-dependent relaxant in rat precontracted arteries (Katano et al. 2000) and in human small pulmonary and systemic abdominal resistance arteries (Stirrat et al. 2001). Bottrill et al. (2000) found that human urotensin II contracted endothelium-intact rat isolated left anterior descending coronary arteries. The contractile response was significantly enhanced by removal of the endothelium. However, human urotensin II caused concentration- dependent relaxation of 5-HT-precontracted arteries, which was abolished by N-nitro-L-argininemethyl ester (L-NAME) or removal of the endothelium. Using merino ewes as experimental animals, Watson et al. (2003) found that urotensin II acts centrally to increase epinephrine and adrenocorticotrophic hormone (ACTH) release and causes potent inotropic and chronotropic actions. Coy et al. (2002) investigated structural requirements at the N-terminus of urotensin II octapeptides. Carotenuto et al. (2004) investigated the active conformation of urotensin II by CD spectroscopy and NMR analysis in SDS micelles. Watson and May (2004) reviewed the role of urotensin II in central and peripheral cardiovascular control. A.1.1.30.2 Rat Thoracic Aorta Bioassay for Urotensin II PURPOSE AND RATIONALE Most studies on urotensin analogs, agonists and antagonists used the isolated thoracic aorta of rats as a pharmacological model (Itoh et al. 1988; Nothacker et al. 1999; Sauzeau et al. 2001; Camarda et al. 2002a; Grieco et al. 2002a, 2002b; Rossowski et al. 2002). Several urotensin II antagonists have been tested in this model (Behm et al. 2002; Herold et al. 2003). Patacchine et al. (2003) tested urantide, an ultrapotent urotensin II antagonist peptide, in the rat aorta. PROCEDURE Male albino rats (Wistar strain, 275–350 g) are decapitated under ether anesthesia. The thoracic aorta is cleared of surrounding tissue and excised from the aortic arch to the diaphragm. From each vessel, a helically cut strip is prepared, and then it is cut into two parallel strips. The endothelium is removed by gently rubbing the vessel intimal surface with a cotton-tip applicator; the effectiveness of this maneuver is assessed by the loss of relaxation response to acetylcholine (1 μM) in preparations precontracted with noradrenaline (1 μM). All preparations are placed in 5 ml organ baths filled with oxygenated normal Krebs–Henseleit solution. Motor activity of the strips is recorded isotonically (load 5 mN). A cumulative concentration–response curve to hU-II is constructed on one of the two strips, which serves as control. The other strip receives the antagonist peptide under examination and, after a 30-min incubation period, hU-II is administered cumulatively. Maximal contractile responses of preparations to hU-II are obtained by administration of KCl (80 mM) at the end of the cumulative curves. EVALUATION Antagonist activity is expressed in terms of pK B (negative logarithm of the antagonist dissociation constant) and, assuming a slope of −1.0, is estimated as the mean 154 Chapter A · Cardiovascular Activity of the individual values obtained with the equation: pK B = log[dose ratio–1]–log[antagonist concentration] (Kenakin 1997). Competitive antagonism is checked by the Schild plot method: a plot with linear regression line and slope not significantly different from unity i considered as proof of simple reversible competition (Kenakin 1997). MODIFICATIONS OF THE METHOD Gibson et al. (1988) studied the influence of urotensin II on calcium flux in rat aorta. Urotensin II caused an increase in uptake of 45Ca by segments of rat aorta. This increase was abolished by calcium channel blocking drugs. Douglas et al. (2000) found differential vasoconstrictor activity of human urotensin II in vascular tissue isolated from the rat, mouse, dog, pig, marmoset and cynomolgus monkey depending on species and anatomical localization. Camarda et al. (2002b) studied the effects of human urotensin II in isolated vessels (aorta, large arteries, veins) of various species (rats, guinea pigs, rabbits, pigs, human) and compared them with other vasoactive agents (noradrenaline, angiotensin II, endothelin I). Watanabe et al. (2001) found a synergistic effect ofurotensin II with serotonin on rabbit vascular smooth muscle cell proliferation. Tamura et al. (2003) examined the effects of urotensin II on activation of extracellular signal-regulated kinase and focal adhesion kinase in cultured vascular smooth muscle cells. Tzanidis et al. (2003) studied direct actions of urotensin II on the heart in a rat model of heart failure after myocardial infarction and the implications for cardiac fibrosis and hypertrophy. Matsushita et al. (2003) showed that urotensin II is an autocrine/paracrine growth factor for the porcine renal epithelial cell line LLCPK1. Behm et al. (2004) investigated the role of urotensin II in the etiology of essential hypertension. Intravenous injection in anesthetized cats induced an increase in systemic blood pressure and peripheral vascular resistance. A.1.1.30.3 Intracellular Calcium Mobilization Assay PURPOSE AND RATIONALE Human urotensin II induces concentration-dependent increases in intracellular calcium in HEK-293 cells expressing human GPR14 (Ames et al. 1999). Herold et al. (2003) used this assay to test a synthetic antagonist at human and rat urotensin II receptors. PROCEDURE Cell Culture HEK293 cells stably expressing the hUT or rUT receptors are generated and propagated as described previously (Ames et al. 1999). Intracellular Calcium (Ca2+ i) Mobilization Assay hUT-HEK293 cells or rUT-HEK293 cells are seeded in blackwalled, clear-bottomed 96-well Biocoat plates (Beckton-Dickinson, Bedford, Mass., USA, Herold et al. 2004) at a density of 45,000 cells/well, grown in the incubator at 37 °C for 18–24 h, and prepared for Ca2+ i measurements (Ames et al. 1999). Plates are placed into the Fluorometric Imaging Plate Reader (Molecular Devices, Sunnyvale, Calif., USA) where cells, loaded with Fluo 3 (Molecular Probes, Eugene, Ore., USA), are exposed to excitation (488 nm) from a 6-W argon laser. Fluorescence is monitored at 566 nm emission for all 96 wells simultaneously, and data are read every 1 s for 1 min and then every 3 s thereafter. Agonist is added after 10 s and concentration–response curves are obtained by calculating the maximal fluorescence counts above background after the addition of each concentration of agonist. For antagonist studies, BIM-23127 (Bachem, King of Prussia, Pa., USA) is added 10 min prior to the addition of hU-II (California Peptide Research, Napa, Calif., USA). EVALUATION Concentration–response curves are analyzed by nonlinear regression using GraphPad Prism 3.0 software (GraphPad, San Diego, Calif., USA). MODIFICATIONS OF THE METHOD Flohr et al. (2002) performed structure–activity relationship studies on urotensin II by investigating peptide analogs and their ability to mobilize calcium in GPR14-transfected CHO cells. Camarda et al. (2002) evaluated a new ligand for the urotensin II receptor ([Orn8]U-II) in calcium functional assays performed on HEK293 cells expressing the recombinant rat and human UT receptor. Croston et al. (2002) used a functional mammalian cell-based R-SAT assay (ACADIA Pharmaceuticals, San Diego, Calif., USA) to identify non-peptide agonists of the CRP14/urotensin II receptor in highthroughput screening. According to Shapiro et al. (2002) NIH-3 T3 cells were grown in 96-well tissue culture plates to 70 %–80 % confluence in Dulbecco’s modified Eagle’s medium supplemented with 10 % calf serum and 1 % penicillin/streptomycin/Gln. Cells were transfected for 12–16 h with plasmid DNAs using Superfect Reagent (Qiagen, Valencia, Calif., USA) according to the manufacturer’s protocols. RSATs were performed with 0.5–50 ng/well receptor and 20 ng/well β-galactosidase plasmid DNA. After overnight transfection, medium was replaced with serum-free Dulbecco’s modified Eagle’s medium containing 2 % cyto-sf3 (Kemp Biotechnologies, Frederick, Md., USA) and 1 % penicillin/streptomycin/Gln and varying concentrations of drug. Cells were grown in a humidified atmosphere with 5 % ambient CO2 for 4–6 days. Medium was removed from the plates, and β-galactosidase activity was measured by the addition of o-nitrophenyl β-D-galactopyranoside (in phosphate-buffered saline with 5 % Nonidet P-40 detergent). The resulting colorimetric reaction was measured using a spectrophotometric plate reader (Titertek, Huntsville, Ala., USA) at 420 nM. For HTS, NIH-3 T3 cells transiently transfected with the urotensin II receptor expression vector and plasmid were frozen and for the assay thawed, plated and exposed to drug. A.1.1.30.4 Receptor Binding of Urotensin II PURPOSE AND RATIONALE The G-protein-coupled receptor GPR14/SENR was described by Marchese et al. (1995) and Tal et al. (1995). Liu et al. (1999) and Mori et al. (1999) identified urotensin II as the endogenous ligand for the orphan G-protein-coupled receptor GPR14. It was renamed as urotensin II (UT) receptor by UPHAR (Douglas and Ohlstein 2000). Human, rat, mouse and monkey receptors have been cloned. The amino acid sequence identity of the monkey UT receptor is 97 % and 77 % identical to the human and rat sequences respectively, while the mouse UT receptor is 76 % and 93 % identical to the human and rat sequences, respectively Brkovic et al. (2003) performed functional andbinding characterizations of urotensin-II-related peptidesin human and rat urotensin II receptor assays. PROCEDURE Reagents and Solvents The following fluorenylmethyloxycarbonyl-protected amino acids were purchased from Chem-Impex International (Wood Dale, Ill., USA): Ala, Cys(Trt), His(Trt), Phe, Trp, Lys-(Boc), Tyr(tBu), Asp(OtBu), Glu(OtBu), Pro, Gln(Trt), Thr(tBu), Arg(Pbf), Orn(Boc), HomoCys(Trt), Cys(Acm), and D-Trp. Biograde TFA was obtained from Halocarbon (River Edge, N.J., USA). Diisopropylethylamine was from Aldrich (Milwaukee,Wis., USA).Wang resin and benzotriazol- 1-yl-oxy-tris(dimethylamino)-phosphonium hexafluorophosphate were purchased from Albatross (Montreal, QC). Basal ISCOVE medium and fetal calf serum (FCS) were from Biochrom (Berlin, Germany). The GC-melt PCR kit as well as the human and rat genomic DNA were purchased from CLONTECH (Palo Alto, Calif., USA). The pEAK8 mammalian episomal expression vector and the selection marker puromycin were from Edge Biosystems (Gaithersburg, Md., USA). Dulbecco’s modified Eagle’s medium (DMEM), L-glutamine, HEPES, LipofectAMINE reagent, and penicillin- streptomycin were from Invitrogen (Carlsbad, Calif., USA). The pCDNA3.1(+) mammalian expression vector was from Invitrogen. The calcium-sensitive fluorescence dye Fluo-4 and Pluronic F-127 were obtained from Molecular Probes (Eugene, Ore., USA). Flashplates PLUS and monoiodinated human [125I-Tyr9]urotensin II for radioligand binding assays were from Perkin Elmer Life Sciences (Boston, Mass., USA). Gentamicin, the transfection reagent FuGene 6, and Complete protease inhibitor were purchased from Roche (Basel, Switzerland). Bacitracin, EDTAdisodium salt, probenecid, MgCl2, NaCl, and sucrose were obtained from Sigma-Aldrich (St. Louis, Mo., USA). Cloning of Human and Rat Urotensin II Receptor As the putative human urotensin II receptor sequence is intronless, this protein was cloned from human genomi DNA via PCR. PCR conditions, established to amplify the human GPR14 sequence, were 94 °C; 10 min followed by 35 cycles of 94 °C, 1 min, 60 °C, 1 min, 72 °C, and 2 min using the GC-melt kit. Primers designed to amplify the coding sequence contained a BamHI site in the forward and a XbaI site in the reverse primer, respectively. The urotensin receptor coding region, flanked by BamHI/XbaI sites, was cloned into the pCDNA3.1(+) mammalian expression vector and sequenced in both directions. For generation of stable cell lines, the human U-II receptor coding sequence flanked by a 5_EcoRI site and a 3_EcoRV site was cloned into the mammalian episomal expression vector pEAK8. The rat U-II receptor coding sequence flanked by a 5΄ EcoRI and 3΄ NotI site was amplified via PCR from rat kidney cDNA and cloned into the mammalian pEAK8 expression vector. Sequences of all urotensin-II-receptor-expressing plasmids were verified by dideoxy sequencing in both directions. Cell Culture and Transfection CHO K1-cells were grown in basal ISCOVE medium supplemented with 10 % FCS, 2 mM L-glutamine, penicillin-streptomycin (10,000 IU/ml – 10,000 μg/ml), and 25 mg/ml gentamicin at 37 °C in a humidified 5 % CO2 incubator. Cells were transiently transfected with the U-II receptor cDNAs using the LipofectAMINE reagent according to the manufacturer’s protocol. After 18–24 h following the transfection, cells were split into blackwalled 96-well plates at a density of 50,000 cells/well and cultured for an additional 18- to 24-h period before being used in the functional fluorescence imaging plate reader (FLIPR) assay (described below in detail) measuring intracellular Ca2+ release upon receptor activation. FLIPR ASSAY Cells were loaded in 96-well plates for 1 h (37 °C, 5 % CO2) with 100 μl of PBS (without Ca2+, Mg2+ and NaHCO3) containing 4 μM of the fluorescent calcium indicator Fluo-4, 0.22 % Pluronic F-127 in dimethyl sulfoxide, 2.5 mM probenecid, 1 mM EGTA, and 1 % FCS. Cells were then washed three times with PBS (without Ca2+, Mg2+ and NaHCO3) containing 1 mM EDTA, 0.5 mM MgCl2, and 2.5 mM probenecid. After the final wash, a 100-μl residual volume remained on the cells. Peptides were aliquoted as 2 × solutions in 96-well plates and transferred by the instrument from the ligand plate to the cell plate. Fluorescence was recorded with the fluorometric imaging plate reader FLIPR (Molecular Devices, Sunnyvale, Calif., USA) over a period of 3 min. Fluorescence was recorded simultaneously in all wells at 3-s intervals during the first minute and at 10-s intervals during the last 2 min. Fluorescence data were generated in duplicate and repeated at least three times. Generation of Stable Human and Rat U-II Receptor Expressing Cell Lines For the generation of stable cell lines expressing the human and rat urotensin II receptor, HEK293 cells were transfected with human- and rat-pEAK8 constructs using the FuGene 6 transfection reagent according to the supplier’s protocol. Two days after transfection, cells were selected in DMEM, supplemented with 10 % FCS, 20 mM HEPES, penicillin-streptomycin (10,000 IU/ml – 10,000 μg/ml), and 1 μg/ml puromycin for a period of 4 weeks (37 °C, 5 % CO2, 95 % relative humidity). Functional activity of the urotensin-II-receptor-expressing cell population was verified with a FLIPR assay recording urotensin- II-mediated intracellular Ca2+ release, as described above. Membrane Preparation and Radioligand Binding Assays HEK293 cells stably expressing human or rat urotensin II receptors were cultured up to 80 % confluency in DMEM, supplemented with 10 % FCS, 20 Mm HEPES, penicillin-streptomycin (10,000 IU/ml – 10,000 μg/ml), and 1 μg/ml puromycin (37 °C, 5 % CO2, 95 % relative humidity). Cells were washed once with ice-cold PBS and a second time with PBS containing the protease inhibitor cocktail (Complete). Cells were scraped off and centrifuged gently. The pellet was resuspended in a buffer containing 5 mM HEPES, 1 mM EDTA-disodium salt, and the cocktail of protease inhibitor Complete and then incubated on ice for 15 min. Cells were pelleted again and resuspended with a homogenizer (Unit F8B, Constant cell disruption systems; Honiley, Warwickshire, UK). The supernatant and resuspended pelletwere combined and centrifuged at 50,000 g (Beckman Avanti J251). The cell membrane pellet was resuspended in a buffer consisting of 20 mM HEPES, 1 mM EDTA-disodium salt, 150 mM NaCl, and 10 % sucrose. Membrane aliquots were stored at −80 °C. One day before the binding assay, membranes were thawed, pelleted, and resuspended in the assay buffer consisting of 20 mM HEPES, 150 mM NaCl, 1 mM EDTA-disodium salt, 160 μg/ml bacitracin, and Complete protease inhibitor (two tablets per 100 ml). Membranes were distributed into 96-well wheatgerm- agglutinin Flashplates PLUS, incubated overnight for adsorption, and then the Flashplates PLUS were washed twice with the assay buffer. For equilibrium binding assays, 0.2 nM human [125ITyr9] urotensin II (initial specific activity 2200 Ci/ mmol, or 81,400GBq/mmol) was incubated with the indicated amounts of unlabeled competitors for 4 h and radioactivity counted in a 1450 Microbeta Wallac Jet (Wallac, Turku, Finland). EVALUATION Data of the FLIPR assay were analyzed by non-linear curve fitting using GraphPad Prism version 3.0 (GraphPad Software, San Diego, Calif., USA). Non-specific binding was determined in the radioligand binding assays in the presence of 10 μM human U-II and corresponded to 31 ± 2 % (n = 5, mean ± SEM) of the total binding for membranes expressing the human urotensin II receptor and to 8 ± 1 % (n = 5, mean ± SEM) of the total binding for membranes expressing the rat urotensin II receptor. Data analysis was performed with GraphPad Prism 3.0. MODIFICATIONS OF THE METHOD Flohr et al. (2002) identified non-peptide urotensin II receptor antagonists by virtual screening on a phamacophore model derived from structure–activity relationships and nuclear magnetic resonance studies on urotensin II. A.1.1.30.5 Urotensin II Gene Expression PURPOSE AND RATIONALE The UT receptor is expressed in vascular tissue (Ames et al. 1999; Maguire et al. 2000). A direct link between U-II, the UT receptor and vasoconstriction has to be assumed (Ames et al. 1999;Douglas andOhlstein 2001). Behm et al. (2003) used homologous recombination in embryonic stem (ES) cells to generate mice lacking the UT receptor coding region to determine the effect(s) of this receptor on vascular reactivity both in vivo and in vitro and to verify that U-II exerts its effects on vascular smooth muscle tone via an interaction with UT. PROCEDURE Targeting the UT Gene and Generation of Mutant Mice Gene targeting was performed in murine E14.1 ES cells, replacing the single coding exon of the UT receptor locus with a positive selection cassette containing the neomycin phosphotransferase gene (Neo) driven by the phosphoglycerate kinase I (PGK) promoter. 5΄- and 3΄ -homology arms, both of ∼ 4.0 kb, were cloned from a 129SVJ mouse genomic bacterial artificial chromosome (BAC) library and placed on either side of the positive selection cassette. Homologous recombination in neomycin-resistant ES cells was confirmed by Southern blot of BamHI-digested genomicDNA using an ∼ 800-bpBamHI/ SmaI restriction fragment as the 5΄ external probe (which detects 6.5- and 6.0-kb bands at the wild-type and targeted locus, respectively). Approximately 1 in 80 G418-resistant clones had undergone homologous recombination. Homologous recombination at the 3΄ end was confirmed in these ES cell clones by Southern blot of HindIII-digested genomic DNA using a ∼ 700-bp XmnI/HindIII restriction fragment as the 3΄-external probe (which detects 5.5- and 5.0-kb bands at the wildtype and targeted locus, respectively). Three targeted clones were injected into C57B16/J-derived blastocysts. Male chimeras were crossed with C57B16/J females to give N1F0 offspring, which were subsequently intercrossed to generate N1F1 offspring. In addition, N1F0 offspring were successively backcrossed to C57B16/J females to generate N5F0 mice. These were intercrossed to create an N5F1 population. Genotyping of Study Populations N1F1 and N5F1 study populations were genotyped by polymerase chain reaction (PCR) and Southern blot of genomic DNA isolated from the hearts of animals used in the studies. Hearts of wild-type (UT(+/+)) and UT receptor knockout (UT(−/−)) mice were cut into small pieces (∼1 mm) and placed into polypropylene tubes. Extraction buffer [2 ml; 10 mM Tris–HCl pH 8.0, 50 mM NaCl, 100 mM ethylenediaminetetraacetic acid (EDTA), 0.5 % SDS, 20 μg ml−1 RNase, 100 μg ml−1 proteinase K] was added and samples were incubated at 50 °C–55 °C for 4 h until completely lysed. The mixture was then extracted two times each with phenol, phenol/chloroform and chloroform (Maniatis et al. 1989). Genomic DNA was precipitated by adding 2.5 vols of cold ethanol, washed with 70 % v/v ethanol (−20 °C) and dissolved in 200 μl of 10 mM Tris–HCl, 1 mM EDTA TE, pH 8.0. Once dissolved, the purity and concentration of the DNA were measured by spectrophotometry (absorbency at 260 and 280 nm wavelength). PCR amplification was performed using 50-μl aliquots (50 mM KCl, 10 mM Tris–HCl, pH8.3, 17 mM MgCl2, 200nM 2΄-deoxynucleotide 5΄- triphosphates (dNTPs), 10 % v/v dimethylsulfoxide, 1.25U Taq DNA polymerase; (Perkin-Elmer,Norwalk, Conn., USA) using 200 ng of genomic DNA as the template and PCR primers specific to the neomycin resistance gene present at the targeted locus (5_-TGA ACA AGA TGG ATT GCA CGC AGG TTC TCC GGC-3΄ and 5΄-GCC AAG CTC TTC AGC AAT ATC ACG GGT AGC-3΄, yielding an ∼ 700-bp product) and mouse UT gene-specific primers (5΄-CTG GCT GAC CTG CTG TAT CTG CT-3΄ and 5΄-CAG GGT CAC ACA AAG CAC TCT CA-3_, yielding an ∼ 900-bp product). A 500-bp mouse glyceraldehyde- 3-phosphate dehydrogenase (GAPDH) amplicon was used as the internal control (5΄-TGG CCA AGG TCA TCC ATG AC-3_ and 5΄-GTC CAC CAC CCT GTT GCT GTA G-3΄, yielding an ∼ 500-bp product). Amplification was performed for 30 cycles at 60 °C annealing for 30 s, 72 °C extension for 90 s and 94 °C denaturing for 30 s. Amplification of a 500-bp (GAPDH)/700-bp doublet alone corresponded to a UT(−/−) genotype and a 500-bp (GAPDH)/900-bp doublet alone corresponded to a UT(+/+) genotype. Genomic DNA (20 μg) was digested with BamHI and run on an agarose gel (1 %). The agarose gel was then treated with denaturing solution (0.5 M NaOH, 1.5 M NaCl) for 45 min, followed by neutralization with 0.5 M Tris–HCl (pH7.5), 1.5 M NaCl for 30–40 min. The DNA was transferred to a nylon membrane (GeneScreen Plus, NEN Life Science Products, Mass., USA) and probed with cDNA corresponding to the full-length mouse UT receptor open reading frame (ORF). cDNA fragments were labeled with [α-32P] 2΄-deoxycytidine 5΄-triphosphate (dCTP) using standard random primed methods (T7 Quick- Prime; Pharmacia Biotech, Piscataway, N.J., USA). Membranes were prehybridized for 2 h at 42 °C and incubated overnight at 42 °C with 1 × 109 cpm μg−1 denatured radiolabeled probe in standard buffer [50 % deionized formamide, 6 × sodium chloride, sodium citrate (SSC), 5 × Denhardt’s reagent, 0.5 % sodium dodecyl sulfate (SDS), 100 μg ml−1 denatured, fragmented salmon sperm DNA]. Membranes were washed under conditions of low stringency (three 15-min washes in 1 × SSC, 0.1 % SDS at 28 °C) followed by a high stringency wash in 0.1 × SSC/0.1 % SDS for 30 min at 55 °C. Hybridization signals were detected by conventional X-ray autoradiography (Hyper film, Amersham Life Science, UK) and phosphor imaging (Storm 860, Molecular Dynamics, Sunnyvale, Calif., USA). Hemodynamics and Echocardiography Male wild-type (UT(+/+)) and homozygous UT receptor knockout (UT(−/−)) mice, anesthetized with 1.5 % isoflurane, underwent transthoracic echocardiographic determination of left ventricular end-diastolic volume (EDV), end-systolic volume (ESV), stroke volume (SV), cardiac output (CO) and ejection fraction (EF). Further to this, mice were re-anesthetized the following day for hemodynamic evaluation where a fluidfilled catheter was inserted into the left carotid artery for the measurement of mean arterial blood pressure (MAP) and heart rate (HR). The catheter was then advanced into the left ventricle (LV) to obtain measurements of left ventricular end-systolic (LVESP) and end-diastolic pressure (LVEDP). At the end of the study, selected organs (right and left kidney, heart, right and left ventricle and lungs) were isolated and wet weights were measured. Preparation and Utilization of Mouse Isolated Aortae and Mesenteric Arteries Male (4 months; 27 g) wild-type (UT(+/+)) and UT receptor knockout (UT(−/−)) mice were anesthetized with inhaled isoflurane (5 % in O2) and killed by cervical dislocation. Proximal descending thoracic aortae were isolated and cleaned of adherent tissue. Vessels approximately 3 mm in length were suspended in 10-ml organ baths containing Krebs solution of the following composition (mM): NaCl 112.0, KCl 4.7, KH2PO4 1.2, MgSO4 1.2, CaCl2 2.5, NaHCO3 25.0, dextrose 11.0. Krebs solution was maintained at 37 ± 1 °C and aerated with 95 % O2, 5 % CO2 (pH 7.4). For contraction studies, vessels were denuded of endothelium by rubbing with a fine forceps and indomethacin (10 mM) was added to the buffer. Changes in isometric force were measured under 0.5 g optimal resting tension using FT03 force-displacement transducers (Grass Instruments, Quincy,Mass., USA) coupled to Model 7D polygraphs. The Halpern–Mulvany wire myograph (Model 610 M; Danish Myo Technology, Denmark) was used formeasurement of isometric force development of endothelium- intact superior mesenteric arteries (optimalresting tension of 0.5 g) and data were recorded using a Grass 7400 direct thermal recorder. Following a 60-min equilibration period, vessels were treated with standard concentrations of KCl (60 mM) and phenylephrine (1 mM) to which subsequent agonist-induced responses were normalized.Once the contractile response to phenylephrine hadplateaued, carbachol (10 μM) was added to the vesselsin order to evaluate endothelial integrity. Cumulative concentration–response curves to phenylephrine (0.1 nM to 10 μM), angiotensin II(0.1nM to 10 μM), endothelin-1 (0.1nM to 1 mM)and hU-II (0.01 nM to 3 μM) were obtained for each vessel by adding the spasmogen to the tissue bath in half-log increments. During relaxation studies, vessels were Preconstricted with an EC80 concentration of phenylephrine and contractile tone was reversed by adding cumulative amounts of carbachol (1nM to 30 μM) or sodium nitroprusside (0.1nM to 1 μM). Each response was allowed to plateau before the addition of subsequent agonist concentrations. Vessels were allowed to recover for at least 30 min between subsequent agonist–response curves, and were not exposed to subsequent agonists after treatment with either endothelin-1 or hU-II. EVALUATION All values are expressed as mean ± SEM and n represents the total number of animals from which the vessels were isolated. Statistical comparisons were made using an unpaired, two-tailed t-test or Fisher’s exact tests and differences were considered significant when P < 0.05. Concentration–response curves were fitted to a logistic equation as previously described (Douglas etal.1995). MODIFICATIONS OF THE METHOD Coulouarn et al. (1998) reported cloning of the cDNA encoding the urotensin II precursor (Prepro-UII cDNA) in frog and human. Intense expression of the urotensin gene in motoneurons of the spinal cord was found indicating important physiological functions of urotensin II. Elshourbagy et al. (2002) reported molecular and pharmacological characterization of genes encoding urotensin II peptides and their cognate G-protein-coupled receptors from the mouse and monkey. Monkey and mouse preproU-II genes were identified to encode 123 and 125 amino acids. Monkey and mouse UT receptors were 389, and 386 amino acids, respectively. Expression of mouse and monkey U-II/UT receptor mRNA was found also in extravascular tissues, including lung, pancreas, skeletal muscle, kidney and liver. A.1.1.31 Apelin A.1.1.31.1 General Considerations PURPOSE AND RATIONALE The peptide apelin, consisting of 36 amino acids, is found increasingly to play a role in biology and medicine (Kleinz and Davenport 2005; Masri et al. 2005). The family of apelin peptides is derived from a single gene and activates the 7-transmembrane G-protein- coupled receptor APJ. In the search for an endogenous ligand of the orphan G-protein-coupled receptor APJ, Tatemoto et al. (1998) isolated and characterized endogenous peptide ligands, designated apelin, from bovine stomach extracts. Apelin-13, consisting of 13 amino acids, was more active than apelin-36. APJ was first identified in a human gene by O’Dowd et al. (1993), sharing close identity to the angiotensin receptor. In rats, the greatest expression of APJ mRNA was detected in the lung, suggesting that APJ and its ligand play an important role in the pulmonary system (Hosoya et al. 2000). Cloning, pharmacological characterization and brain distribution of the rat apelin receptor were reported by De Mota et al. (2000), and the physiological role of apelin and its receptor in rat brain by Reaux et al. (2001). The hypothalamic and hypophyseal distribution of the receptor suggested an involvement of apelin in the control of neuro- and adenohypophyseal hormone release, whereas the presence in the pineal gland and in discrete higher brain structures pointed to possible roles in the regulation of circadian rhythms and of water and food intake behavior. Studying the distribution of apelin-synthesizing neurons in the adult rat brain, Reaux et al. (2002) suggested multiple roles of apelin especially in the central control of ingestive behaviors, pituitary hormone release and circadian rhythms. Studying apelin immunoreactivity in the rat hypothalamus and pituitary, Brailoiu et al. (2002) concluded that apelin may be a signaling peptide released from the hypothalamichypophyseal axis. De Mota et al. (2004) found that apelin is a potent diuretic neuropeptide counteracting vasopressin actions through inhibition of vasopressin neuron activity and vasopressin release. Masri et al. (2002) reported that apelin activates extracellular signal- regulated kinases via a system sensitive to pertussis toxin (PTX). Pharmacological and immunohistochemical characterization of the APJ receptor and its endogenous ligand apelin were reviewed by Medhurst et al. (2003). Jászberény et al. (2004) studied the behavioral, neuroendocrine, and thermoregulatory actions of apelin-13. Wang et al. (2004) investigated the localization of apelin in the gastrointestinal tract, ontogeny, and stimulation of gastric cell proliferation and of cholecystokinin secretion. Boucher et al. (2005) found in isolated mouse and human adipocytes that apelin is upregulated by insulin and obesity. A.1.1.31.2 Cardiovascular Actions of Apelin PURPOSE AND RATIONALE Most reports concentrate on the functional role of apelin in the cardiovascular system (Tatemoto et al. 2001; Katugampola et al. 2002; Sokodi et al. 2002; Katugampola and Davenport 2003; Chen et al. 2003; Berry et al. 2004; Kleinz and Davenport 2004; Kagiyama et al. 2005; Losano 2005). Cheng et al. (2003) studied the venous dilator effect of apelin in conscious rats using a method for measurement of body venous tone published by Pang (2000). Ashley et al. (2005) found that apelin improves cardiac contractility and reduces cardiac loading in vivo in mice. PROCEDURE Male C57Bl/ 6 mice were used. The following studies were performed: magnetic resonance imaging of the heart, pressure–volume hemodynamics, effects of chronic apelin infusion, assessment of ventricular hypertrophy after sacrifice, and expression of the APJ receptor. Pressure–volume hemodynamics were assessed using the Aria system (Millar Instruments, Houston, Tex., USA), This measurement platform, specifically designed for small rodents, comprises an ultra-miniature 1.4 F (0.47 mm outer diameter) catheter, which incorporates pressure and conductance sensors, possessing hardware including analog-digital conversion and analysis software. Pressure is measured directly in mmHg, while the conductivity of blood is used to estimate volume and allow construction of pressure– volume relationships in real time. Male mice aged 8–16 weeks were anesthetized with 1 %–2 % isoflurane in oxygen. The internal jugular vein was cannulated with PE tubing and a 10 % albumin solution infused at 5 μl/min following a bolus of 150 μl over 5 min. After tracheostomy, a 19- gauge cannula was inserted into the trachea and the animal was ventilated at a tidal volume of 200 μl at 100 breaths per minute. Following an incision just dorsal to the xyphoid cartilage, the diaphragm was visualized from below, and after diaphragmatic incision, the left ventricular apex was visualized. The pressure– volume catheter was inserted along the long axis of the left ventricle, from where it was adjusted to obtain rectangular-shaped pressure–volume loops. Baseline loops were recorded following volume replacement, at which point the inferior vena cava was visualized within the chest and occlusion parameters were recorded during and after a 5-s manual occlusion of the vessel. Next, the albumin solution was replaced by one containing 100 nM apelin, which was infused at 5 μl/min for 20 min, following which baseline and occlusion loops were recorded once again. Signals from the catheter were digitized using the Powerlab system and stored for offline analysis using the PVAN software. This allows analyses of pressure (e. g., end systolic pressure, end-diastolic pressure) and derivation of pressure–time and volume–time parameters at steady state. For magnetic resonance imaging, male C57Bl/6 mice aged 16 weeks were scanned twice on subsequent days. The animals underwent general anesthesia while breathing spontaneously via a nose cone fitted carefully to minimize escape of anesthetic into the environment. Two percent isoflurane was administered with an oxygen flow rate of 1-2 l/min. Platinum needle ECG leads were inserted subcutaneously. Respiration was monitored by means of a pneumatic pillow sensor positioned against the abdomen. Mouse body temperature was maintained during scanning at 37 °C by a flow of heated air thermostatically controlled by a rectal temperature probe. Magnetic resonance images were acquired on a 4.7 T Oxford magnet controlled by a Varian Inova console (Varian, Palo Alto, Calif., USA) using a transmit–receive, quadrature, volume coil with an inner diameter of 3.5 cm. Image acquisition was gated to respiration and to the ECG R wave (SA Instruments, Stony Brook, N.Y., USA). Coronal and sagittal scout images led to the acquisition of multiple contiguous 1-mm-thick, short axis slices orthogonal to the interventricular septum. Nine cine frames were taken at each slice level with the following sequence parameters: TE = 2.8 ms, NEX = 12, FOV = 3 × 3 cm, matrix = 128 × 128, flip angle = 60°. Cine frames were spaced 16 ms apart and acquired through slightly more than one cardiac cycle guaranteeing acquisition of systole and diastole. On the second day of scanning, mice received 300 μg/kg body weight of apelin as an intraperitoneal injection 1 h prior to scanning. A pilot study had previously identified 1 h as an appropriate time within which to identify apelin effects resulting from peritoneal absorption. Planimetry measurements of end-diastolic and end-systolic dimensions were derived offline from short axis views of the left ventricle at the level of the papillary muscles using ImageJ software (National Institutes of Health, Bethesda, Md., USA). Ejection fraction was calculated as [LVEDA-LVESA]/LVEDA, where LVEDA is left ventricular end-diastolic area and LVESA is left ventricular end-systolic area. EVALUATION Data were analyzed using Student’s t statistic (paired) or repeated measures analysis of variance using the post hoc comparison of Fisher. MODIFICATIONS OF THE METHOD Katugampola et al. (2001, 2002) described [125I](Pyr1)apelin as a radioligand for localizing the APJ orphan receptor in human and rat tissues. Kasai et al. (2004) found that apelin worked as an angiogenic factor in the retinal endothelial cell line RF/6A. A.1.1.32 TRP Channels A.1.1.32.1 General Considerations The transient receptor potential (TRP1) ion channels are named after the role of the channels in Drosophila phototransduction (Montell 2001). The mammalian genes are encoded by at least 28 channel subunit genes (Clapham 2003; Moran et al. 2004; Clapham et al. 2005). Six protein families comprise the mammalian TRP superfamily: the classic TRPs (TRPCs), the vanilloid receptor TRPs (TRPVs), the melastatin or long TRPs (TRPMs), the mucolipins (TRPMLs), the polycystins (TRPPs), and ankyrin transmembrane protein 1 (ANKTM1, TRPA1). The TRP channel primary structures predict six transmembrane (TM) domains with a pore domain between the fifth (S5) and sixth (S6) segments and both C and N termini presumably located intracellularly (Vannier et al. 1998). The TRP superfamily includes > 20 related cation channels that play critical roles in processes ranging from sensory physiology to vasorelaxation and male fertility. Defects in TRP channels have been associated with changes in growth control and one TRP-related protein may be a tumor suppressor. Moreover, mutations in a member of the TRP superfamily are a common cause of polycystic kidney disease, while disruption of another is responsible for mucolipidosis, a neurodegenerative disease. TRP proteins are widely expressed in the nervous system, and, in non-excitable cells, TRP-related channels may be the primary mode of Ca2+ entry. TRP proteins are cation channels; however, they vary significantly in their selectivity and mode of activation. Nevertheless, members of the TRP superfamily share significant sequence homology and predicted structural similarities. Based on primary amino acid homology, the conventional TRP protei s can be classified into three subfamilies: TRPC, TRPV, and TRPM (Birnbaumer et al. 2003). Three additional, more distantly related subfamilies have recently been defined: ANKTM1, a Ca2+ − permeant, non-selective cation channel, is the only mammalian member of the TRPA branch of TRP proteins. It is activated by noxious cold temperature, pungent mustard oil compounds and may additionally serve as a mechanosensitive transduction channel in auditory hair cells as well as an ionotropic cannabinoid receptor. The three mucolipins, TRPML1, 2, and 3, appear to be ion channels in intracellular vesicles. Mutations in TRPML1 cause mucolipidosis type IV, a neurodegenerative lysosomal storage disorder, while genetic defects in TRPP2, a member of the TRPP subfamily, are frequently encountered in patients suffering from autosomal dominant polycystic kidney disease. A.1.1.32.2 TRPC Channels The TRPC family can be divided into three subgroups by sequence homology as well as functional similarities: C1/C4/C5, C3/C6/C7, and C2. TRPC1 was the first member of the mammalian TRP family purported to form an ion channel (Zitt et al. 1996). Given the widespread expression of TRPC1 and its ability to coassemble with other TRPC subunits (Xu et al. 1997; Lintschinger et al. 2000; Strübing et al. 2003), TRPC1 might be a component of different heteromeric TRP complexes. The subgroup most closely related to TRPC1 comprises TRPC4 and TRPC5. TRPC4 and TRPC5 are PDZ motif-containing proteins that can form homomeric cation channels that are activated following stimulation of Gq-coupled receptors (Okada et al. 1999) as well as receptor tyrosine kinases (Schaefer et al. 2000). Xu and Beech (2001) found that TRPC1 is a membrane- spanning subunit of store-operated Ca2+ channels in native vascular smooth muscle cells. Vandebrouck et al. (2002) described involvement of TRPC in the abnormal calcium influx observed in dystrophic (mdx) mouse skeletal muscle fibers. Venkatachalam et al. (2003) discussed regulation of canonical transient receptor potential (TRPC) channel function by diacylglycerol and protein kinase C. Bergdahl et al. (2003) found that cholestrerol depletion impairs vascular reactivity to endothelin-1 by reducing store-operated Ca2+ entry dependent on TRPC1. Amiri et al. (2003) published FRET-based analysis of TRPC subunit stoichiometry. Jho et al. (2005) reported that angiopoietin-1 opposes VEGF-induced increase in endothelial permeability by inhibiting TRPC1-dependent Ca2+ influx. Rao and Kaminski (2006) found that induction of intracellular elevation by Δ9-tetrahydrocannabinol in T cells involves TRPC1 channels. Takai et al. (2004) distinguished two types of nonselective cation channels by muscarinic stimulation with carbachol in bovine muscle cells. Kumar et al. (2006) studied upregulated TRPC1 channel in vascular injury in vivo and its role in human neointimal hyperplasia. Less information is available about TRPC2, which shares approximately 30 % sequence identity with the TRPC3/6/7 subfamily. Full-length TRPC2 mRNA and several N-terminal splice variants have been found in mouse and rat tissue, but TRPC2 seems to be a pseudogene in humans (Vannier et al. 1999; Liman 2003). TRPC2 protein was localized to neuronal micovilli in rat vomeronasal organ (Liman 2003) and in the head of mouse sperm (Jungnickel et al. 2001). TRPC3, TRPC6, and TRPC7 are 75 % identical. When expressed they constitute non-selective cation currents that rectify in both the inward (− voltages) and outward (+ voltages) directions. TRPC3, TRPC6, and TRPC7 are inwardly and outwardly rectifying, have relatively low selectivity for Ca2+ overNa+, and are activated by diacylglycerol (DAG) (Hofmann et al. 1999; Okada et al. 1999; Putney et al. 2004). These channels seem to play important roles in vascular and airway smooth muscle (Trebak et al. 2003; Yu et al. 2003; Corteling et al. 2004). Groschner and Rosker C (2005) described TRPC3 as a versatile transducer molecule that serves integration and diversification of cellular signals. Graziani et al. (2006) investigated the potential role of membrane cholesterol as a regulator of cellular TRPC3 conductance. Smyth et al. (2006) found a dissociation of regulated trafficking of TRPC3 channels in the plasma membrane from their activation by phospholipase C. TRPC4 and TRPD5 are receptor-operated Ca2+ − permeable non-selective cation channels (Plant and Schaefer 2003). Odell et al. (2005) found that epidermal growth factor induces tyrosine phosphorylation, membrane insertion and activation of transient receptor potential channel 4. Saleh et al. (2006) described that angiotensin II activates two cation channels with distinct TRPC1 and TRCP6 channel properties in rabbit mesenteric artery myocytes. Shimizu et al. (2006) reported that Ca2+ − calmodulin-dependent myosin light chain kinase is essential for activation of TRPC5 channels expressed in HEK293 cells. Shi et al. (2004) described multiple regulation by calcium of murine homologs of transient receptor potential proteins TRP6 and TRP7 expressed in HEK293 cells. Xu et al. (2006) identified sphingosine-1-phosphate as an activator of the calcium channel TRPC5, which controls vascular smooth muscle activity. Estacion et al. (2004) studied activation of human TRPC6 channels by receptor stimulation. Basora et al. (2003) reported that 20-hydroxyeicosatetraenoic acid (20-HETE) activates mouse TRPC6 channels expressed in HEK293 cells. Maruyama et al. (2006) found that heteromultimeric TRPC6-TRPC7 channels contribute to arginine vasopressin-induced cation current of A7r5 vascular smooth muscle cells. A.1.1.32.3 TRPM Channels The TRPM subfamily has eight members divided into four groups: M1 (melastatin)/M3, M7 (TRPPLIK)/ M6, M2/M8, and M4/M5 (Hartzeneck 2005; Fonfria et al. 2006).TRPM1 may be regulated through direct interaction with a cytosolic isoform generated by alternative RNA splicing (Xu et al. 2001). TRPM2 is a 1503-amino-acid protein that is highly expressed in brain (Nagamine et al. 1998) and present in blood cells. Perraud et al. (2003) reviwed TRPM2 Ca2+-permeable cation channels. Hill et al. (2004a, 2004b) reported inhibition of TRPM2 channels by the antifungal agents clotrimazole and econazole as well as by flufenamic acid; Kraft et al. (2006) by N-(p-amylcinnamoyl)anthranilic acid. Identified first by sequencing projects, the function of TRPM3 is poorly understood. The hTRPM3 gene maps to human chromosome 9q-21.12 and encodes a 1555-amino-acid protein. TRPM4 and TRPM5 have similar characteristics. TRPM4b, a splice variant of TRPM4, and TRPM5 are Ca2+-activated, voltage-modulated, monovalent-selective cation channels with 25-pS single-channel conductances (Launay et al. 2002; Hofmann et al. 2003; Nilius et al. 2003). Pérez et al. (2003) studied the ion channel TRPM5 in taste receptor cells. TRPM6 and TRPM7 comprise a unique subfamily of TRP proteins with both channel and kinase activities. TRPM7, which has 1863 amino acid residues, was identified in a yeast two-hybrid screen as a protein interacting with phospholipase C (PLC) (Runnels et al. 2001; Schmitz et al. 2003). It seems to be ubiquitously expressed. Takezawa et al. (2004) described receptormediated regulation of the TPRM7 channel through its endogenous protein kinase domain. TRPM8 is a 1104-amino-acid protein that does not seem to contain associated enzymatic domains. TRPM8 is a non-selective, voltage-modulated conductance. At colder temperatures (8 °C–28 °C) or in the presence of menthol, TRPM8 current is activated at a more physiological range of voltages (Brauchi et al. 2004; Voets et al. 2004). This channel is expressed in A.1 · Cardiovascular Analysis 167 small-diameter primary sensory neurons, where it presumably functions as a thermosensor (McKemy et al. 2002; Peier et al. 2002). A.1.1.32.4 TRPV Channels The TRPV subfamily is named after the first mammalian member of the subfamily, vanilloid receptor 1 (Caterina et al. 1997; Benham et al. 2002; Montell et al. 2002; Clapham 2003; Mutai and Heller 2003). TRPV5 and TRPV6 are highly Ca2+-selective TRP channels thatmediate trans-epithelial Ca2+ transport in kidney and intestine (Hoenderop et al. 2003). The TRPV channel subfamily has six members divided into two groups: V1/V2/V3/V4 and V5/V6. The vanilloid receptor, TRPV1, is the best understood ion channel in this class (Caterina et al. 1997; Caterina and Julius 2001). TRPV channels as temperature sensors were reviwed by Benham et al. (2003). The expressed TRPV1 capsaicin receptor is a heat/proton/lipid/voltage-modulated Ca2+-permeant (PCa/PNa 10) ion channel. A more voltag-gatingcentric explanation is that at warmer temperatures (> 37 °C) or in the presence of capsaicin, TRPV1 current is activated by a more physiological range of voltages (Brauchi et al. 2004). TRPV1 is desensitized by internal Ca2+; it is not activated by store depletion. TRPV1, V2, and V3 are activated by the synthetic compound 2-aminoethoxydiphenylborate (2- APB) (Chung et al. 2004; Hu et al. 2004). Endogenous cannabinoid receptor ligands, such as anandamide, are potential TRPV1 agonists. The vanilloid receptor-like channel TRPV2 is 50 % identical to TRPV1, but is insensitive to capsaicin (Caterina et al. 1999). Like TRPV1 it is more permeable to Ca2+ than to Na+ (P Ca/P Na = 3:1). It has been proposed to mediate high-threshold noxious heat sensation, perhaps in the lightly myelinated A nociceptors, but its presence in non-sensory tissue suggests other functions as well. TRPV3 is expressed widely but most strikingly in skin. Increasing temperature from 22 to 40 °C in mammalian cells transfected with hTRPV3 elevates intracellular calcium by activating a non-selective cationic conductance (P Ca/P Na 10:1) (Peier et al. 2002; Smith et al. 2002; Xu et al. 2002). As in sensory neurons, the current is steeply dependent on temperature, sitizes with repeated heating, and displays a striking hysteresis on heating and cooling, but the extent of expression in sensory neurons is controversial. Based on these properties, TRPV3 is thermosensitive in the physiological range of temperatures between TRPM8 and TRPV1 and may play a role in pain. TRPV4 is 40 % identical to TRPV1 and TRPV2 (Liedtke et al. 2000; Strotmann et al. 2000).When expressed in mammalian cells it comprises a moderately selective cation channel (P Ca/P Na = 6), which, like TRPV1, displays a gently outwardly rectifying I–V relation. TRPV4 is 40 % identical to TRPV1 and TRPV2 (Liedtke et al. 2000; Strotmann et al. 2000). When expressed in mammalian cells it comprises a moderately selective cation channel (P Ca/P Na =6), which, like TRPV1, displays a gently outwardly rectifying I–V relation. TRPV5 and TRPV6 comprise a separate subfamily of TRPVs with only 30 % identity with TRPV1. The expressed channels strongly inwardly rectify and are the most Ca2+-selective (P Ca/P Na > 100) (Nilius et al. 2000; Vennekens et al. 2000; Yue et al. 2001; Den Dekker et al. 2003) of all TRP channels. These properties are consistent with proposed mechanisms for Ca2+-selective channels in which negatively charged glutamic or aspartic acid residues provide a binding site for divalents within the pore. Intra- and extracellular [Ca2+] (Yue et al. 2001; Hirnet et al. 2003; Bödding and Flockerzi 2004) and calmodulin (Lambers et al. 2004) regulate TRPV6 activity. The localization of TRPV5 and TRPV6 to the proximal small intestine and collecting duct of the kidney, along with mouse knockout data, suggests that this family is important in calcium uptake via epithelial cells (Hoenderop et al. 2005). Lee et al. (2005) reported that PIP2 activates TRPV5 and releases its inhibition by intracellular Mg2+. A.1.1.32.5 TRPV1 Receptor Assay PURPOSE AND RATIONALE The vanilloid receptor-1 (TRPV1) is a non-selective cation channel, predominantly expressed by peripherally sensory neurons, which is known to play a key role in the detection of noxious painful stimuli, such as capsaicin and heat. Smart et al. (2000, 2001) found that the endogenous lipid anandamide is a full agonist at the human vanilloid receptor and characterized human vanilloid VR1 pharmacology using FLIPR. With these methods, Gunthorpe et al. (2004) identified and characterized a potent and selective vanilloid receptor (VR1/TRPV1) antagonist. PROCEDURE Cloning and Expression of VR1 Receptors in HEK293 Cells Human VR1 cDNA was identified using the published rat VR1 sequence (GenBank accession AF029310) to search public nucleotide databases. Expressed sequence tag T48002 was identified and its sequence extended by rapid amplification of the cDNA ends using cDNA templates from a number of tissue sources. The full cDNA was amplified from brain cDNA, inserted into the expression vector pcDNA3.1, double-strand sequenced, and stably expressed in HEK293 cells. Rat VR1 cDNA was amplified from rat DRG cDNA and similarly expressed in HEK293 cells. Cell Culture hVR1-HEK293 cells were grown as monolayers in minimum essential medium (MEM) supplemented with non-essential amino acids, 10 % fetal calf serum, and 0.2 mM L-glutamine, and maintained under 95 %/5 % O2/CO2 at 37 °C. Cells were passaged every 3–4 days and the highest passage number used was 20. Dissociated rat neonatal DRG cultures were prepared as described by Skaper et al. (1990). Electrophysiological Studies Cells were plated and cultured on glass coverslips at 26,000 cells cm−2 and whole-cell voltage clamp recordings were performed at room temperature (20–24 °C), using standard methods. The extracellular solution consisted of (mM): NaCl 130, KCl 5, CaCl2 2, MgCl2 1, glucose 30, HEPES-NaOH 25, pH 7.3. For anandamide application this solution was supplemented with 0.2 % lipid-free bovine serum albumin. Patch pipettes of resistance 2–5MΩ were fabricated on a Sutter Instruments P-87 electrode puller and were filled with the following solution (mM): CsCl 140, MgCl2 4, EGTA 10, HEPESCsOH 10, pH 7.3. All recordings were made from single, well isolated, phase bright cells. Currents were recorded at a holding potential of –70 mV using an Axopatch 200B amplifier. Data acquisition and analysis were performed using the pClamp7 software suite. Drug applications were affected with an automated fast-switching solution exchange device (Warner Instruments SF-77B; time for solution exchange ≈ 30 ms). Measurements of [Ca2+]iUsing the FLIPR hVR1-HEK293 cells were seeded into black-walled clear-base 96-well plates (Costar, UK) at a density of 25,000 cells per well inMEM, supplemented as above, and cultured overnight. The cells were then incubated with MEM containing the cytoplasmic calcium indicator Fluo-3 AM(4 μM; Teflabs, Austin, Tex., USA) at 25 °C for 120 min. The cells were washed four times with, and finally cultured in, Tyrode’s medium containing 0.2 % BSA, before being incubated for 30 min at 25 °C with either buffer alone (control) or buffer containing various antagonists. The plates were then placed into a FLIPR (Molecular Devices, UK) to monitor cell fluorescence (λEX = 488 nM, λEM = 540 nM) (Sullivan et al. 1999) before and after the addition of various agonists. EVALUATION Responses were measured as peak fluorescence intensity (FI) minus basal FI, and where appropriate were expressed as a percentage of a maximum capsaicin-induced response. Data are expressed as mean ± SEM unless otherwise stated. Curve-fitting and parameter estimation were carried out using Graph Pad Prism 3.00 (GraphPad Software, Calif., USA). pK B values were generated from IC50 curves for the antagonist vs a fixed EC80 concentration of agonist using the Cheng–Prusoff equation. MODIFICATIONS OF THE METHOD Rao and Kaminski (2006) reported that induction of intracellular elevation by Δ9-tetrahydrocannabinol in T cells involves TRPC1 channels. A.1.2 Studies in Isolated Organs A.1.2.1 α-Sympatholytic Activity in Isolated Vascular Smooth Muscle ... PURPOSE AND RATIONALE Noradrenaline and other sympathomimetic drugs increase vascular smooth muscle tone by stimulation of α-adrenergic receptors. Contractions can be antagonized by α-adrenergic receptor blocking agents such as phentolamine. Drugs can be tested for their capacity of reducing vascular smooth muscle contractions induced by the adrenergic receptor-activating agent noradrenaline. Moreover, effects of peptides, such as bradykinin, can be tested with strips of aorta or pulmonary artery. PROCEDURE As donor animals Pirbright White guinea pigs of either sex weighing about 400 g, or Chinchilla rabbits weighing about 3.5 kg, or Sprague–Dawley rats weighing 200–300 g are used. The vessels to be tested are the thoracic aorta or the arteria pulmonalis. The animals are sacrificed by stunning and exsanguination. The pulmonary artery or the thoracic aorta is quickly removed and cut into helical strips of 1–2 mm width and 15–20 mm length. The strips are mounted in an organ bath with a preload of 1 g. Krebs-Henseleit buffer solution containing 11.5 M glucose is maintained at 37 °C and oxygenated with 95 % O2, 5 % CO2 . Isotonic or isometric registration is performed. Changes in length are recorded isotonically using a lever transducer (368 type B, Hugo Sachs Elektronik Freiburg). Isometric force is measured with a force transducer (UC-2 Gould-Statham, Oxnard, USA). Experimental Course Following an equilibration period of 60 min, contractions are induced by repeated administrations of (−)noradrenaline HCl in concentrations of 2 × 10−6 M for testing the contractions of the pulmonary artery and in concentrations of 2 × 10−8 M for testing the contractions of the aorta. After obtaining a stable plateau of identically sized contractions, cumulative doses of the test compound are added into the organ bath. Consecutive concentrations are given when the response of the previous dose has reached a plateau. Controls at the end of the experiment: If a compound does not show vasorelaxing activity at any dose, the sensitivity of the preparation is tested by adding phentolamine (1 × 10–7 M). If a compound shows vasorelaxing activity, the reversibility of the relaxation is tested by increasing the noradrenaline concentration. EVALUATION The contractile force is determined before and after drug administration. Percent inhibition of spasmogen-induced contraction by test drug is calculated as compared to the maximal contraction with a spasmogen alone ( = 100 %). IC 50 values are determined from the individual dose–response curves. IC 50 is defined as the dose of drug leading to a 50 % relaxation of noradrenaline-induced contraction. MODIFICATIONS OF THE METHOD The isolated vena cava of rabbits can be used for assaying α-adrenolytic activity. The rabbit is sacrificed by CO2 anesthesia. The vena cava inferior is removed and cut into strips. The percent inhibition of epinephrine or norepinephrine induced contractions is determined. The effects of bradykinin and bradykinin antagonists can be tested in isolated guinea pig artery and isolated rabbit aorta which contains predominantly the BK1-receptor type (Regoli and Barabé 1980; Hock et al. 1991). Wisskirchen et al. (1998) tested agonists of calcitonin gene-related peptide, homologues and antagonists in rat isolated pulmonary artery. Endotheliumintact pulmonary artery rings were contracted with 3 × 10−8 M phenylephrine and a cumulative doseresponse curve of relaxation was constructed. A.1.2.2 α-Sympatholytic Activity in the Isolated Guinea Pig Seminal Vesicle ... PURPOSE AND RATIONALE The seminal vesicles of guinea pigs and rats are tubular organs whose longitudinal and annular muscles are innervated by the sympathetic system. The inhibition of contractions induced by norepinephrine or the α 1-selective agonist phenylephrine indicates α-sympatholytic activity. Sharif and Gokhale (1986) recommended the use the isolated rat seminal vesicle as a rather sensitive and specific model. PROCEDURE Male guinea pigs weighing 300 to 600 g are sacrificed by a blow to the neck. Both seminal vesicles are prepared and placed in Ringer’s solution in an organ bath maintained at 32 °C and being oxygenated with 95 % O2/5 % CO2. Isotonic or isometric registration is performed. Changes in length are recorded isotonically using a lever transducer (368 type B, Hugo Sachs Elektronik Freiburg). Isometric force is measured with a force transducer (UC-2 Gould-Statham, Oxnard, USA). Following an equilibration period of 30 min, contractions are induced by repeated administration of (−)norepinephrine HCl in concentrations of 1 to 5 μg/ml or phenylephrine HCl in concentrations of 10 to 50 μg/ml. After obtaining a stable plateau of identical contractions, the test compound is added into the organ bath. Three min later, the previous concentration of norepinephrine or phenylephrine is added. As standard phentolamine is used in concentrations of 3 to 30 × 10–7 M. EVALUATION Contractions of the seminal vesicle induced by the α-adrenergic agonists after addition of the test compound are compared with the initial values and expressed as percentage thereof. For in depth analysis, full doseresponse curves of the agonist are recorded before and after addition of various doses of the antagonist. A parallel shift to the right indicates competitive antagonism which can be evaluated as pA x – values according to Schild (1947) MODIFICATION OF THE METHOD Leitch (1954) recommended the use of isolated seminal vesicles of rats for the assay of sympatholytic drugs. A.1.2.3 α-Sympatholytic Activity in the Isolated Vas Deferens of the Rat ... PURPOSE AND RATIONALE The vas deferens of the guinea pig or preferably the rat is used for quantitative evaluation of adrenergic antagonists. The response of this organ to α-adrenergic agonists consists of a strong rapid contraction followed by quick relaxation on washing the agonists out of the tissue. PROCEDURE Male Wistar rats weighing about 300 g are used. The animals are sacrificed by a sharp blow to the neck, the vasa deferentia are dissected free from the extraneous tissues and suspended in a organ bath containing Tyrode solution being oxygenated with a 95 % O2 and 5 % CO2 mixture at 32 °C. Isotonic registration is performed at a preload of 0.5 g. Changes in length are recorded isotonically using a lever transducer (e. g., 368 type B, Hugo Sachs Elektronik, Freiburg, FRG). Following an equilibration period of 30 min, contractions are induced by repeated administration of (−)norepinephrine HCl in concentrations of 0.5, 1.0, 2.0, or 4.0 μg/ml. After obtaining a stable plateau of identical contractions, the test compound is added into the organ bath. Three min later, the previous concentration of norepinephrine is added. As standard phentolamine is used in concentrations of 3 to 30 × 10–7 M. EVALUATION Contractions of the vas deferens induced by the α- adrenergic agonist after addition of the test compound are compared with the initial values and expressed as percentage thereof. For in depth analysis, full doseresponse curves of the agonist are recorded before and after addition of various doses of the antagonist. A parallel shift to the right indicates competitive antagonism which can be evaluated as pA x – values according to Schild (1947). MODIFICATIONS OF THE METHOD Electrical stimulation of the isolated ductus deferens results in the release of norepinephrine. Stimulation induced contractions of this organ are inhibited by clonidine which impairs adrenergic neurotransmission by activating inhibitory α-receptors. The ductus deferens is suspended in an organ bath bubbled with carbogen and maintained at 37 °C. Tension is adjusted to 25mN. Following a 45 min equilibration period, supramaximal amplitude stimulation by a HSE type 2 stimulator (Hugo Sachs Elektronik, Freiburg) is applied. After stabilization of the response, clonidine is added to the organ bath in accumulated doses. Test compounds are added 5 min prior to clonidine administration. The percent potentiation of clonidine induced inhibition of contractions is determined. Taylor et al. (1983) used the rat deferens for pharmacological characterization of purinergic receptors. Nerve-muscle preparations of the vas deferens have been reviewed by Holman (1975). Hughes et al. (1974) used the electrically stimulated mouse vas deferens for assessment of the agonistic and antagonistic activities of narcotic analgesic drugs. Ross et al. (2001) used the mouse vas deferens to study structure-activity relationship for the endogenous cannabinoid, anadamide, and certain of its analogues at vanilloid receptors. Oka et al. (1980) recommended the vas deferens from rabbits as a specific bioassay for opioid κ-receptor agonists. Mutafova-Yambolieva and Radmirov (1993) studied the effects of endothelin-1 on electrically- or druginduced contractile responses mediated by purinergic or adrenergic receptors in the isolated prostatic portion of rat vas deferens. Ward et al. (1990) used isolated vasa deferentia preparations from rat and mouse to study the pharmacological profile of the analgesic pravadoline. Hukovic (1961) described an isolated ductus deferens preparation together with the sympathetic hypogastric nerve of the guinea pig. Cordellini and Sannomiya (1984) pretreated guinea pigs with reserpine. In the isolated vasa deferentia concentration- effects curves to phenylephrine were established in the presence of cocaine. The antagonistic effect of phenoxybenzaminewas used for receptor occupancy studies. Donoso et al. (1992) studied neurotransmission in epididymal and prostatic segments of isolated superfused rat vas deferens preparations. Vaupel and Su (1987) used the vas deferens preparation of guinea pigs to study sigma and phencyclidine receptors. Eltze (1988) used the field-stimulated (95 % of maximum voltage, 0.1Hz, 0.5 ms) portion of rabbit vas deferens to study muscarinic M1 and M2-receptors. Dumont et al. (1997) used the isolated guinea pig heart and the isolated rat vas deferens for in vitro bioassays of calcitonin gene-related peptide (CGRP) agonists and antagonists. Poyner et al. (1999) found concentration-dependent inhibitions of the electrically stimulated twitch responses of guinea pig vas deferens by calcitonin generelated peptide, amylin and adrenomedullin. Couldwell et al. (1993) found that the rat prostate gland possesses a typical α 1-adrenoceptor similar to that found in the vas deferens. Wisskirchen et al. (1998) tested agonists of calcitonin gene-related peptide, homologues and antagonists in rat isolated vas deferens. The prostatic half was suspended under 0.5 g resting tension and equilibrated in Krebs solution at 37 °C. Contractile responses of the prostatic vas were induced by electrical field stimulation at 0.2Hz, 1.0 ms and 60 V through parallel platinum electrodes either side of the tissue. A.1.2.4 α-Sympatholytic Activity in the Isolated Rat Spleen ... PURPOSE AND RATIONALE α-Stimulant agents (such as epinephrine, norepinephrine) or electrical stimulation induce contractions in sympathetically innervated organs such as spleen smooth muscle. These effects can be antagonized by drugswith α-blocking activities such as phentolamine. PROCEDURE Male Sprague–Dawley rats weighing 180–220 g are used. The animal is sacrificed in CO2 anesthesia. The spleen is removed and cut longitudinally into two halves. Each part is placed in an organ bath containing nutritive solution. The bath solution is bubbled with carbogen and maintained at 37 °C. Following a 30 min incubation period under a tension of 0.5 g, contractions are elicited by administration of epinephrine (10–6 g/ml) or norepinephrine 10–6 g/ml). After obtaining 3 approximately identical spasms, the test compound is administered followed by the addition of the spasmogen 5 min later. The contractile response is allowed to plateau and recorded. Standard compound: phentolamine EVALUATION The contractile force is recorded at its maximal level before and after drug administration. The percent inhibition of epinephrine or norepinephrine induced contraction is determined. A.1.2.5 α-Sympatholytic Activity in the Isolated Rat Anococcygeus Muscle ... PURPOSE AND RATIONALE The rat anococcygeus muscle as pharmacological tool was introduced by Gillespie (1972, 1980), Gibson and Gillespie (1973). This smooth muscle has a dense adrenergic innervation and contracts to noradrenaline, acetylcholine, 5-hydroxytryptamine, but not to histamine. Moreover, the muscle contracts to field stimulation or stimulation of extrinsic nerves. The preparation can be used to assess the pre- and post-synaptic α-adrenoceptor blocking activity of drugs (Doggrell 1980, 1983). PROCEDURE The two anococcygeus muscles arise from the upper coccygeal vertebra close to one another in the midline of the pelvic cavity. The muscles pass caudally, lying first behind and the to one side of the colon, finally joining together to form a ventral bar in front of the colon a few mm from the anus. The extrinsic nerves pass in a branch of the perineal nerve on either side to enter the deep surface of each muscle just before the formation of the ventral bar. After sacrifice, the abdomen of rats is opened in the mid-line, the pelvis split and the bladder and urethra removed. Care is required in clearing the lower part of the urethra to avoid damage to the ventral bar of muscle, the only region lying ventral to the colon. The colon is then cut through at the pelvic brim, the pelvic portion pulled forward and the delicate connective tissue behind cleared until the anococcygeus muscles come into view. The muscles are isolated, in some instances with the extrinsic nerve intact. The extrinsic nerves on either side run in the posterior scrotal branch of the perineal nerve and leave it to enter the deep surface of the anococcygeal muscles as the lie on the lateral surface of the colon. The ventral bar is cut through and each muscle mounted in a 100 ml bath containing Krebs solution at 36 °C. The solution is gassed with 95 % O2 + 5 % CO2. Tension is measured with isometric transducers and displayed on a polygraph. Field stimulation of the intramural nerves is applied after drawing the muscles through a pair of electrodes similar to those described by Burn and Rand (1960); when the muscles are stimulated through their extrinsic nerves the nerves are drawn through similar electrodes. Stimulation of either intramural or extrinsic nerves is with 1 ms pulses at 20Hz, and at a supramaximal voltage. Dose–response curves are established with doses of 2 × 10–7 to 4 × 10−6 M noradrenaline, 4 × 10–7 to 4 × 10−5 M acetylcholine or with graded frequencies of electrical stimulation. The effect of noradrenaline is abolished by α-adrenergic antagonists, such as 10−6 M phentolamine. Dose–response curves show a parallel shift characteristic of competitive antagonism. EVALUATION Contractions of the anococcygeus muscle induced by an α-adrenergic agonist after addition of the test compound are compared with the initial values and expressed as percentage thereof. For in depth analysis, full dose–response curves of the agonist are recorded before and after addition of various doses of the antagonist. A parallel shift to the right indicates competitive antagonism which can be evaluated as pA x – values according to Schild (1947). MODIFICATIONS OF THE METHOD Gibson et al. (1990) found L-N G-nitroarginine to be a potent inhibitor of non-adrenergic, non-cholinergic relaxations in the rat anococcygeus muscle. Oliveira and Bendhack (1992) found that dopamine has a dual effect in the rat anococcygeus muscle: a partial effect due to an indirect sympathomimetic action and a partial effect due the interaction with postjunctional receptors. Brave et al. (1993) investigated the interaction between motor sympathetic and inhibitory non-adrenergic, non-cholinergic nerves in the rat anococcygeus muscle using L-N G-nitroarginine, an inhibitor of Larginine: NO synthase. Cakici et al. (1993) described a coaxial bioassay system consisting of guinea pig trachea as donor organ for epithelial derived-relaxing factors and phenylepinephrine-precontracted rat anococcygeus muscle as assay tissue. Iravani and Zar (1993) found differential effects of nifedipine on nerve-mediated and noradrenalineevoked contractions of rat anococcygeus muscle. Rand and Li (1993) studied the modulation of acetylcholine-induced contractions of the rat anococcygeus muscle by activation of nitrergic nerves. Mudumbi and Leighton (1994) investigated the mechanisms of action of relaxation induced by bradykinin and by electrical field stimulation in isolated rat anococcygeus muscle, where contractile tone had been elevated with clonidine. Gwee et al. (1995) investigated the prejunctional and postjunctional inhibition of adrenergic transmission in the rat isolated anococcygeus muscle by cimetidine. Najbar et al. (1996) found that smooth muscle cells in the rat anococcygeus muscle are endowed with two distinct P-2-purinoreceptors which subserve contractions. De Godoy et al. (2003) evaluated the inhibitory effects of atropine and hexamethonium on the angiotensin-II-induced contraction of rat anococcygeus muscles. Pettibone et al. (1993) examined the inhibitory potency and selectivity of an oxytocin antagonist against oxytocin-stimulated contractions if the mouse anococcygeus muscle. Dehpour et al. (1993) and Radjaee et al. (1996) used isolated anococcygeus muscles from rabbits and found an extremely regular activity induced by methoxamine or clonidine. A.1.2.6 β 1-Sympatholytic Activity in Isolated Guinea Pig Atria ... PURPOSE AND RATIONALE The β-agonist isoprenaline (isoproterenol) induces an increase in the frequency and force of contraction of spontaneously beating isolated right atrias and potentiates contractions of electrically stimulated isolated left atria. Drugs with β-sympatholytic activity inhibit these isoprenaline-induced effects. β-receptor blocking activity of drugs can be evaluated in isolated right (a) and left (b) guinea pig atria. Since the heart contains predominantly β 1-adrenoreceptors, β 1-blocking activity is assessed by this test. PROCEDURE Pirbright White guinea pigs of either sex weighing 250–300 g are used. The animal is sacrificed by stunning and exsanguination. The heart is removed, the right or the left atrium is cut off and mounted in a 50 ml organ bath with a preload of 100 mg. The Henseleit solution is maintained at 32 °C and aerated with 95 % O2/5 % CO2. Contractions are recorded isotonically using a lever transducer (368 type B, Hugo Sachs Elektronik, Freiburg). Right Atrium After an equilibration period of 30 min, isoprenaline is administered into the organ bath to potentiate inotropy and frequency of the isolated right atrium. Cumulative doses of isoprenaline are added starting from a concentration of 0.05 μg/ml; consecutive doses are administered at 3 min intervals. When a stable maximum plateau of the effect is achieved, the organ bath is thoroughly flushed for 1 min; flushing is repeated twice 5 and 20 min later. The whole procedure is repeated with the same isoprenaline concentrations (control baseline values = 100 %). The test compound is then added into the organ bath and 5 min later, again isoprenaline is given at cumulative doses. If the test compound has β-receptor blocking activity (β-sympatholytic), higher isoprenaline concentrations are necessary to induce the same potentiation of inotropy and frequency or at the same isoprenaline concentrations added as before, the increase in inotropy and frequency is reduced. At the end of the experiment, again a cycle without test drug is performed. Left Atrium The left atrium is stimulated by a square wave stimulator with 2 impulses/s at a voltage of 15 V and an impulse duration of 1 ms. After an equilibration period of 30 min, the β-agonist isoprenaline is added at concentrations of 0.05–0.1 mg/ml. The organ bath is then thoroughly flushed for 1 min. Flushing is repeated twice 5 and 20 min later. The whole procedure is repeated with the same cumulative isoprenaline concentrations (control baseline values = 100 %) and flushing procedure. When a stable plateau of contractions is achieved, the test compound is added into the organ bath and 3 min later, isoprenaline is added again at cumulative concentrations. If the test compound has β-receptor blocking activity (β-sympatholytic), the isoprenaline-induced effects are inhibited. In addition, refractory period is determined before and after drug administration. EVALUATION a) Percent inhibition of (a) isoprenaline-induced or (b) electrically-induced and isoprenaline-potentiated increased inotropy and frequency by test drug is calculated as compared to pre-drug activity ( = 100 %). b) Percent change in refractory period is calculated. IC 50 values are determined from the individual dose–response curves. Statistical evaluation is performed by means of the paired t-test. Standard compounds: propranolol HCl, amrinon, nifedipine, and milrinone. MODIFICATIONS OF THE METHOD A detailed description of the use of isolated atrial preparations has been given by Levy (1971). Instead of the right atrium, Doggrell and Hughes (1986) used the isolated right ventricle of the rat for the assessment of the β-adrenoreceptor blocking activity of propranolol and investigated the competitive nature of the isoproterenol antagonism at various doses with Schild-plot analysis. Doggrell (1988) used the isolated left atria of the rat for simultaneous assessment of membrane-stabilizing and β-adrenoreceptor blocking activity. Berthold et al. (1990) described a method for testing cardiotonic sodium channel activators in isolated, electrically stimulated left guinea pig atria after potassium depolarization. Olson et al. (1995) studied the function of isolated rat left atria and papillary muscles and quantified the voltage-response relationship between punctate and field electrical stimulation after pretreatment with reserpine or β-blockers. A.1.2.7 β 2-Sympatholytic Activity in the Isolated Tracheal Chain ... PURPOSE AND RATIONALE Contraction of bronchial smooth muscle is induced by the cholinergic agonist carbachol. The carbachol effect can be antagonized by the β-agonist isoprenaline (isoproterenol). A compound has β-sympatholytic activity if the spasmolytic action of isoprenaline is inhibited. The β-sympatholytic effect of drugs can be evaluated in an in vitro model. Since the trachea contains predominantly β 2-adrenoreceptors, β 2-blocking activity can be assessed by this test. PROCEDURE Male PirbrightWhite guinea pigs weighing 250–300 g are used. The animals are sacrificed by stunning and exsanguination. The trachea is removed and cut into individual rings. Six rings are connected in series by means of short loops of silk thread. The tracheal chain is mounted in an 50 ml organ bath with a preload of 1 g for isotonic registration. To the nutritive solution (Tyrode) containing ascorbic acid and 1.0 g/L glucose, the α-receptor blocking agent phentolamine (0.1 μg/ml) and the spasmogen carbachol (80 ng/ml) are added. The solution is maintained at 34 °C and aerated with 95 % O2, 5 % CO2 Experimental Course After an equilibration period of 30 min, cumulative doses of 10–10 to 10−7 M of the spasmolytic agent isoprenaline are added. When maximal relaxation is obtained, the organ bath is flushed and the procedure repeated. After the two control relaxations with isoprenaline, the tissue is rinsed thoroughly and the first dose of the test compound is administered. Three min later, cumulative doses of isoprenaline are administered as before. Following a 10 min washout and recovery period, the next dose of the test compound is given. Up to 10 drug concentrations can be tested with one organ. Standard compounds: propranolol practolol EVALUATION Percent inhibition of isoprenaline-induced relaxation under drug treatment is calculated compared to maximal relaxation induced by isoprenaline alone (control = 100 %). A competitive antagonism of test compound is evaluated and can be quantitated from the dose–response curve. MODIFICATIONS OF THE METHOD O’Donnell and Wanstall (1980) used guinea pig tracheal preparations, where K+-depolarization was achieved by replacing all the Na+ in Krebs solution by an equivalent amount of K+ causing a sustained contraction of the preparations. A dose-dependent relaxation effect of isoprenaline could be obtained provided that the preparations were repolarized by washing in normal Krebs solution between curves. pA2 values were in good agreement with values obtained in other types of tracheal preparations. Guinea pig superfused trachea and dispersed tracheal cells have been used by Buckner et al. (1995) to compare the effects of isoproterenol and forskolin on immunologic and nonimmunologic histamine release. Lundblad and Persson (1988) found that epithelial removal is of little consequence for the pharmacology of the guinea pig tracheal open ring preparation in vitro. The rat portal vein has been recommended as model for assessment of β 2 adrenoceptor blocking activity of drugs by Doggrell (1990). A.1.2.8 Angiotensin Converting Enzyme Inhibition in the Isolated Guinea Pig Ileum ... PURPOSE AND RATIONALE The angiotensin-converting enzyme (ACE) is responsible for the formation of the active angiotensin II from the inactive angiotensin I. The same enzyme is responsible for the degradation of the active peptide bradykinin to inactive products. ACE activity can therefore be measured in two ways: activity of the newly formed angiotensin II and inhibition of the activity of bradykinin. ACE inhibition results in decreased activity of the precursor angiotensin I and potentiation of the bradykinin effect. The guinea pig ileum contracts in response to both peptides, angiotensin II and bradykinin, and can be used for quantitative determination of ACE inhibiting activity. PROCEDURE Guinea pigs of either sex weighing 300 to 500 g are used. They are sacrificed by stunning and exsanguination. The abdomen is opened with scissors. Just distal to the pylorus, a cord is tied around the intestine which is then severed above the cord. The intestine is gradually removed, and the mesentery is being cut away as necessary. When the colon is reached, the intestine is cut free. Below the cord, the intestine is cut halfway through, so that a glass tube can be inserted. Tyrode’s solution is passed through the tube and the intestine until the effluent is clear. Mesentery is cut away from the intestine that was joined to the colon. Pieces of 3 cm length are cut. Preferably, the most distal piece is used being the most sensitive one. This piece is fixed with a tissue clamp and brought into an organ bath with Tyrode’s solution at 37 °C being oxygenated with O2. The other end is fixed to an isometric force transducer (UC 2 Gould-Statham, Oxnard USA). Responses are recorded on a polygraph. Angiotensin I Antagonism After an equilibrium time of 30 min, angiotensin I is added in a concentration of 10 ng/ml bath solution. The force of contraction is recorded and the angiotensin I dosage is repeated once or twice until the responses are identical. Then the potential ACE inhibitor is added. After 5 min incubation time, again angiotensin I is added. The contraction is diminished depending on the activity of the ACE inhibitor. Bradykinin Potentiation Pieces of guinea pig ileum are prepared as described before. After an equilibrium time of 30 min bradykinin is added in a concentration of 15 ng/ml bath solution. The force of contraction is recorded and bradykinin additions are repeated once or twice until the response is identical. Then the potential ACE inhibitor is added. After 5 min incubation time, again bradykinin is added. The contraction is potentiated depending on the activity of the ACE inhibitor. EVALUATION Angiotensin I Antagonism The contraction after addition of the ACE inhibitor is expressed as percentage of contraction without the ACE inhibitor. Using various doses of the ACE inhibitor IC 50 values (concentrations inducing 50 % inhibition) are calculated. As standards ramipril, enalapril, and captopril are used. Bradykinin Potentiation The increase of the contraction after addition of the ACE inhibitor is expressed as percentage of contraction without the ACE inhibitor. As standard ramiprilate is used. CRITICAL ASSESSMENT OF THE METHOD The classical method of the isolated guinea pig ileum has been proven to be a reliable method for screening of potential ACE inhibitors. A.1.2.9 Contractile and Relaxing Activity on Isolated Blood Vessels Including Effects of Potassium Channel Openers ... PURPOSE AND RATIONALE The contractile process within the vascular smooth muscle results from an increase in the concentration of intracellular Ca2+. Inhibition of vasoconstriction occurs by addition of calcium antagonists or by removal of extracellular calcium. The vasorelaxing effects of compounds can be tested in isolated rodent arteries (pulmonary artery, thoracic aorta). Arterial rings or strips with or without endothelial lining are contracted with different agents, e. g., extracellular K+ and Ca2+, the α-adrenoceptor agonists phenylephrine and noradrenaline, the Ca2+ ionophore A23187 or the thromboxane receptor agonist U46619. Compounds with vasodilating activity antagonize the induced contractions. Potassium channel openers such as cromakalin, nicorandil, pinacidil or HOE 234 induce relaxation of contracted smooth musculature (Bolton et al. 1998). These effects are explained by data from patch clamp technique and ion flux experiments as well as by antagonism against potassium channel blockers. They indicate the potential use as antihypertensive and anti-asthmatic drugs (Hamilton andWeston 1989; Edwards and Weston 1990, 1993; Weston and Edwards 1992). The studies are complicated by the high diversity of potassium channels including ATP-sensitive, voltage-sensitive and Ca2+-activated channels (Mourre et al. 1986; Blatz and Magleby 1987; Ashcroft and Ashcroft 1990; Jan and Jab 1990; Pongs 1992; Wann 1993). Since each functional channel appears to consist of four different subunits, the possibility exists that there may be hundreds of different voltage-sensitive K channels, depending on their subunit composition. Ashcroft and Gribble (2000) discussed new windows on the mechanism of action of KATP channel openers. Glibenclamide is an antagonist of the ATP-modulated K+ channel allowing the localization of the binding sites (Eltze 1989; French et al. 1990; Mourre et al. 1990; Miller et al. 1991). PROCEDURE Male Pirbright White guinea pigs weighing about 400 g, or Chinchilla rabbits weighing about 3.5 kg, or Sprague–Dawley rats weighing 250–400 g are used as donor animals. The tested vessels are the thoracic aorta or the arteria pulmonalis. Materials and solutions Physiological salt solutions (PSS) [mM] PSS I PSS II PSS III NaCl 122 112 72 (92) KCl 5.0 5 40 (20) CaCl2 1.2 – – MgSO4 0.56 0.56 0.56 KH2PO4 1.2 1.2 1.2 NaHCO3 25 25 25 EDTA – 0.2 – glucose 12 12 12 Contracting agents K+ +Ca2+ 40 mM + 0.5 mM K+ +Ca2+ 20 mM + 0.5 mM U 46619 (thromboxane A2 analogue) 1 μM A 23187 (calcium ionophore) 5 μM noradrenaline 1 μM phenylephrine 0.1 μM acetylcholine 1 μM oxyhemoglobin 10 μM methylene blue 10 μM Animals are sacrificed by stunning and exsanguination. At least 4 isolated organs are tested per drug. The heart and the pulmonary artery are quickly removedand immersed in PSS I at room temperature. The artery is dissected into rings and endothelial cells are removed by gently rubbing the intimal surface. Spirally cut strips of 15–20 mm length and 1–1.5 mm width are suspended at a resting force of 380 mg in an organ bath containing 20 ml oxygenated (95 % O2, 5 % CO2) PSS I at 37 °C. Changes in length are recorded isotonically using a lever transducer (368 type B, Hugo Sachs Elektronic, Freiburg). To test the effect of compounds on vessels with intact endothelial lining, the thoracic aorta of rats is isolated and dissected free from surrounding tissue. Rings of 3 mm width are cut and suspended in the organ bath containing PSS I. Isometric force is measured with a force transducer (UC-2, Gould-Statham, Oxnard, USA) under a resting tension of 500 mg. The functional integrity of the endotheliumis tested before drug administration. One μM acetylcholine in the organ bath should result in a transient relaxation. After an equilibration period of 1 h, contraction of each vessel strip or ring is induced by addition of one of the contracting agents into the organ bath. To induce contractions of potassium-depolarized vessels, three different PSS solutions are used (PSS I for 30 min, PSS II for 3 × 15 min and PSS III). Contraction is induced in the presence of PSS III by adding 0.5 mM Ca2+ into the organ bath. When a stable plateau of contraction is achieved, cumulative concentrations of the test compound are added into the organ bath to obtain drug-response curves. Consecutive concentrations are added either at 1 h-intervals or when the response of the previous dose has reached a steady state level. In order to study the time course of relaxation and the duration of action, only one concentration is tested. To test whether the mechanism of action of a vasorelaxing agent is related to the liberation of nitric oxide, methylene blue or oxyhemoglobin (10 μM) are added to the organ bath 15–30 min prior to the cumulative administration of the test compound. Methylene blue or oxyhemoglobin block selectively NO induced relaxation. EVALUATION Mean values of relaxation ± SEM are calculated. The height of contraction before the first drug administration is taken as 100 %. IC 50 values are determined from the individual dose–response curves. IC 50 is defined as the dose of drug leading to a 50 % relaxation of the contraction induced by KCl or other agonists. Statistical evaluation is performed by means of the t-test. MODIFICATIONS OF THE METHOD Calderone et al. (1996) compared four rat aortic preparation (single ring, spiral strip, zig-zag strip, and multiple ring) on the basis of responses to noradrenaline and acetylcholine. They recommended the multiple ring preparation as the most suitable of all four for the study of vasoactive drugs because of the reproducibility of both contracturant and relaxing responses. Kent et al. (1982) used rat aortic strips contracted to a stable tension by either phenylephrine or barium chloride for comparison of vasodilators. Wilson et al. (1988) studied in isolated rings of rat aorta precontracted with noradrenaline the antagonism of glibenclamide against the vasorelaxation induced by cromakalin. Löhn et al. (2002) cannulated cerebral arteries from mice with glass cannulas on both sides, allowing an application of hydrostatic pressure to the vessel. Diameter was measured by using a videomicroscopic system (Nikon Diaphot, Düsseldorf, Germany) connected to a personal computer with appropriate software for detection of changes of vessel diameter (TSE, Bad Homburg, Germany). Nishimura and Suzuki (1995) tested the contractile responses to 5-HT in basilar arteries, superior mesenteric arteries and thoracic aortas from strokeprone spontaneously hypertensive rats in comparison to normal Wistar–Kyoto rats and found that that the hyperresponsiveness to 5-HT is mediated by different 5-HT receptor subtypes. Fouda et al. (1991) used the isolated tail arteries from rats. Differences of the vasoconstrictor response to potassium and norepinephrine between tail arteries from spontaneously hypertensive, renovascular hypertensive, and various strains of normotensive rats were found. Hamilton et al. (1986),Dacquet et al. (1987) studied the effects of calcium entry blockers in rat portal vein. Bråtveit and Helle (1984) studied the inhibition of vascular smooth muscle by vasoactive intestinal peptide (VIP) in the isolated rat portal vein. Shetty and Weiss (1987) studied the inhibition of spontaneous rhythmic movements and norepinephrine- induced tension responses in the rat portal vein. Edwards et al. (1991) compared the effects of several potassium-channel openers on rat bladder and rat portal vein in vitro. Smith et al. (1993) tested the ability of C-terminally truncated fragments of human α-calcitonin generelated peptide to relax mesenteric arteries precontracted with norepinephrine Chen et al. (1996) studied the contractile effects of noradrenaline and neuropeptide Y given alone or in combination on isolated rat mesenteric resistance vessels. Gurden et al. (1993) used guinea pig aorta relaxation for functional characterization of adenosine receptor types. Eltze (1989) studied the antagonism of glibenclamide against potassium channel openers in the isolated guinea pig pulmonary artery. Szentmiklósi et al. (1995) used circular segments from the proximal part of the main pulmonary artery of guinea pigs to study contractile and relaxant effects of adenosine receptors. Pikkers and Hughes (1995) examined the effect of hydrochlorothiazide on intracellular calcium concentration [Ca2+]i and tone in guinea pig mesenteric arteries. Vessels were mounted on a microvascular myograph and loaded with the Ca2+-sensitive fluorescent dye, Fura-2. Nishimura et al. (1998) used isolated aorta rings from Syrian hamsters. Contractile responses were recorded with an isometric transducer (TSE, Bad Homburg, Germany) and stored (TSE Data acquisition software). Meisheri et al. (1990) recommended the use of the isolated rabbit mesentery artery as a sensitive in vitro functional assay to detect K+-channel-dependent vasodilators. Mironneau and Gargouil (1979) studied the influence on electrophysiological and mechanical parameters of longitudinal smooth muscle strips isolated from rabbit portal vein by means of a double sucrose gap method associated with a photoelectric device for recording contractions. Lauth et al. (2001) performed superfusion assays with rabbit jugular vein. Four venous ring segments (3–4 mm long) were tested simultaneously by mounting them between force transducers and a rigid support for measurement of isometric force. Increasing doses of bradykinin were applied as bolus injections and the ensuing constrictor response was monitored with the aid of a PC-operated analysis System (Biosys, TSE, Bad Homburg, Germany). McBean et al. (1986, 1988) used isolated segments of the arteria basilaris of pigs to detect compounds with antivasoconstrictive properties. Contraction is elicited by PGF2α , serotonin or norepinephrine. Specimens are obtained from adult pigs (strain: Deutsche Landrasse) within 30 min after slaughter from the local slaughter house and stored in nutritive solution. The vessels are trimmed to a length of 4 mm, and the segments are suspended between 2 L-shaped metal hooks in a bath containing 20 ml modified Krebs Henseleit solution (NaCl 148 mM, KCl 5.4 mM, CaCl2 2.2 mM, NaHCO3 12 mM, glucose 12 mM). The bath solution is maintained at 37 °C and continuously gassed with carbogen to produce a resulting pH of 7.35–7.45. The preparation is incubated under a tension of 37.28mN (optimal passive load producing the largest contractile response to 3 × 10−6MPGF2α ). Following a 60minute stabilization period, the vessels are sensitized with 30 mM KCl for 10 min. The vessels are washed for 1minute, and allowed to recover for 30 min with additional 1 minute washes at 15 and 30 min. Thereafter, contractions of the vessels are induced by adding PGF2α at 3 × 10–6 M. The contractile response is allowed to plateau, then the test compound is administered at cumulative doses. For each test compound a dose–response curve is recorded. The EC 50 is obtained graphically or by means of a Hill plot. The EC 50 is defined as the dose of drug producing half maximal response. Werner et al. (1991) studied the vascular selectivity of calcium antagonists using porcine isolated ventricular trabeculae and right coronary arteries. Merkel et al. (1992) used isolated porcine coronary artery rings precontracted with prostaglandin F2α to demonstrate the vasorelaxant activity of an A1-selective adenosine agonist. Miwa et al. (1993) compared the effect of a K+-channel opener with cromakalim, nitroglycerin and nifedipine on endothelin-1-induced contraction of porcine coronary artery. Satoh et al. (1993) investigated in isolated porcine large coronary arteries whether or not the vasorelaxant actions of nicorandil and cromakalim would be selective using seven different vasoconstrictor agonists. Yokoyama et al. (1994) studied the vasodilating mechanisms of several pyridinecarboximidamide derivatives in isolated porcine coronary arteries. Makujina et al. (1995) described a procedure that facilitates the eversion of vascular smooth muscle. Vascular segments of porcine coronary artery, approximately 2 cm in length, were sutured to portions of polyethylene tubing inserted into the lumen of the vessel. After being secured and stabilized by the tubing, the vessel was everted while immersed in physiological buffer. Intracellular calcium concentrations (measured by fura-2AMfluorometry) and tension were registered simultaneously in everted rings denuded of endothelium. Izumi et al. (1996) tested a K+-channel opener and related compounds in isolated porcine coronary arteries contracted with 25 mM KCl. Frøbert et al. (1996) described impedance planimetry as a new catheter-based technique to measure porcine coronary artery pharmacodynamics and compared the results with the commonly used wiremounted isometric tension technique after in vitro application of nifedipine in various concentrations. A four-electrode impedance measuring system was located inside a 12-mm long balloon which was introduced into 3–4 cm long segments of the left anterior descending coronary artery obtained from 70–90-kg Danish Landrace-Yorkshire pigs. Hamel et al. (1993) dissected segments (3–4 mm long) of temporal ramifications of the middle cerebral artery from bovine brains and mounted them between two L-shaped metal prongs in a tissue bath containing Krebs-Ringer solution at 37 °C. Changes in muscle tension were measured by a force displacement transducer and recorded on a polygraph. Several 5-HT receptor agonists were tested for their ability to induce vasoconstriction and their potencies were compared to that of 5-HT. The authors concluded that bovine pial arteries appear to be the best available model for the human cerebrovascular 5-HT1D receptor. De la Lande et al. (1996) used isolated segments from proximal (4.5 mm i.d.) and distal (0.5 mm i.d.) bovine coronary arteries and found a heterogeneity of response to glyceryl trinitrate. The isolated human coronary artery was used to study the vasoconstriction by acutely acting antimigraine drugs (Saxena et al. 1996a, b, 1997) A.1.2.10 Isolated Guinea Pig Ureter ... PURPOSE AND RATIONALE The isolated guinea pig ureter shows phasic-rhythmic contractions after addition of KCl to the organ bath. Inhibition of this effect can be explained as a modulation of potassium channels. PROCEDURE Male unfasted guinea pigs weighing 400–500 g are sacrificed and both ureters removed immediately without the part directly connected to the pelvis in order to exclude the pacemaker region responsible for spontaneous activity. Each segment of 2 cm length is placed in a Petri dish containing Tyrode solution at 37 °C, freed of surrounding connective tissue and then suspended at a baseline tension of 0.5 p in a 25 ml organ bath containing Tyrode solution at 37 °C being aerated with 5 % CO2/95 % O2, pH7.4. Contractions are measured isometrically using Gould/Statham UC 2 transducers. After a 15 min equilibration period, KCl is added to the bath in a final concentration of 3 × 10−2 Mol/l and left in the bath for 2 min. KCl induces a constant series of phasic-rhythmic contractions without a rise in baseline tone. Subsequent washing causes the immediate disappearance of the rhythmic contractions. This addition of KCl is repeated and the values of these two experiments are used as initial values. The antagonistic activity is studied by addition of the test drug one min prior to the KCl challenge. Percentage of the following parameters are determined: mean height of contractions, frequency of contractions and the product of mean height and frequency of contractions. For interaction studies the potassium channel blocker glibenclamide 10–6 mol/l is added 1 min prior to the test drug. EVALUATION Arithmetic means and standard deviations of the data are calculated and compared with initial values using Student’s t-test. CRITICAL ASSESSMENT OF THE METHOD The isolated guinea pig ureter stimulated with KCl can be used for studies on the modulation of potassium channels. MODIFICATIONS OF THE METHOD Yoshida and Kuga (1980) recorded electrical activities in a preparation consisting of the pelvic region and the upper ureter of the guinea pig. Train field stimulation of the pelvic region evoked a train of nerve action potentials followed by a multiphasic smooth muscle action potential after a latency of about 2.5–8.0 s. This smooth muscle response was abolished by tetrodotoxin and dibucaine, and also by cholinergic blocking agents. The effects of veratridine and of yohimbine on the efflux of norepinephrine from electrically stimulated guinea pig ureters were studied by Kalsner (1992). Maggi and Giuliani (1994) studied the excitability and refractory period of the guinea pig ureter to electrical field stimulation. Roza and Laird (1995), Laird and Cervero (1996) studied the pressor responses to distension of the ureter in anesthetized rats as a model of acute visceral pain. A simple method for measurement of ureteric peristaltic function in vivo in anesthetized rats was published by Kontani et al. (1993). A.1.2.11 Isolated Corpus Cavernosum ... PURPOSE AND RATIONALE The isolated corpus cavernosum of rabbits has gained interest as pharmacological model since selective inhibitors of cyclic guanosine monophosphate (cGMP) phosphodiesterase type 5 (PDE5) were found to be effective in the treatment of erectile dysfunction in man (Ballard et al. 1996; Jeremy et al. 1997; Chuang et al. 1998; Liu et al. 1998; Turko et al. 1999; Wallis 1999;Wallis et al. 1999; Stief 2000; Aydin et al. 2001; Thompson et al. 2001; Lin et al. 2002). PROCEDURE Male New Zealand White rabbits weighing 3–4 kg are sedated with an intramuscular injection of 25 mg/kg ketamine + 6 mg/kg xylazine. Anesthesia is maintained by intravenous injection of 25 mg/kg nembutal. The penis is removed at the level of the attachment of the corporal bodies to the ischium. The corpus cavernosum (total length about 20 mm) is sharply dissected from tunica albuginea and two longitudinal strips with unstretched length about 10 mm are made from the proximal, more muscular portion. Corporal strips are placed in organ baths containing 10 ml Tyrode’s buffer (NaCl 124.9 mmol/l, KCl 12.5 mmol/l, MgCl2 · 6H2O 0.5 mmol/l, NaH2PO4 H2O 0.4 mmol/l, CaCl2 1.8 mmol/l and glucose 5.5.mmol/l) at 37 °C. Each tissue is equilibrated with a mixture of 95 % O2 and 5 % CO2 at pH 7.4. One end of each strip is connected to a force displacement transducer, and changes in muscle tension are measured and recorded with a polygraph. After zeroing and balancing transducers and strip chart, 2.0 g of tension is placed on each strip, and the strips are allowed to equilibrate for 30 min. Each strip is prestimulated with 10 μM phenylephrine, then relaxed by electrical field stimulation with square wave pulses of 80 V, 1 ms duration at 2–16Hz frequency. Then sodium nitroprusside (0.01–100 μM) is added ad NO donor. Finally, the standard (sildenafil 1 nM to 1 μM) or the test compound is added. EVALUATION The dose-dependent increase of relaxation after test compound and standard is measured. From dose–response curves activity ratios can be calculated. MODIFICATIONS OF THE METHOD Wallis et al. (1999) studied the inhibition of human phosphodiesterases PDE1 to PDE6 by sildenafil in various tissues, such as cardiac ventricle, corpus cavernosum, skeletal muscle and retina. Park et al. (1997) reported functional characterization of angiotensin II receptors in rabbit corpus cavernosum. Yildirim et al. (1997) investigated the effects of castration and testosterone on the constricting effect of phenylephrine and endothelium-dependent and - independent relaxing effects of different agonists in the corpus cavernosum of male rabbits. Liu et al. (1998) analyzed the pharmacological effects of in vitro ischemia on rabbit corpus cavernosum. Gupta et al. (1998) found that activation of Gi-coupled postsynaptic α 2-adrenoceptors causes contraction of smooth muscles in the corpus cavernosum of rabbits. Teixeira et al. (1998) used a bioassay cascade to study the effect of Tityus serrulatus scorpion venom on the rabbit isolated corpus cavernosum. Cellec and Moncada (1998) used the clitoral corpus cavernosum of female rabbits to study the role of nitrergic neurotransmission in non-adrenergic non-cholinergic relaxation responses. The isolated corpus cavernosum of rats has been used by Tong and Cheng (1997), Gemalmaz et al. (2001), and Wingard et al. (2003), of mice by Gocmen et al. (1997) and Mizusawa et al. (2001), of dogs by Hayashida et al. (1996), Comiter et al. (1997), of monkeys by Okamura et al. (1998), of horses by Recio et al. (1997). Studies in isolated human corpus cavernosum were performed by Holmquist et al. (1992), Bush et al. (1992), Rajfer et al. (1992), Cellek and Moncada (1997), Ballard et al. (1998), Omote (1999), Wallis et al. (1999), Lin et al. (2000), and Stief et al. (1998, 2000). In vivo studies measuring intracavernous pressure in rats were performed by Ari et al. (1996), Chan et al. (1996),Moody et al. (1997), Reilly et al. (1997), Chang et al. (1998), Mills et al. (1998), Gemalmaz et al. (2001), Takagi et al. (2001), Rajasekaran et al. (2005), and Wingard et al. (2006). Cashen et al. (2002) measured intracavernous pressure in anesthetized mice. In vivo studies on penile erection were performed in cats by Champion et al. (1997). Intracavernous pressure was measured in vivo in anesthetized dogs by Ayajiki et al. (1997), Sarikaya et al. (1997), Carter et al. (1998), and Noto et al. (2000). Bischoff and Schneider (2000) decribed a simple and quantitative model to study agents that influence penile erection in conscious rabbits. Erection was assessed by measuring the length of uncovered mucosa before and after the intravenous administration of agents. Anmals did not require anesthesia during the course of the study. A.1.3 Cardiovascular Analysis in Vivo A.1.3.1 Hemodynamic Screening in Anesthetized Rats ... PURPOSE AND RATIONALE The test is used to detect the effect of compounds on blood pressure and heart rate of anesthetized rats and to check for possible interference with adrenergic receptors. Antihypertensive agents with different mechanisms of action can be detected with this test. PROCEDURE Male Sprague–Dawley rats weighing 250–400 g are used. At least 2 animals are necessary for screening of one compound. The rats are anesthetized by intraperitoneal injection of 8 ml/kg of a solution of 8%urethane and 0.6 % chloralose. The trachea is cannulated to facilitate spontaneous respiration. Body temperature is maintained at 38 °C by placing the animal on a heating pad. The left femoral vein is cannulated for drug administration, which is standardized to injections of 0.2 ml/100 g body weight over a period of 1 min. For measurement of hemodynamic parameters and for intra-arterial administration of test compound, a cannula is inserted retrogradely into the right carotid artery. The tip of the catheter is positioned close to the origin of the subclavian artery. This allows most of the injected substances to reach the CNS via the vertebral artery before going into the general circulation. For continuous monitoring of blood pressure (systolic and diastolic pressure) and heart rate, the catheter is connected to a pressure transducer (Statham DB 23). When stable hemodynamic conditions are achieved for at least 20 min (control values), test boli of adrenaline (1 mg/kg) and isoprenaline (0.25 mg/kg) are administered. When baseline values are again established, increasing doses of the test substance (0.01, 0.1, 3.0 mg/kg) are given intra-arterially. In case of no effect, the interval between successive doses is 15 min, otherwise 60 min. To check for α- or β-blocking activity, adrenaline and isoprenaline administration is repeated after injection of the highest dose of test compound. If the test compound shows no effect, a standard antihypertensive compound is administered for control purpose. Hemodynamic parameters are recorded continuously during the whole experiment. EVALUATION Changes in blood pressure and heart rate after drug administration are compared to control values obtained during the 20 min pre-drug period. Maximal changes in BP and HR and duration of the effect are reported. The results are scored relative to the efficacy of standard compounds for the degree of the effect and the duration of the effect. Statistical significance is not tested because of the small number of animals used (n = 2, sometimes 3 or 4) but larger numbers of animals have to be used for quantitative evaluation. CRITICAL ASSESSMENT OF THE METHOD Due to the administration of the test compounds via the right common carotid artery not only peripherally acting vasodilators and neuron blockers but also compounds affecting the blood pressure regulating mechanisms in the CNS are detected. Bolus injections of adrenaline and isoprenaline reveal possible α- or β-antagonistic effects. Standard data: The following compounds at the doses indicated lead to a strong decrease in blood pressure: Clonidine 0.008 mg/kg Dihydralazine 1.0 mg/kg Phentolamine 3.0 mg/kg Prazosin 0.1 mg/kg Propranolol 1.0 mg/kg Urapidil 1.0 mg/kg Verapamil 0.1 mg/kg MODIFICATIONS OF THE METHOD Several authors (Mervaala et al. 1999; Wallerath et al. 1999; Rothermund et al. 2000; Baltatu et al. 2001) monitored arterial pressure and heart rate using a pressure transducer system and continuously recorded on a computer-based registration system (TSE, Bad Homburg, Germany). A procedure for differential intra-arterial pressure recordings from different arteries in the rat was described by Pang and Chan (1985). DeWildt and Sangster (1983) described the evaluation of derived aortic flow parameters measured by means of electromagnetic flowmetry as indices of myocardial contractility in anesthetized rats. Using a special Millar ultraminiature catheter pressure transducer and a thermodilutionmicroprobe, Zimmer et al. (1987, 1988) measured right ventricular functional parameters in anesthetized, closed-chest rats. Veelken et al. (1990) published improved methods for baroreceptor investigations in chronically instrumented rats. Salgado and Krieger (1988), de Abreu and Salgado (1990), Da Silva et al. (1994) studied the function of thebaroreceptor reflex in thiopental anesthetized rats. The left aortic nerve was isolated and supported by a bipolar stainless steel electrode and carefully insulated with silicone rubber. Carotid pressure was recorded simultaneously with aortic nerve discharges on an oscilloscope and monitored with a loudspeaker. King et al. (1987) developed a cross circulation technique in rats to distinguish central from peripheral cardiovascular actions of drugs. The right common carotid arteries were ligated, and the left common carotid arteries and left and right external jugular veins of two phenobarbital-anesthetized rats were connected with polyethylene tubing so that peripheral blood from one rat, A, supplied the head of another rat, B, and then returned to the body of A, and vice versa, for peripheral blood from rat B. Each rat was artificially ventilated with O2, the chest was opened, and both subclavian arteries were ligated. Prior to the ligation of the subclavian arteries, blood flow from rat A supplied its own brain and both brain hemispheres but not the brain stem of rat B. Following subclavian artery ligation, blood flow from rat A did not supply A’s brain, but supplied both hemispheres and brain stem of rat B. The head of each rat was, therefore, rendered dependent on the carotid arterial blood supply from another rat. This rat cross-circulation preparation can be used to separate the central and peripheral cardiovascular actions of drugs. Zavisca et al. (1994) studied the hypertensive responses to defined electrical and mechanical stimuli in anesthetized rats. Rats were given etomidate, 3.8 mg/kg/h intravenously following carotid artery and jugular vein cannulation.At 15 min after beginning the infusion, 4 types of noxious stimuli were administered sequentially at 1-min intervals: Type 1: Square electrical waves 125 cps, 1.6 ms, 2-s duration, varying current from 0.4 to 12 mA; Type 2: A single 10-mA electrical stimulus, 5-s train duration; Type 3: Tail clamping; Type 4: Skin incision. After each stimulus, maximum change in systolic blood pressure was measured. Graded electrical stimulation allowed the best quantitative evaluation of the hypertensive response to noxious stimuli. Hyman et al. (1998) described a novel catheterization technique for the in vivo measurements of pulmonary vascular responses in rats. Male Charles River rats weighing 26–340 g were anesthetized and strapped in supine position to a fluoroscopic table. They breathed air enriched with oxygen through an endotracheal tube inserted by tracheostomy. Catheters were inserted into the femoral blood vessels. The venous catheters were passed to the right atrium under fluoroscopy. A F-1 thermistor catheter was passed from the left carotid artery into the ascending aorta under fluoroscopy, and a PE-50, 150-mm plastic catheter with a specially constructed curved tip was passed fluoroscopically from the left jugular vein into the main pulmonary artery. A plastic radiopaque 22-gauge catheter 100 mm in length with a curved tip was passed with a 0.025 mm soft-tip coronary guiding catheter from the right jugular vein through the right atrium to the inferior vena cava. The coronary softtip guide was then withdrawn. A specially curved 102.5-mm transseptal needle, 0.4 mm in diameter, was then passed though the catheter. Both the needle and catheter were withdrawn into the superior portion of the right atrium under fluoroscopic guidance so that the needle and catheter both rotated freely. With the rat in a slight left anterior oblique position, the catheter and needle were carefully rotated anteriorly to the intraatrial septum. With gentle pressure, the catheter and needle can be felt and seen fluoroscopically to pass through the atrial septum. As the needle was withdrawn, the curve of the catheter permitted passage of the tip into the vein draining either the left or rightlower lobe. The catheter was carefully positioned near the pulmonary venoatrial junction and fixed in place. Mean pressures in the femoral artery, pulmonary artery and pulmonary vein at the venoatrial junction were measured with pressure transducers and recorded on a polygraph. Cardiac output was obtained in triplicate by delivering 0.1 ml normal saline at room temperature into the femoral venous catheter at the right venoatrial junction and determining thermodilution cardiac output with the thermistor catheter in the ascending aorta. Hayes (1982) described a technique for determining contractility, intraventricular pressure, and heart rate in the anesthetized guinea pig by inserting a needle, attached to a pressure transducer, through the chest wall into the left ventricle. Williams et al. (1995) used castrated male ferrets anesthetized by intramuscular injection of a mixture of 55 mg/kg ketamine and 4 mg/kg xylazine to measure the effects of a nonpeptidyl endothelin antagonist on endothelin-induced pressor responses. A.1.3.2 Blood Pressure in Pithed Rats ... PURPOSE AND RATIONALE The pithed rat has been proposed for assessing pressor substances by Shipley and Tilden (1947). The preparation is frequently used to evaluate drug action on the cardiovascular system since this preparation is devoid of neurogenic reflex control that may otherwise modulate the primary drug effect. PROCEDURE Male rats weighing 250–350 g are prepared for pithing under halothane anesthesia. The left carotid artery is cannulated for blood pressure monitoring and blood sampling. Furthermore, the trachea and the right jugular vein are cannulated. The rats are pithed inserting a steel rod, 2.2 mm in diameter and about 11 cm in length, through the orbit and foramen magnum down the whole length of the spinal canal. Via the tra190 cheotomy tube, the animals are ventilated with a small animal ventilation pump. Inspirated air is oxygen-enriched by providing a flow of oxygen across a Tpiece attached to the air intake of the ventilation pump (Harvard Apparatus model 680). The rats are ventilated at a frequency of 60 cycles/min with a tidal volume of 2 ml/100 body weight. Thirty min after pithing, a 0.3 ml blood sample is withdrawn from the carotid cannula and immediately analyzed for pO2, pCO2, pH, and derived bicarbonate concentration using an automatic blood gas analyzer. By alterations of the respiratory stroke volume of the pump, the values are adjusted to: pCO230–43 mm Hg, pH7.36–7.50, pO287–105 mm Hg. Continuous registration of blood pressure and cardiac frequency (Hellige He 19 device and Statham P 23 Db transducer) is performed via the left carotid artery. In order to measure α 1 and α 2 antagonism, first dose–response curves are registered using doses of 0.1–30 μg/kg i.v. phenylephrine (a selective α 1 agonist), and 1–1000 μg/kg i.v. BHT 920, (a selective α 2 agonist). The test drug is administered intravenously and the agonist dose–response curves are repeated again 15 min later. EVALUATION If the curve of blood pressure response to the agonists is shifted, dose–response curves are plotted on a logarithmic probit scale and potency ratios are calculated. MODIFICATIONS OF THE METHOD Gillespie andMuir (1967) described a method of stimulating the complete sympathetic outflow from the spinal cord to blood vessels in the pithed rat by coating those parts of the pithing rod which lay in the sacral and cervical region of the spinal cord with highresistance varnish to restrict stimulation to the thoracolumbar region. The steel rod is insulated with an adhesive throughout its length except for a 5 cm section which provides sufficient a stimulation area of the lower thoracolumbar nerves. For stimulating nerves fibers supplying exclusively the heart, a pithing rod is used which is insulated throughout its length except for a 0.5 cm section 7 cm proximal to the tip. The spinal cord is stimulated electrically using the pithing rod as the cathode and a hypodermic needle which is inserted under the skin near the right hind-limb, as the anode. Varying the intensity and/or the duration of the stimulation, dose–response curves can be registered which are altered after treatment with drugs. Curtis et al. (1986) described an improved pithed rat method by mounting the preparation vertically with the head pointing downward resulting in considerably higher blood pressure and heart rate. MacLean and Hiley (1988) studied the effect of artificial respiratory volume on the cardiovascular responses to an α 1- and α 2-adrenoceptor agonist in the air-ventilated pithed rat using microsphere technique and analysis of arterial blood gases and pH. Trolin (1975) used decerebrated rats to study the clonidine-induced circulatory changes. Balt et al. (2001) compared the angiotensin II type 1 (AT1) receptor blockers losartan, irbesartan, telmirsatan and the ACE inhibitor captopril on inhibition of angiotensin-II-induced facilitation of sympathetic neurotransmission in the pithed rat. A.1.3.3 Antihypertensive Vasodilator Activity in Ganglion-Blocked, Angiotensin II Supported Rats ... PURPOSE AND RATIONALE The method is used to demonstrate direct vasodilator activity of potential antihypertensive agents. The experimental model is an anesthetized, ganglion-blocked rat whose blood pressure is maintained by an intravenous infusion of angiotensin II. The test allows to differentiate between centrally acting antihypertensives and peripheral vasodilators. PROCEDURE Male Wistar rats weighing 275–450 g are anesthetized with a combination of urethane (800 mg/kg) and chloralose (60 mg/kg) administered intraperitoneally in a volume of 10 ml/kg. Following induction of anesthesia, chlorisondamine (2.5 mg/kg) is injected into the peritoneal cavity to abolish sympathetic and parasympathetic nerve activity. The right femoral artery is cannulated to monitor blood pressure (Statham pressure transducer P23Db) and heart rate. Both femoral veins are cannulated to administer drugs or infuse angiotensin II. The trachea is intubated and animals are allowed to breathe spontaneously. Following a stabilization interval of 10–15 min, angiotensin II is infused at a rate of 0.25 or 3.5 μg/min in a volume equivalent to 0.05 ml/min (Harvard infusion pump). After an increase of blood pressure, a new elevated steady-state pressure is established within 15–20 min. Drugs are subsequently injected intravenously over an interval of 3 min in a volume of 2 ml/kg. Mean arterial pressure is recorded on a polygraph at 5, 10, 15, 20 and 30 min after initiation of drug administration. Seven to 9 animals are used for each drug and dose level studied. α -adrenoreceptor blockade can be determined in ganglion-blocked rats. Pressor responses to graded doses of phenylephrine injected intravenously are obtained before and 15 min after administration of test compounds. Sufficient concentrations of phenylephrine have to be given to ensure a rise in mean arterial blood pressure of 50 mm Hg or more. Data obtained from 5 or 6 animals are averaged and resultant doseresponse curves plotted. The dose of phenylephrine required to elicit a 50 mm Hg increase in mean arterial blood pressure is interpolated from dose response curves. Standard data: The following compounds are used as standards and, at the doses indicated, lower mean arterial blood pressure by about 50 mm Hg: Cinnarizine 3.0 mg/kg, i.v. Hydralazine 1.0 mg/kg, i.v. Minoxidil 10.0 mg/kg, i.v. Saralasine 0.03 mg/kg, i.v. Molsidomine 0.1 mg/kg, i.v. EVALUATION Mean values ± SEM are given for mean arterial blood pressure and heart rate. Changes of these parameters after drug administration are compared to control values obtained immediately before the application of the test compound. Statistical significance is assessed by means of the paired t-test. CRITICAL ASSESSMENT OF THE METHOD A hypotensive response in this model appears to correlate more closely with antihypertensive activity in DOCA-salt hypertensive rats than does a vasodilator response in the perfused hind limb of anesthetized dogs and allows a distinction between central anti-hypertensive and vasodilators. MODIFICATIONS OF THE METHOD Santajuliana et al. (1996) developed a standard ganglionic blockade protocol to assess neurogenic pressor activity in conscious rats. Rats were instrumented with arterial and venous catheters for measurement of arterial pressure and heart rate and for administration of three different ganglionic blockers (trimethaphan, hexamethonium, and chlorisondamine). A.1.3.4 Blood Pressure in Conscious Hypertensive Rats (Tail Cuff Method) ... PURPOSE AND RATIONALE Rats with spontaneous or experimentally induced hypertension are widely used for screening of potentially antihypertensive compounds. The indirect tail cuff method allows the determination of systolic blood pressure according to the following principle: The cuff is quickly inflated to well above suspected systolic blood pressure; the pulse will then be obliterated. Thereafter, pressure in the cuff is slowly released and, as the pressure falls below systolic blood pressure, the pulse will reappear. The method is analogous to sphygmomanometry in human and can be applied not only at the tail of awake rats but also in dogs and small primates. The indirect tail cuff method is widely used to evaluate the influence of antihypertensive drugs in spontaneously and experimentally hypertensive rats. PROCEDURE Male spontaneous hypertensive rats (Charles River) weighing 300–350 g or rats with experimentally induced hypertension are used. Surgical Procedure to Induce Renal Hypertension Male Sprague–Dawley rats weighing 80–100 g are anesthetized by intraperitoneal injection of 0.8 ml 4 % chloralhydrate solution. Both kidneys are exposed retroperitoneally. To induce renal hypertension, a silver clip (0.2 mm diameter, 4 mm length) is placed onto both renal arteries, the kidneys are reposed and the wound is closed by suture. Within 5–6 weeks, operated animals attain a renal hypertension with a systolic blood pressure (BPs) of 170–200 mm Hg (mean normal physiological BPs for rats is 100 mm Hg). Only animals with a BPs = 180 mmHg are used for the tests. Test Procedure The procedure is the same for spontaneously and experimentally hypertensive rats. Groups of 6 animals are used per dose. The control group receives saline only. To reduce spontaneous variations in blood pressure, animals are adjusted to the experimental cage by bringing them into the restraining cage which is enclosed in a 31–32 °C measuring chamber 3–4 times before the start of the experiment for a period of 30–60 min. To measure blood pressure, a tubular inflatable cuff is placed around the base of the tail and a piezoelectric pulse detector is positioned distal to the cuff. The cuff is inflated to approximately 300 mm Hg. As the pressure in the cuff is slowly released, the systolic pressure is detected and subsequently recorded on a polygraph. The test substance is administered intraperitoneally or by gavage once per day over a period of 5 days. The usual screening dose of a new compound is 25 mg/kg. Blood pressure and heart rate measurements are taken at the following times: day 1: predose and 2 h postdrug day 3: predose and 2 h postdrug day 5: predose, 2 h postdrug and 4 h postdrug. Between measurements, animals are returned to their home cages. Standard compounds: endralazine (3 mg/kg p.o.) nifedipine (3 mg/kg p.o.) urapidil (5 mg/kg p.o.) EVALUATION Mean values in systolic blood pressure before and after drug administration and the duration of the effect are determined. Percent decrease in systolic blood pressure under drug treatment is calculated. Statistical significance is assessed by the Student’s t-test. Scores for%decrease in systolic blood pressure and for the duration of the effect are allotted. CRITICAL ASSESSMENT OF THE METHOD The indirect tail-cuff method is being used in many laboratories with many modifications of the devices. Pfeffer et al. (1971) found a good correlation between values obtained with the indirect tail-cuff method and values measured directly with indwelling carotid arterial cannulae, whereas Buñag et al. (1971) reported a lack of correlation between direct and indirect measurement of arterial pressure in unanesthetized rats and Patten and Engen (1971) found difficulties to measure accurate systolic values at higher blood pressure. A good correlation between direct blood pressure data from the carotid artery in rats and readings with the tail cuff method was found by Matsuda et al. (1987) who developed a six-channel automatic blood pressure measuring apparatuswith a highly sensitive photoelectric sensor for the detection of tail arterial blood flow and a microcomputer system for automatic measurement of systolic blood pressure and heart rate and for data acquisition and processing. MODIFICATIONS OF THE METHOD Details of the tail-cuff method in rats have been discussed by Stanton (1971). Special equipment for measuring blood pressure in rats is commercially available (e. g., TSE GmbH, Bad Homburg, Germany). Widdop and Li (1997) described a simple versatile method for measuring tail cuff systolic blood pressure in conscious rats. A tail cuff consisting of a metal Tpiece tube with latex rubber inside the tube is placed around the tail at the proximal end. A piezoelectric transducer (model MLT1010) is strapped to the ventral surface of the tail to record the pulse signal from the caudal artery and connected directly to a MacLab data-acquisition system ADInstruments Pty Ltd.). The tail-cuff method for measurement blood pressure has been adapted for dogs, monkeys (Wiester and Iltis 1976), and cats (Mahoney and Brody 1978). Blood pressure can be measured from the hind leg of the rat using a leg cuff and a photoelectric cell situated at the dorsal surface of the foot (Kersten et al. 1947). When the leg is occluded, the foot swells and the amount of light striking the photocell is reduced. When the pressure in the cuff is released, the arterial blood flow is restored, the increase of foot volume is decreased and the amount of light transversing the paw increases. A.1.3.5 Direct Measurement of Blood Pressure in Conscious Rats with Indwelling Catheter ... PURPOSE AND RATIONALE Themethod first described byWeeks (1960) allows the direct measurement of arterial pressure in conscious rats eliminating the influence of anesthesia on cardiovascular regulation. PROCEDURE Preparation of Cannulae In order to prepare the cannulae 7 cm and 12 cm long pieces are cut from PE 10 and PE 20 tubings respectively. A stylet wire is inserted into the PE 10 tubing and the PE 20 tubing is also slipped over the stylet wire. The ends of the tubings are heated in a current of hot air and fused together. Ridges are made to anchor the cannula in the animal’s tissue. In order to make a ridge, the stylet wire is left inside the cannula and the cannula is heated in a fine jet of hot air. When the polyethylene at the point of heating becomes soft, the cannula is pressed slightly and thus a ridge is formed. One ridge is formed at the PE 20 tubing, about 0.5 cm away from the junction with the PE 10 tubing, and 3 more ridges are formed on the PE 20 tubing at a distance of about 1 cm from each other, first one being situated about 3 cm away from the free end of the PE 20 tubing. The stylet wire is then removed from the cannula and the PE 10 portion of the cannula near the junction with the PE 20 tubing is wound around a glass rod with a diameter of 4 mm. Two rounds are made. Then it is dipped in a boiling water bath for about 5 s. When taken out of the bath, the cannula retains its circles, forming a spring-like structure. Implantation of Cannulae Male Sprague–Dawley rats weighing about 300 g are used. The rat is anesthetized with 45 mg/kg pentobarbital i.p. The area of the neck and the abdomen are shaved and cleaned with 70 % alcohol. The viscera are exposed through a midline abdominal incision. A segment of the abdominal aorta is exposed just above the bifurcation. A trocar is passed through the psoas muscles adjacent to this segment of the aorta, through the muscles of the back and under the skin until it emerges from the skin of the neck. Then the cannula is inserted into the trocar and the trocar is withdrawn from the body. The end of the cannula thus comes out from the neck, being anchored by silk sutures to the neck skin and to the psoasmuscle. The cannula is filled with heparin solution and the end which is projecting out from the neck skin is blocked with a tight fitting stainless steel needle. Then the other end of the cannula is implanted into the aorta. The aorta is wiped with a cottontipped applicator stick above the bifurcation, occluded above this segment and puncturedwith a bent 27 gauge hypodermic needle. The tip of the PE 10 catheter is inserted through the needle and advanced up the aorta. The intestines are replaced and the wound sutured. The rats are allowed to recover for one week. Measurement of Blood Pressure The occluding stainless steel needle is removed and the cannula flushed with diluted heparin solution. The rat is placed in a small cage to restrict its movements, even so it is free to move. The cannula is connected to a Statham P 23Db pressure transducer and blood pressure is recorded on a polygraph. Test drugs or standards are administered either subcutaneously or orally. Recordings are taken before and after administration of drug over a period of 1 h. EVALUATION Changes of blood pressure are measured for degree and duration. Five rats are used for each dose and compound. The maximal changes of each group are averaged and compared with the standard. CRITICAL ASSESSMENT OF THE METHOD Direct measurement of arterial blood pressure in unanesthetized rats originally introduced by Weeks (1960) has become a valuable and widely used tool in cardiovascular research. MODIFICATIONS OF THE METHOD A detailed description of a slightly modified Week’s method has been given by Stanton (1971). Improvements of the method for continuous direct recording of arterial blood pressure and heart rate in rats have been described by Buñag et al. (1971), Laffan et al. (1972), Buckingham (1976),Garthoff and Towart (1981), Garthoff (1983). A detailed description of permanent cannulation of the iliolumbar artery was given by Remie et al. (1990). Wixson et al. (1987) described a technique for chronic catheterization of the carotid artery in the rat. Prepared cannulas are commercially available (IRC Life Science, Woodland Hills CA). A newer modification uses the access to the aorta via the common carotid artery (Linz et al. 1992). Rats are prepared under thiopental anesthesia with arterial PE-50 lines (Intramedic from Clay Adams, USA). The lines are introduced into the ascending aorta via the right carotid artery for direct measurement of arterial blood pressure and into the jugular vein for i.v. application of test compounds. Both lines, filled with saline containing heparin, are surfaced on the neck. The animals are allowed to recover for at least 2 days. Blood pressure is monitored through Statham R P23Db transducers connected to a recording device. During measurements the lines are kept open with counter current saline infusion at a rate of 1 ml/h. Bao et al. (1991) placed one catheter via the right femoral artery in the abdominal aorta in rats for recording mean arterial pressure and two additional catheters via the left carotid artery into the descending aorta for application of bradykinin and bradykinin antagonists. Arterial pressure was recorded in unanesthetized rats after induction of severe hypertension by complete ligation of the aorta between the origin of the renal arteries by Sweet and Columbo (1979). Hilditch et al. (1978) described a device for the direct recording of blood pressure in conscious dogs. Akrawi and Wiedlund (1987) described a method for chronic portal vein infusion in unrestrained rats. Hepatic drug metabolism can be studied by infusion into the portal vein and blood collection from the femoral vein. Robineau (1988) described a method for recording electrocardiograms in conscious, unrestrained rats. Electrodes were implanted subcutaneously and a socket connector was sutured on the head of the animal. A flexible cord leading to a swivel collector was linked to an ECG amplifier. Kurowski et al. (1991) reported on an improved method to implant, maintain, and protect arterial and venous catheters in conscious rats for extended periods of time. Schenk et al. (1992) measured cardiac left ventricular pressure in conscious rats using a fluid-filled catheter. Tsui et al. (1991) recommended a reliable technique for chronic carotid arterial catheterization in the rat. Hagmüller et al. (1992) described a tail-artery cannulation method for the study of blood parameters in freely moving rats. Liebmann et al. (1995) described an in vivo long-term perfusion system which is based on 195 tomated, computer-controlled high-frequency heparin (10 U/ml) flushing of a cannula inserted into the tail artery of freely moving rats. Santajuliana et al. (1996) used conscious rats instrumented with arterial and venous catheters to assess neurogenic pressor activity after administration of ganglionic blockers. Rezek and Havlicek (1975) described simple cannula systems for the infusion of experimental substances in chronic, unrestrained animals. A cannula with a removable cap is used for infusions into various parts of the digestive tract. Intravenous infusions can be performed through a closed system cannula which avoids a possible introduction of air into the circulation. Kimura et al. (1988) described a method for chronic portal venous, aortic, and gastric cannulation to determine portal venous and aortic glucose and lactate levels in conscious rats. A.1.3.6 Cannulation Techniques in Rodents ... PURPOSE AND RATIONALE Cardiovascular pharmacology requires special techniques for catheterization and permanent cannulation of vessels. A few methods are described below. A comprehensive literature survey on methods for vascular access and collection of body fluids from the laboratory rat was written by Cocchetto and Bjornsson (1983). A.1.3.6.1 Permanent Cannulation of the Jugular Vein in Rats PURPOSE AND RATIONALE Permanent cannulation of the jugular vein in rats in combination with a head attachment apparatus allowing easy connection of cannulae was first introduced by Steffens (1969). Modifications were described by Brown and Hege (1972), Nicolaidis et al. (1974) and by Dons and Havlik (1986).A detailed description was given by Remie et al. (1990). PROCEDURE Rats are anesthetized with N2O2/O2/halothane. The shaven neck of the animal on the right side is disinfected with chlorhexidine solution. The incision is made just above the right clavicle. Connective and adipose tissue are pushed aside with blunt forceps and the jugular vein is exposed. The external jugular vein is followed and the division into the maxillary vein, the facial and the linguofacial vein identified. The largest vein is chosen and mobilized for a distance of about 5 mm. Small artery forceps are used to clamp the vessel. The vein is then ligated rostral to the clamp with 6–0 silk, and a second ligature is put loosely around the vessel, but not tightened. Using iridectomy scissors, a V-shaped hole is cut in the vein 2 mm rostral from the bifurcation. Prior to its insertion into the vessel, a sterile cannula is connected to a 1 ml syringe filled with a heparinized saline solution. The vessel is dilated by means of a sharp pointed jeweler’s forceps, the cannula slit between the legs of the forceps and gently pushed into the vessel until the tip is at the level of the right atrium. Then the forceps is removed, the caudal ligature gently tied, and the rostral ligature used to anchor the cannula to the vessel. The cannula is tunneled to emerge at the top of the head. While the skin in the neck is held firmly, the artery forceps is inserted subcutaneously in caudal direction over a distance of about 3 cm, then turned anti-clockwise in the direction of the incision in the neck. The cannula is grasped with the forceps. Then the forceps is pulled back until the cannula emerges at the crown of the head and closed by a small microvascular clamp. The cannula is slid over the short end of a 20G stainless steel needle bent to a 90° angle. The catheter is flushed with saline and filled with polyethylene/heparin solution. The long end of the L-shaped stainless steel adapter is closed with a piece of heat-sealed PE-tubing and the wounds are closed with sutures. MODIFICATIONS OF THE METHOD Hutchaleelaha et al. (1997) described a simple apparatus for serial blood sampling from the external jugular vein which permits simultaneous measurement of locomotor activity in freely moving rats. A.1.3.6.2 Permanent Cannulation of the Renal Vein in Rats PURPOSE AND RATIONALE A detailed description for permanent cannulation of the renal vein in rats was given by Remie et al. (1990). PROCEDURE Rats are anesthetized with N2O2/O2/halothane. After opening the abdominal wall, the intestines are lifted out and laid next to the animal on the right side (as viewed by the surgeon) on gauzemoistened with warm saline solution. This provides an excellent view to the vena cava. At its confluence with the vena cava, the right renal vein is stripped of its adipose tissue and the peritoneum is opened. Using small anatomical forceps the peritoneum is detached from the vena cava by making small spreading movements with the forceps just beneath the peritoneum. Subsequently, the vena cava and the renal vein are mobilized for approximately 1.5 cm, to allow for clamping of the vessel. A four or five fine-stitch purse-string is placed in the vessel at the confluence of the vena cava and the right renal vein. Using a Barraquer needle holder and a cottonwool stick, the 7–0 silk suture, armed with a BV-1 needle, is guided through the vessel. After each stitch, any bleeding has to be immediately arrested by applying light pressure using a cotton-wool stick. Having completed the suture a single knot is made with the drawstrings. Three microvascular clips are then placed on the vena cava and the renal vein; first the proximal clip on the vena cava, followed by the clip on the renal vein and finally the distal vena cava clip. A small aperture is cut immediately inside the purse-string suture using iridectomy scissors and jeweler’s forceps. The cannula, which is filled with a heparinized saline solution, is pushed into the opening as far as possible. quently, the purse-string suture is pulled taut and the clip of the renal vein removed, while pushing the cannula further. The proximal clip on the vena cava is now removed as quickly as possible. The patency of the cannula is checked and the drawstrings of the pursestring suture are used to anchor the cannula. The cannula is laid kink-free in the abdominal cavity and sutured to the internal abdominal cavity near the xiphoid cartilage. The abdomen is closed in two layers and the cannula tunneled to the top of the head. The cannula together with a L-shaped adapter is fixed to the skull. A.1.3.6.3 Permanent Cannulation of the Portal Vein in Rats PURPOSE AND RATIONALE Several techniques have been described for cannulation of the portal vein in rats (Hyun et al. 1967; Pelzmann and Havemeyer 1971; Suzuki et al. 1973; Sable-Amplis and Abadie 1973; Helman et al. 1984). A detailed description for permanent cannulation of theportal vein in rats was given by Remie et al. (1990).After additional application of platinum electrodesaround the portal vein in close proximity to the cathetertip, this model can also be used to study the presynaptic regulation of neurotransmitter release from nonadrenergic nerve terminais (Remie and Zaagsma 1986;Remie et al. 1988, 1989). PROCEDURE Rats are anesthetized with N2O2/O2/halothane. Afteropening the abdominal wall, the intestines are liftedout and laid next to the animal on the right side(as viewed by the surgeon) on gauze moistened withwarm saline solution. Using a micro needle holderand a cotton-wool stick, a four or five, fine stitchpurs-estring suture (7–0 silk suture armed with a BV-1 needle) is placed in the wall of the portal vein at theside opposite the gastroduodenal vein. The diameterof the purse-string should be about 1 mm. After the suture has been completed a single knot is made with thedrawstrings. The portal vein is clamped with a smallcurved hemostatic bulldog clamp. Using iridectomyscissors and a pair of jeweler’s forceps the center of thepursestring is cut, a cannula filled with heparinizedsaline is inserted into the vessel and pushed upwards.The purse-string is gently tightened taking care not toobstruct the cannula. The drawstrings of the suture areused to anchor the cannula. The cannula is laid kink-free in the abdominal cavity and sutured to the internal abdominal cavity near the xiphoid cartilage. Theabdomen is closed in two layers and the cannula tunneled to the top of the head. The cannula together witha L-shaped adapter is fixed to the skull. A.1.3.6.4 Permanent Cannulation of the Thoracic Duct in Rats PURPOSE AND RATIONALE Collection of lymph is rather difficult and has per-formed mainly in dogs (Biedl and Offer 1907;Gryaznova 1962,1963; Vogel 1963). Some techniqueshave been described for the rat (Bollman et al. 1948;Girardet 1975). Remie et al. (1990) did not obstructthe duct by placing a purse-string suture in the wallof the duct, by which the cannula is secured. The animal’s lymph can be collected during the experiment,and after refilling the cannula the lymph flow remainsundisturbed. PROCEDURE Rats are anesthetized with N2O2/O2/halothane. Afteropening the abdominal cavity, the intestines are placedin gauze moistened with warm saline and laid to theleft of the animal. The suprarenal abdominal artery islocated and mobilized by gently tearing the connective tissue. Using blunt dissection technique, the thoracic duct is mobilized along the dorsolateral surfaceof the aorta. A small three to four fine stitch purse-string suture is placed in the wall of the duct, usinga 9-0Ethilon suture. A hole is cut inside the purse-string with a very fine pair of scissors, while holding the wall with angled jeweler’s forceps. The cannula which is filled with heparinized saline solutionand is inserted into the duct using anatomical forceps.After the tip of the cannula has been inserted intothe thoracic duct, the curved forceps are removed andthe total tip is pushed into the duct. The ligature isthen closed and some lymph will flow into the cannula. The cannula is secured within the abdominalcavity by attaching it to the abdominal muscle nearthe xiphoid cartilage with a 7–0 silk suture. Following the closure of the abdominal wall and the tunneling of the cannula to the crown of the head, a L-shaped adapter is placed on the cannula, filled withPVP-solution and closed with a heat-sealed polyethylene cap. A.1.3.6.5 Portacaval Anastomosis in Rats PURPOSE AND RATIONALE In 1877 the Russian surgeon Eck reported the achieve-ment of successful portacaval shunts in dogs. Lee andFischer (1961), Funovics et al. (1975), de Boer et al.(1986), described portacaval shunt in the rat. A de-tailed description of surgery for portacaval anastomo-sis in rats was given by van Dongen et al. (1990). PROCEDURE Rats are anesthetized with N2O2/O2 in combinationwith either enflurane, methoxyflurane or isoflurane.After opening the abdominal wall, the intestines areplaced left to the animal on gauze moistened withwarm saline solution. Proximally and distally to theanimal's right renal vein, the vena cava is then strippedof its adipose and connective tissue, and the retroperi-toneal cavity is opened. Using anatomical forceps theperitoneum is dissected from the vena cava by making small spreading movements with the forceps justabove the vena cava. The portal vein is pulled slightlyto the left using straight anatomical forceps and freedfrom the hepatic artery and the gastroduodenal arterywith curved anatomical forceps. Rostral to the celiacartery, the abdominal artery which is covered withperitoneum is freed from its lateral muscle bed overa length of approximately 5 mm providing enoughspace for placing a small bulldog clamp at a later stageof the operation. Without occlusion a six fine-stitchpurse-string is placed in the wall of the vena cavaclose to its confluence with the right renal vein. Using a Barraquer needle holder and a cotton wool stick,the 7–0 silk suture armed with a BV-1 needle is guidedthrough the vessel. After each stitch, bleeding has tobe arrested immediately, by applying light pressureon the area, again using the cotton wool stick. Afterthe suture has been completed, a single knot is madewith the drawstrings. The drawstrings should come to-gether at the rostral part of the purse-string. A bulldog clamp, modified to resemble a Satinsky vascularclamp, is then placed on the vena cava. Before clamping the abdominal aorta rostral to theceliac artery with a small bulldog clamp, a ligature(7–0 silk) is placed around the portal vein as close aspossible to the hilus of the liver. Subsequently, theclamp is placed on the aorta and the ligature tightened. A Heifetz clip is then placed transversely ontothe portal vein at its confluence with the gastroduo-denal vein. The portal vein is cut just distally fromthe ligature. A prepared button is slipped over the left-hand straight small anatomical forceps, while the right-hand forceps are used to pass the portal vein to thelefthand anatomical forceps. The vein is then graspedand pulled through the button. Subsequently, the button is pushed as close as possible to the Heifetz clip,and clamped to the clip using a Pilling bulldog clamp. Using small straight, and curved anatomical forcepsthe portal vein is reversed around the button and fixedwith a previously prepared 7–0 silk suture. The Pillingbulldog clamp is then removed and replaced at the endof the Satinsky clamp for reasons of stability. The vena cava is then somewhat elevated, bringing it into closercontact with the portal vein button. A longitudinal cut is made in the purse-string suture using iridectomy scissors and jeweler’s forceps.One drawstring of the suture is clamped with a smallhemostat and put under slight tension in a rostral direction. The button manipulated by its grip, is pushedinto the vena cava. The purse-string is tightened withthe left hand whilst the right hand still holds the button in position. The button is released and two additional knots tied. The Satinsky clamp is removed firstfollowed by the Heifetz clamp and the bulldog clampon the aorta. After replacing the intestines the abdominal wall is closed in two layers. A.1.3.7 Cardiovascular Analysis in Anesthetized Mice ... PURPOSE AND RATIONALE To fully utilize the potential of mouse models with specific gene mutations, it is necessary to study the functional consequences of genetic manipulations in fullyintact mice. Lorenz and Robbins (1997) developed andvalidated a methodology to study cardiovascular pa-rameters in closed-chest mice. PROCEDURE Adult mice of either sex weighing 25–35 g are anesthetized by intraperitoneal injection of 50 mg/kg ketamine and 100 mg/kg thiobutabarbital. After the miceare placed on a thermally controlled surgical table withbody temperature continually monitored via a rectalprobe, a tracheotomy is performed with a short length(< 1 cm) of PE-90 tubing. The right femoral artery isthen cannulated with polyethylene tubing which ispulled over a flame to a small diameter (~0.4 mm OD).The catheter is advanced ~ 1 cm, near the level ofthe aorta, and connected directly to a low-compliance COBE CDXIII fixed-dome pressure transducerfor the measurement of arterial blood pressure. Theright femoral vein is then cannulated with the sametype of small-diameter tubing and connected to a microinjection pump for the infusion of experimentaldrugs. To assess myocardial performance, the rightcarotid artery is cannulated with a 2 F Millar MIKROTIP transducer (Model SPR-407, Millar Instruments,Houston TX). This high-fidelity transducer, which hasa tip diameter of ~0.67 mm, has a reported frequencyresponse that is flat up to 10,000 Hz and therefore canbe used to accurately monitor the high frequency ofthe mouse ventricular pulse pressure. During continual monitoring of the blood pressure wave to ascertain the anatomic position of the catheter, the tip of thetransducer is carefully advanced through the ascendingaorta and into the left ventricle. When the stable waveform of the ventricular pressure profile is achieved,the transducer is anchored in place with 7–0 silk sutures. After completion of the surgery, all woundsare closed with cyanoacrylate to minimize evaporativeloss of fluid, and the animals are allowed to stabilizefor 30–45 min. EVALUATION Blood pressure signais from the COBE transducer andfrom the Millar transducer are amplified and the output is recorded and analyzed with a MacLab 4/s dataacquisition system connected to a Macintosh 7100/80computer which allows the calculation of the following parameters: dP/dt first derivative of the ventricular pressurewave, MAPmean arterial pressure,HR heart rate, LVP systolic and diastolic left ventricular pressure, LVEDP left ventricular enddiastolic pressure, Further indices of ventricular performance can be calculated from dP/dt. MODIFICATIONS OF THE METHOD Champion et al. (2000) described a right-heart catheterization technique for in vivo measurement of vascular responses in lungs of intact mice. CD1 miceweighing 25–38 g were anesthetized with thiopento-barbital (85–95 mg/kg i.p.) and ketamine 3 mg/kg i.p.)and were strapped in supine position to a thermoregulated fluoroscopic table. The trachea was cannulatedand the animals breathed with room air enriched with95%O2/5%CO2. A femoral artery was cannulatedfor the measurement of systemic arterial pressure.Heart rate was electronically monitored from the systolic pressure pulses with a tachometer (Grass model7P44A). The left jugular vein was cannulated for theadministration of agonists and antagonists. For measuring pulmonary arterial pressure, a special single lumen catheter was constructed. Thecatheter was 145 mm in length and 0.25 mm in outerdiameter, with a specially curved tip to facilitate passage through the right heart, main pulmonary artery,and the left or right pulmonary artery. Before thecatheter was introduced, the catheter curve was initially straightened with a 0.010-in. straight angioplastic guide wire to facilitate passage from the right jugular vein into the right atrium at the tricuspid valve under fluoroscopic guidance. As the straight wire wasremoved, the natural curve facilitated entry of thecatheter into the right ventricle. A 0.010-in. soft-tipcoronary artery guide wire was then inserted, andthe catheter was passed over the guide wire into themain pulmonary artery under fluoroscopic guidance.Pressure in the main pulmonary artery was measuredwith a pressure transducer, and mean pulmonary arterypressure was derived electronically and recorded continuously. Cardiac output was measured by the thermodilutiontechnique. A known volume (20 pl plus catheter deadspace) of 0.9 % NaCl solution at 23 °C was injectedinto the right atrium, and changes in blood temperature were measured at the root of the aorta. A cardiacoutput computer equipped with a small-animal interface was used. The thermistor microprobe was insertedinto the right carotid artery and advanced to the aorticarch, where changes in aortic blood temperature weremeasured. A catheter placed in the right jugular veinwas advanced to the right atrium or main pulmonaryartery for rapid bolus injection of saline. The salinesolution was injected with a constantrate syringe toensure rapid and repeatable injection of the saline indicator solution. Thermodilution curves were recordedon a chart recorder mechanisms in transgenicTGR(mREN2)27 rats. Br J Pharmacol placementwas verified by postmortem examination. A.1.3.8 Blood Pressure in Anesthetized Cats ... PURPOSE AND RATIONALE Cats are the most sensitive species of cardiovascular regulation. They were used extensively for cardiovascular screening. Recently, experiments in dogs are preferred since this species can be bred more easily in homogeneous strains. PROCEDURE Adult cats of either sex weighing 2.5 to 4 kg are anesthetized by intraperitoneal injection of 35 mg/kg pentobarbital sodium. Tracheotomy is performed and a tracheal cannula is inserted so that the cat can be mechanically ventilated with room air. A femoral artery and two femoral veins are cannulated for measurement of arterial blood pressure and systemic administration of drugs. The arterial cannula is connected to a Statham model P23Gb transducer. All recordings are made on a polygraph. Heart rate is determined with a Beckman Cardiotach connected to a voltage/pressure-pulse coupler. Rectal temperature is monitored and maintained between 37 °C and 38 °C with a heating pad. The following drugs are injected i.v. as challenges: epinephrine 0.1, 0.3, 0.5 μg/kg, norepinephrine 0.1, 0.3, 0.5 μg/kg, isoproterenol 0.1, 0.2, 0.4 μg/kg, carbachol 0.1, 0.2, 0.5 μg/kg. At least 5 min are allowed between challenge doses to permit the measured parameters to return to baseline. Test drugs are injected at various doses followed by injections of the challenging drugs. EVALUATION Dose–response curves of challenging drugs are established before and after injections of the test drugs. CRITICAL ASSESSMENT OF THE METHOD Blood pressure experiments in anesthetized cats are very valuable as screening techniques for cardiovascular agents. Moreover, potentiation of norepinephrine response has been used as screening procedure for antidepressants with norepinephrine uptake inhibiting activity. MODIFICATIONS OF THE METHOD Sander (1965) investigated the vasoconstrictor and vasodilator effects of procaine in spinal cats. The animals were anesthetized with ether and ventilated with a positive pressure pump via a tracheal cannula. The spinal cord was then cut between the second and third vertebrae, and ether administration stopped. The remaining portion of the spinal cord above the transection was destroyed by passing a curette through the spinal canal. Yardiey et al. (1989) studied cardiovascular parameters in spinal cats. The animals were anesthetized with 80 mg/kg intravenousiy administered α- chloralose. The spinal cord was transected or crushed at the first cervical segment after tetracaine hydrochloride (0.125 mg in 0.1 ml) had been injected into this region of the cord. Systemic blood pressure was supported at a level sufficient to maintain constricted pupils (mean value 45 ± 5 mm Hg) by volume expansion with blood from a donor (10–20 ml) or an infusion of dextran. A.1.3.9 Cardiovascular Drug Challenging Experiments in Anesthetized Dogs ... PURPOSE AND RATIONALE Sympathomimetic and cholinomimetic compounds as well as angiotensin II and carotid occlusion exert characteristic responses in blood pressure of anesthetized dogs. Antagonism or potentiation of these responses allow to characterize the cardiovascular activity of a new compound. PROCEDURE Adult Beagle dogs of either sex weighing between 8 and 15 kg are anesthetized with 15 mg/kg sodium thiopental, 200 mg/kg sodium barbital and 75 mg/kg sodium pentobarbital. Additional doses of sodium pen- tobarbital are given as needed. The dogs are intubated with a cuffed endotracheal tube and placed on a Harvard respirator (20 ml/kg, 10-15cycles/min). A femoral vein and artery are cannulated using polyethylene tubing for drug administration and determination of arterial blood pressure, respectively. The animals are bilaterally vagotomized. The arterial cannula is connected to a Statham model P23Gb transducer. All recordings are made on a polygraph. Heart rate is determined with a Beckman Cardiotach connected to a voltage/pressure-pulse coupler. Drug challenges: One of the following combinations of drugs is administered i.v. to the dogs. The challenges are given in a fixed order: at least twice prior to test drug administration to insure consistent responses and again starting 15 min post test drug. Epinephrine and norepinephrine (1 μg/kg), isoproterenol (0.25 μg/kg), carbachol (0.25 μg/kg), tyramine (100 μg/kg) are used; bilateral carotid occlusion (45 s), phenylephrine (10 μg/kg), isoproterenol (0.25 μg/kg) angiotensin II (0.2 μg/kg) and carbachol (0.25 μg/kg) for cardiovascular drugs. At least 5 min are allowed between challenge doses to permit the measured parameters to return to baseline. Challenge drug doses are sometimes varied to keep the mean arterial pressure within the following limits: epinephrine (+30 to +60 mm Hg), norepinephrine (−30 to +70 mm Hg), tyramine (+30 to +70 mm Hg), isoproterenol (−30 to −50 mm Hg), carbachol (−30 to −50 mm Hg), phenylephrine (−30 to +70 mm Hg), angiotensin II (+30 to +50 mm Hg), and bilateral carotid occlusion (+30 to +70 mm Hg). EVALUATION The recordings are studied to detect any changes in the arterial pressure response to the challenge drug before and after test-drug administration and to observe any changes in blood pressure and heart rate. Results are expressed as the percentage change from the predrug response. A.1.3.10 Hemodynamic Analysis in Anaesthetized Dogs ... PURPOSE AND RATIONALE The hemodynamic effects of compounds supposed to affect the cardiovascular system are evaluated by measuring preload and afterload of the heart, contractility, heart rate, cardiac output and peripheral or coronary flow. To measure these cardiovascular parameters accurately, the use of larger animals such as dogs or pigs is necessary. This experimental model allows the classification of test drugs according to their action as having: positive inotropic effects negative inotropic effects (Ca2 + −antagonist, antiarrhythmic?) hypertensive effects hypotensive effects coronary-dilating effects β -blocking effects α-blocking effects anti-anginal effects peripheral-vasodilating effects PROCEDURE Male or female inbred Beagle or Labrador-Harrier dogs weighing between 15 and 25 kg are used. They are anesthetized with a bolus injection of 35–40 mg/kg pentobarbital, and continued with an infusion of 4-6 mg/kg/h. A catheter is placed into the cephalic vein for intravenous injections. Another catheter is placed into the duodenum for enteral administration. Respiration is maintained with room air through a tracheal tube using a positive pressure respirator, e. g., Bird-Mark-7-respirator. Blood gas analyses are performed at regular time intervals. Oxygen is supplied via the respirator as needed. Preparation for Hemodynamic Measurements Blood pressure is recorded through a cannula inserted into the left femoral artery and connected to a Statham pressure transducer (Statham P 23 DB). For determination of LVP, a Millar microtip catheter (type PC 350) is inserted via the left common carotid artery into the left ventricle. LVEDP is measured on a high-sensitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate is counted. The LVP-signal also triggers a cardiotachometer. Cardiac output, pulmonary artery pressure (PAP) and stroke volume are measured by a thermodilution technique using a Cardiac Output Computer (Gould/Statham SP 1245) and a balloon-tip triple lumen catheter (Gould SP 5105,5 F) with the thermistor positioned in the pulmonary artery via the jugular vein. Myocardial oxygen consumption (MVO2) is calcu- lated as pressure-work-index according to Rooke and Feigl (1982). Femoral blood flow and coronary flow are measured with electromagnetic flow probes attached to the femoral artery and the circumflex branch of the left coronary artery (LCX), respectively. Experimental Course When stable hemodynamic conditions and blood gas values of pO2 > 100 mm Hg and pCO2 < 35 mm Hg are achieved for at least 20 min (control values), the test substance is administered through a catheter inserted into a cephalic vein in doses of 0.1, 0.3, 1.0, and 3.0 mg/kg or into the duodenum in doses of 0.3, 1.0, 3.0, and 10.0 mg/kg. All parameters are recorded continuously during the whole experiment. Characteristics blood pressure left ventricular pressure, LVP left ventricular enddiastolic pressure, LVEDP maximal rate of pressure rise, dp/dt max systolic, BPs diastolic, BPd heart rate, HR peripheral blood flow in A. femoralis, PF blood pressure A. pulmonalis, PAP coronary flow, CF cardiac output, CO stroke volume, SV total peripheral resistance, TPR left ventricular stroke work, LVSW left ventricular minute work, LVMW left ventricular myocardial oxygen consumption, MVO2 CALCULATION OF RESULTS AND EVALUATION Besides the different directly measured hemodynamic parameters, the following data are calculated according to the respective formulae stroke volume [ml/beat], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ SV = \frac{{CO}}{{HR}} $$\end{document} total peripheral resistance [dyns/cm5], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ TPR = \frac{{BPm}}{{CO}} \times 79.9 $$\end{document} left ventricle stroke work [J/beat], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ LVSW = (BPm - LVEDP) \times SV \times 0.333 \times 10^{ - 3} $$\end{document} left ventricular minute work [J/min], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ LVMW = LVSW \times HR $$\end{document} left ventricular myocardial oxygen consumption [mlO2/min/100 g], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \begin{array}{l} MVO_2 = K_1 (BPs \times HR) + K_2 \\ \qquad \qquad \; \times \frac{{(0.8BPs + 0.2BPd) \times HR + SV}}{{BW}} + 1.43 \\ \end{array} $$\end{document} K 1   = 4.08×10 -4 K 2  = 3.25.08×10 -4 BPs = systolic blood pressure [mm Hg] BPd = diastolic blood pressure [mm Hg] BPm = mean blood pressure [mm Hg] HR = heart rate [beats/min] CO = cardiac output [ml/min] SV = stroke volume [ml/beat] LVEDP = left ventricular enddiastolic pressure [mm Hg] BW = body weight [kg] Changes in parameters measured after drug administration are compared to control values obtained during the 20 min pre-drug period. Results are presented as mean ± SEM with n > 3. Statistical significance is assessed by means of the paired t-test. MODIFICATIONS OF THE METHOD The effect of drugs on the carotid artery occlusion effect can be studied in anesthetized dogs. The occlusion of right and left common carotid arteries is performed by squeezing them between a polyethylene tubing and a twine which is passed inside the tubing and around the carotid artery. An occlusion of the carotid arteries for 30 s causes an increase of systolic blood pressure by 40–50 mm Hg. Inhibition of this effect by drugs is tested. Studies in anesthetized dogs can be used to determine the influence of cardiotonic drugs on propranolol induced cardiac insufficiency (Rajagopalan et al. 1993) Instead of dogs, pigs (German landrace) weigh- ing between 20–35 kg can be used. They are pre- treated with ketamine 500 mg/5 ml i.m., methomidate hydrochloride 200 mg/4 ml i.p., xylazine 60 mg/3 ml i.m., and anaesthetized with 15–20 mg/kg pentobarbital sodium, followed by continuous infusion of 12 mg/kg/h. The parameters are evaluated similarly to the experiments in dogs. Measurement of cardiac output by the thermodilution method in rats was described by Richardson et al. (1962) and Müller and Mannesmann (1981). Thermodilution methods were used by Rosas et al. (1964) in anesthetized rats, by Carbonell et al. (1985) and by Salyers et al. (1988) in conscious rats to determine hemodynamic parameters. Oxygen pressure, carbon dioxide pressure and pH in coronary venous and common carotid arterial blood of anesthetized dogs has been measured using a blood gas analyzer (Aisaka et al. 1988). Acute ischemic left ventricular failure can be induced in anesthetized dogs by repeated injections of plastic microspheres into the left coro– nary artery (Smiseth and Mjøs 1982; Sweet et al. 1984; Schölkens et al. 1986). A coronary catheter was introduced through the right femoral artery and advanced under fluoroscopy to the left coro- nary ostium, guided by injection of small amounts of contrast medium. After reaching baseline values, acute left ventricular failure was induced by subsequent intra-coronary injections of plastic micro- spheres (52.9 ±2.48 μm non-radioactive tracer micro- spheres). The microspheres were suspended in saline with a drop of Tween 80 and sonified before use, 1 mg microspheres/1 ml saline corresponding to ap- proximately 12,000 microspheres. (13–16 injections of microspheres or 3.4-5.0 mg/kg). Microspheres were injected every 5 min for 70–90 min. Each microsphere injection effected an immediate and stepwise increase in LVEDP. With this procedure, LVEDP can be in– creased to a desired level in a very controlled manner. In the 30 min following embolization, LVEDP contin– ued to increase by approximately 5 mm Hg. Animal with arrhythmias had to be excluded from the study. Thirty min after the end of embolization, when hemodynamic parameters had stabilized, drug administrations were started. Valdes-Cruz et al. (1984) developed an open-chest preparation in dogs to validate the accuracy of a two- dimensional Doppler echocardiographic method for estimating pressure drops across discrete stenotic obstructions. In order to assess the potential of a single breath technique (using freon-22) as an effective way to es- timate cardiac output non-invasively, Franks et al. (1990) measured simuitaneousiy with the single breath technique the aortic flow using an electromagnetic flowmeter in anesthetized dogs. A.1.3.11 Hemodynamic Measurements in Conscious Dogs ... PURPOSE AND RATIONALE The potency of a cardiovascular drug depends on the direct effects at the cellular level and on the response of the cardiovascular control mechanisms. The latter are often markedly influenced by anesthesia. The chroni- cally instrumented conscious dog with renal hypertension is therefore a more realistic test model to eval- uate the effects of antihypertensive, anti-anginal and cardiotonic compounds. The test is used to evaluate hemodynamic drug effects in conscious dogs, an experimental model with chronic arterial and ventricular catheterization and renal artery constriction. PROCEDURE Male or female Labrador-Harrier dogs weighing 15–25 kg are used. They are anaesthetized with 1 mg/kg xylazine i.m., followed by 1 mg/kg xy- lazine i.v. and 18 mg/kg pentobarbital sodium i.v. For chronic instrumentation and induction of renal hypertension, fluid-filled catheters are implanted into the abdominal aorta and into the left ventricle. The catheters are tunneled subcutaneously and exteriorized on the nape of the neck dorsally. Renal hypertension is induced by placing silastic constrictors around both renal arteries. Hemodynamic measurements are performed after a two-week recovery period or later. To familiarize the dogs to the test surroundings, they are brought into the laboratory 2–3 times before the start of the study. Thus, drug testing is possible with- out sedation. During the experiment the animal rests quietly on a laboratory table. Experimental Protocol Hemodynamic measurements are performed by connecting the two implanted catheters to Statham pressure transducers. Pressure signais, electronically differentiated LVP dp/dt max and heart rate are recorded with a polygraph. After reaching stable hemodynamic conditions for at least 20 min (control baseline values), the test compound is administered either orally in a gelatin capsule or by intravenous injection into the cephalic vein. Hemodynamic parameters are recorded continuously starting 30 min before to 120 min after drug administration, and thereafter at 1 h intervals until 6 h after dosage. EVALUATION The following parameters are monitored: systolic blood pressure [mm Hg] diastolic blood pressure [mm Hg] left ventricular enddiastolic blood pressure, LVEDP [mm Hg] left ventricular pressure at dp/dt max [mm Hg/s] heart rate [beats/min] Mean values ± SEM are calculated with n > 3 as differences to pre-drug control values. MODIFICATIONS OF THE METHOD Mann et al. (1987) described a simple procedure for direct blood pressure measurement in conscious dogs using the Vascular-Access-Port™, consisting of a 33 x 13 mm reservoir body affixed to a silicon rubber catheter. Müller-Schweinitzer (1984) described a method for the assessment of vasoconstrictor agents by recording venous compliance in the conscious dog. Changes in the diameter of the canine saphenous vein, produced by inflation to 45 mm Hg of a sphygmomanometer cuff placed on the upper hind leg, were recorded. Hintze and Vatner (1983) compared the effects of nifedipine and nitroglycerin in conscious dogs, in- strumented for instantaneous and continuous measure- ments of coronary arterial and left ventricular di- ameters with an ultrasonic dimension gauge, arterial and left ventricular pressure with implanted miniature gauges, and coronary blood flow with an electromag- netic flowmeter or a Doppler ultrasonic flowmeter. Shimshak et al. (1986) studied the recovery of regional myocardial contractile function after a 10 min coronary artery occlusion in chronically instrumented conscious dogs. Wright et al. (1987) described a minimally invasive technique which allows assessment of histamine H1 - receptor antagonist activity in conscious dogs based on the inhibition of tachycardia caused by intravenous administration of the H1–receptor agonist, 2–pyridylethy– lamine. Hashimoto et al. (1991) studied the coronary ef- fects of nicorandil in comparison with nitroglycerin in chronic conscious dogs instrumented with ultrasonic crystals and electromagnetic flowmeters in the circum- flex coronary artery. Hartman and Waritier (1990) described a model of multivessel coronary artery disease using conscious, chronically instrumented dogs. A hydraulic occluder and Ameroid constrictor were implanted around the left anterior descending and the left circumflex coro- nary arteries. Pairs of piezoelectric crystals were im- planted within the subendocardium of the left anterior descending and the left circumflex coronary artery perfusion territories to measure regional contractile func- tion. A catheter was placed in the left atrial appendage for injection of radioactive microspheres to measure regional myocardial perfusion. Hof et al. (1990) used the Doppler method for measuring cardiac output in conscious rabbits. Grohs et al. (1993) simuitaneousiy assessed car- diac output with pulsed Doppler and electromagnetic flowmeters during cardiac stimulation. A.1.3.12 Hemodynamic Studies in Monkeys ... PURPOSE AND RATIONALE Prior to studies in human beings, studies of cardiovascular effects of new drugs in monkeys are necessary in some instances. PROCEDURE Rhesus monkeys of either sex, weighing between 5 and 8 kg are anesthetized with 20 mg/kg ketamine hy- drochloride followed by 50 mg/kg pentobarbital-Na given slowly i.v. A small side-branch of the femoral or radial artery is surgically exposed and cannulated for blood pressure recordings using a blood pressure transducer (P23ID). Heart rate is determined from a con- ventional ECG lead by a biotachometer. Compounds are administered either intravenously or via a gastric fibroscope, e. g., Olympus XP10, into the duodenum under visual control. The cardiovascular parameters are registered for a pretest period of 30 min and then during 60 min after intravenous administration or 2 h after intragastric administration of the test drug. Three to 6 animals are used for evaluation. EVALUATION Mean values ± SD are calculated for the pretest pe- riod and for the cardiovascular effects every min for 5 min after i.v. administration and then every 5 min. After intragastric administration the values are regis- tered every 5 min up to 30 min and then every 10 min. The values after administration of the test compound are compared statistically with the pretest values using the Student’s t-test. MODIFICATIONS OF THE METHOD Lacour et al. (1993) studied cardiovascular parameters in conscious cynomolgus monkeys (Macaca fascicularis). A silicone catheter (internai and external diameter 0.64 and 1.19 mm, respectively) was implanted under aseptic conditions into the thoracic aorta via a carotid artery after the monkeys had been anesthetized with 40 mg/kg ketamine and 0.5 mg/kg acepromazine intramuscularly. The vascular catheter (filled with an aqueous solution of 40 % polyvinylpy- rolidone and 20 % heparin) was inserted into a carotid artery. A patch of silicone was sewn around the artery to maintain the catheter in position, the latter being routed subcutaneously and exteriorized at the top of the head into a stainless steel connector. This connec- tor was fixed to the skull with screws and dental cement, and sealed with a plug to protect the catheter from damage. The monkeys were permitted a 3-week minimum recovery period. Before the experiment was performed the monkeys were placed in a primate-re- straining chair on several occasions, of gradually in- creasing duration, for experiment acclimatization. Pulsatile arterial pressure was recorded by connecting the arterial catheter to a polygraph via a Statham P23Id pressure transducer. Mean arterial pressure and heart rate were derived from the pulse pressure signal and recorded. A catheter was inserted acutely into a saphenous vein for administration of compounds. A.1.3.13 Measurement of Cardiac Output and Regional Blood Flowwith Microspheres ... PURPOSE AND RATIONALE The microsphere technique allows the measurement of cardiac output and regional blood flow. Using different radionuclides, repeated determinations are possible. The method is applicable not only for dogs, cats, and minipigs (Hof et al. 1980) but also for rats (McDe- vitt and Nies 1976; Bonnacrossi et al. 1978; Ishise et al. 1980; Stanek et al. 1985) using microspheres of appropriate size. PROCEDURE Male Sprague–Dawley rats weighing 265–375 g are anesthetized with 35 mg/kg i.p. pentobarbital. The right carotid and right femoral arteries are cannulated. Using pressure monitoring, a carotid cannula is manip-ulated into the left ventricle. Carbonized microspheres (15 ± 5μdiameter) labelled with 85Sr are drawn into a glass injection chamber and suspended in 0.3 ml 6 % dextran so that each chamber contains 60000 to 80,000 microspheres. The radioactivity in each cham- ber is determined by gamma scintillation counting be- fore and after microsphere injection, the difference being the amount of radioactivity injected. The microspheres are injected into the left ventricle in a total volume of 0.8 ml 6 % dextran over 20 s. Simuitaneousiy, arterial blood from the femoral artery is withdrawn at 0.8 ml/min for 90 s with a syringe withdrawal pump. EVALUATION This reference blood sample is used to calculate the cardiac output by the formula: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \begin{array}{l} {\rm cardiac}\;{\rm output} = {\rm counts}\;{\rm injected} \\ \times \frac{{{\rm reference}\;{\rm sample}\;{\rm withdrawal}\;{\rm rate}}}{{{\rm reference}\;{\rm sample}\;{\rm counts}}} \\ \end{array} $$\end{document} After obtaining the reference sample, the animals are sacrificed with pentobarbital and the organs dissected, placed in counting vials, and counted for 5 min. Regional distribution of the cardiac output is calculated by comparing the radioactivity in each organ with the total injected radioactivity. Organ flow is determined by multiplying the cardiac output by the fractional distribution of the cardiac output to the organ. CRITICAL ASSESSMENT OF THE METHOD Problems associated with the microsphere technique in rats are the hemodynamic effects of the solutions used to inject the microspheres and the effects of blood withdrawal after repeated determinations (Stanek et al. 1985). MODIFICATIONS OF THE METHOD For repeated determinations, other nuclides have been used, such as 46Sc, 51Cr, 141Ce, 125I (Hof et al. 1980). Koách et al. (1992) used up to 5 radiolabelled microspheres (57Co, 113Sn, 85Sr, 95Nb and 46Sc) for measurement of regional cerebral blood flow in cats. Faraci and Heistad (1992) measured blood flow with radioactive microspheres (15μdiameter) labeled with 46Sc, 95Nb,153Gd, 85Sr, and 141Ce in anesthetized rabbits. Grover et al. (1990), Gross et al. (1992) measured myocardial blood flow in dogs with the radioactive mi- crosphere technique. Kowallik et al. (1991) measured regional myocar- dial blood flow with multiple colored microspheres. The method yielded values very similar to those ob- tained with radioactive microspheres. A.1.3.14 Carotid Artery Loop Technique ... PURPOSE AND RATIONALE The carotid loop method, originally described by van Leersum (1911) for rabbits has been used by several authors (e. g., Child and Glenn 1938; Valli et al. 1967; O'Brien et al. 1971; Meyer et al. 1989) for measurement of blood pressure or blood sampling in conscious dogs and sheep (Lagutchik et al. 1992). PROCEDURE Male or female inbred Beagle or Labrador-Har- rier dogs weighing between 15 and 25 kg are used. They are anesthetized with a bolus injection of 35–40 mg/kg pentobarbital, and continued with an infusion of 4–6 mg/kg/h. The animal is placed on a heated op- erating table. The skin on the ventral side of the neck is carefully shaved and disinfected. The course of the carotid artery is outlined by palpation along the tracheal border. About 2 cm of skin is taken on each side marking the width of the flap. The medial incision is made slightly above the thyroid cartilage and is extended caudal to a point about 1 cm lateral and 1 cm above the manubrium sterni. The lateral incision again lies about 2 cm from the line of the carotid artery and parallel to it. The lateral incision is only half as long as the medial one. The incisions are made down to the subcutaneous tissue over the platysma muscle. Between the skin and the muscle, the flap is under- mined. All bleeding points are carefully clamped and tied. The subcutaneous tissue, the platysma myoides muscle and the anterior fascia of the neck are incised in the course of the midline incision down to the plane of cleavage between the sternohyoid and sternomastoid muscle. By blunt dissection, these muscles are separated, disclosing at their depth the neurovascular bun- dle over which lies the internal jugular vein. The floor of the space so isolated is formed by the longus capitis muscle. By careful dissection, these muscles are separated at least 1 cm above and below the limits of the incision in the skin. The superior thyroid artery marks the uppermost portion of the carotid artery suitable for exteriorization. The plane of cleavage is followed caudal to the origin of the sternocleidomastoid muscle at the manubrium sterni. Throughout the limits of the incision the artery is dissected free from the internal jugular vein and then from the vagus nerve. The first step in the exteriorization of the artery is the reapproximation of the muscle borders beneath the vessel by mattress sutures. In order to prevent tension on the completed loop due to contraction of the ster– nomastoid and sternohyoid muscle, it is important to reapproximate these muscles throughout their course. Sutures are placed at the edges of skin. The tubu- lar flap of skin is then approximated loosely around the carotid artery. It is essential that the skin flap fits loosely around the artery. A continuous suture of fine silk is started at the place where the vessel emerges from the muscle borders. The suture is so placed as to include the artery in a sling of skin which isolates the vessel from the line of suture of the underside of the completed loop. Finally, the proximal and distal quar- ters of the flap are closed with sutures, while the skin tube is closed with a continuous suture. Antibiotics are given locally and systemically. One thickness of gauze is placed beneath the loop and along each border a strip of gauze in order to re- lieve the loop from the pressure caused by the reminder of dressings. Around the neck is wrapped a gauze bandage several turns of which have passed behind the forelimbs in order to prevent the dressing from rid- ing upwards on the animal’s neck. Over this is placed a plaster roll protecting the loop from the animal's efforts of scratching. The dressings are changed on the fifth and seventh day when the sutures can be removed. Blood pressure measurements can be made accord- ing to Riva-Rocci’s principle by placing a inflatable cuff around the loop. CRITICAL ASSESSMENT OF THE METHOD The carotid artery loop method needs some surgical experience and very meticulous caretaking of the ani- mals. MODIFICATIONS OF THE METHOD Lewis et al. (1980) placed a CO2 sensor using mass spectrometry and its through flow cuvette in a common carotid artery-to-jugular vein loop in anesthetized cats. Meyer et al. (1989a, b) studied pulmonary gas exchange in panting dogs with an exteriorized carotid artery loop. Kaczmarczyk et al. (1979) used conscious, chron- ically instrumented dogs with electric flow probes around the left renal artery and a carotid loop to study postprandial volume regulation. A.1.3.15 Measurement of Heart Dimensions in Anesthetized Dogs ... PURPOSE AND RATIONALE The measurement of the heart dimensions allows to lo- calize the effect of a drug on the activity of the heart. An ultrasonic technique is used for continuous mea- surement of left ventricular dimensions. Compounds are tested with potential anti-anginal activity due to the reduction of left ventricular diameter. The test is used to evaluate the influence of drugs on left ventricular external and internal diameter in anesthetized dogs. PROCEDURE Male or female Beagle or Labrador-Harrier dogs weighing between 15 and 25 kg are used for the test. The dog is anesthetized by intravenous injection of 35–40 mg/kg pentobarbital sodium followed by subcutaneous injection of 2 mg/kg morphine. Respiration is maintained through a tracheal tube with N2O/O2 (3:1) using a positive pressure respirator. Implantation of Ultrasonic Transducers Ultrasonic transducers are constructed and implanted as described by Stinson et al. (1974). To measure left ventricular external diameter (LVED), two ultrasonic transducers are fixed to the left ventricular wall. One crystal is sutured to the poste- rior wall within the rectangular area formed by the left circumflex coronary artery and the left posterior de- scending artery. The other one is placed near the first diagonal branch of the left anterior descending coro- nary artery. Exact positioning is assured with an oscilloscope. To measure left ventricular internal diameter (LVID), the transducers are placed in the same anatomical area as for the epicardial crystals. However, they are pushed through the wall of the left ventricle through stab wound incisions. The crystals are posi- tioned across the greatest transverse diameter of the left ventricle, one on the anterior and the other on the posterior endocardial wall. Bleeding during the implantation procedure is con– trolled by umbilical tapes around the cranial and caudal veins and by purse string sutures at the implantation sites. The pericardial incision and the chest is closed by sutures and the transducer wires are con- nected to the recording equipment. In each dog, either LVED or LVID is measured to- gether with the other hemodynamic parameters. Preparation for Hemodynamic Measurements Blood pressure is recorded through a cannulated femoral artery by a pressure transducer (Statham P23DB). For determination of LVP, a Millar microtip catheter (type PC 350) is inserted via the left common cartid A. carotis commu- nis. LVEDP is measured on a high-sensitivity scale. From the pressure curve, dp/dtmax is differentiated and heart rate is calculated. Hemodynamic parameters are recorded continu- ously during the whole experiment. Experimental Course When stable hemodynamic conditions are achieved for at least 30 min (control values), the test substance is administered by intravenous or intraduodenal injection. Readings are taken at times 0, 15, 30, 45, 60, 75, 90 and 120 after drug administration. Left ventricular dimensions are measured at the end of the diastole and systole. Characteristics: blood pressure systolic blood pressure diastolic blood pressure left ventricular pressure, LVP left ventricular enddiastolic pressure left ventricular contractility, dp/dt heart rate, HR left ventricular external diameter, LVED left ventricular internai diameter, LVID EVALUATION Hemodynamic parameters, LVED and LVID [mm] are determined. Changes in parameters after drug administration are compared to control values obtained during the 30 min pre-drug period. Statistical significance is assessed by means of the paired t-test. Since a change in the diameter of the left ventricle is a reasonable accurate index of left ventricular volume, a reduction of LVED or LVID with no change in dp/dt and HR can be considered as a strong indicator for “venous pooling” and thus an anti-anginal activity of a compound. Scores are allotted relative to the efficacy of standard compounds assessing the intensity as well as the duration of the effect. Standard data: LVED [mm] LVID [mm] Nitroglycerin 0.005mg/kg, i.v. –0.9 20 min –1.2 30 min Isosorbidedinitrate 0.1mg/kg, i.v. –0.6 120 min Molsidomine 0.2mg/kg, i.v. –2.1 <60 min –1.4 <120 min Nifedipine 0.1mg/kg, i.v. +1.2 120 min MODIFICATIONS OF THE METHOD Novosel et al. (1992) measured the dimensions of the right ventricle with microsonometry in anesthetized rabbits. A.1.3.16 Telemetric Monitoring of Cardiovascular Parameters in Rats ... PURPOSE AND RATIONALE Radiotelemetry allows the recording of cardiovascular parameters in conscious, free-moving animals. Several authors (Brockway et al. 1991; Mattes and Lemmer 1991; Guiol et al. 1992; Morimoto et al. 1992; Basil et al. 1993; Brockway and Hassier 1993; Lemmer et al. 1993, 1994, 1995; Calhoun et al. 1994; Diamant et al. 1993; Kramer et al. 1993a, 1995; Griffin et al. 1994; Kuwahara et al. 1994; Sato et al. 1994, 1995; van den Buuse et al. 1994; Kinter 1996; Becker et al. 1997; Witte et al. 1998) used commercially available systems with some modifications to study the circadian rhythm of blood pressure and the influence of drugs on heart rate, blood pressure and motility in rats. PROCEDURE The telemetry and data acquisition system (e. g., Data Sciences International, Inc., St Paul MN) consists of four parts: the implantable transmitter, which measures the pressure. This device contains a highly stable, ion- implant, semiconductor, strain-gauge sensor and battery-powered electronics to process the information from the pressure sensor and to telemeter it from within the animal. Arterial pressure is trans- mitted to the sensor via a 0.7-mm diameter, fluid- filled catheter; the receiver which detects the signal from the im- planted transmitter and converts it to a form read- able by computer; the pressure reference module, which measures at- mospheric pressure to allow for the telemetered ab- solute pressure to be converted to a gauge pressure; the data acquisition software, which accepts data from the reference module and the receivers, filters corrupt samples from the incoming data stream, converts the telemetered pressure to millimeters of mercury, subtracts atmospheric pressure from the telemetered pressure, and stores the data for re- trieval, plotting, and analysis. Under pentobarbital anesthesia, the telemetry transmitter is implanted into rats. The descending aorta is exposed between the renal arteries. A vascular clamp is made by putting two surgical threads on the prox- imal and distal part of the artery. The catheter tip is inserted through an incision in the vessel. A drop of cyanoacrylate glue is applied to the dried entry point. The transmitter is sutured to the abdominal musculature. EVALUATION Data from individual animals are recorded over long periods of time which allow the investigator to follow the circadian rhythm under several experimental conditions. MODIFICATIONS OF THE METHOD Hess et al. (1996) monitored pulmonary arterial pressure in freely moving rats by inserting the sensing catheter of a telemetric system through a small hole and pushing it into the pulmonary artery. Further cardiovascular studies in rats using the tele- metric system were reported by Sgoifo et al. (1998), Webb et al. (1998). Kramer et al. (1993b) used telemetry to record elec- trocardiogram and heart rate in freely moving mice. Carison and Wyss (2000) used small telemetry probes for long term recording of arterial pressure and heart rate in mice after implantation to the carotid artery or the abdominal aorta. DePasquale et al. (1994) used radiotelemetry to monitor cardiovascular function in conscious guinea Pigs. Telemetric ECG recordings in cardiomyopathic hamsters were reported by Desjardins et al. (1996). Van den Buuse and Malpas (1997) studied cardiovascular parameters in rabbits by radiotelemetry. Astley et al. (1991), Smith et al. (1993) used tele- metric systems to monitor cardiovascular responses in baboons. Schnell and Wood (1993) measured blood pressure and heart rate by telemetry in conscious, unrestrained marmosets. An ultrasonic blood flowmeter telemetry system for cats and rabbits has been described by Yonezawa et al. (1989,1992). Telemetry was used by Symons et al. (1992) to monitor the severity of events representing myocardial dysfunction in miniswine. Savory and Kostal (1997) applied the telemetric system for chronic measurement of cardiovascular and other parameters in chicken. Radiotelemetry has also been used for other pharmacological experiments, such as field potential analysis by radioelectroencephalography (see Sect. E.1.2.6), step through passive avoidance (see Sect.F.3.1.2), shock-prod burying test in rats (see Sect.E.2.5.3), measurement of body temperature (see Sect. H.4.0.2) and motility in rats and mice (Clement et al. 1989; Guillet et al. 1990; Diamant et al. 1993; van den Buuse 1994). A.1.3.17 Cardiovascular Effects After Intracerebroventricular Administration ... PURPOSE AND RATIONALE Several drugs, like α2-adrenergic agonists, act primar- ily at central sites. Their effects can be most clearly demonstrated after injection into the cerebroventricu- lar system. The first experiments have been performed in cats. The method has been adapted to rats. PROCEDURE Rats of either sex weighing 250–350 g are anesthetized with 100 mg/kg hexobarbitai i.p. The scalp is cut in a sagittal line. With a dental drill a hole of 1–1.5 mm diameter is drilled through the cranial bone 1 mm lateral and 2 mm caudal of the bregma. A PVC-catheter is introduced perpendicular to the bone to a depth of 3 mm in order to reach the lateral cerebral ventricle. The catheter is fixed with dental cement and the wound closed. Test substances are administered through the catheter. To measure blood pressure one catheter is placed in one carotid artery and connected to a Statham transducer. Blood pressure and heart rate are recorded on a polygraph over a period of at least 30 min. For long acting drugs registration periods up to 2 h are nec- essary. After the experiment, the animal is sacrificed and the brain removed to confirm the site of injection. EVALUATION Systolic and diastolic blood pressure as well as heart rate after intracerebroventricular injection are ex- pressed as percentage of pretreatment values. The re- sponse is compared with the standard clonidine which is effective in doses of 4–60 μg. MODIFICATIONS OF THE METHOD Based on the work of Feldberg et al. (1954) and Hay- den et al. (1966), Mastrianni et al. (1986) developed an intracerebroventricular perfusion system for the study of centrally acting antihypertensive drugs in the rat. The antihypertensive effect of clonidine could be ob- served over several hours. Methods used to detect central hypotensive activity of drugs have been reviewed by Timmermans (1984). A.1.3.18 Influence on Orthostatic Hypotension ... PURPOSE AND RATIONALE Orthostatic hypotension with dizziness up to uncon- sciousness is a syndrome occurring in many human in- dividuals. Moreover, several drugs are known to cause orthostatic hypotension. In several animal species, such as rabbit, cat and dog, this syndrome can be evoked by changing the usual horizontal position into a vertical position with the head upwards using a tilting table. PROCEDURE Cats of either sex weighing 2.0–3.0 kg are temporariiy anesthetized with ether. Anesthesia is maintained by intravenous injection of 70 mg/kg chloralose. The animal is fixed with its legs on a heated operating table which can be tilted by 90degrees. The carotid artery is cannulated for measuring blood pressure through a Statham P 23 Db transducer on a 6 channel Hel- lige recorder. The femoral vein is cannulated for injection of the test compound. After the blood pressure is stabilized for 30 min, the animal is quickly tilted to a vertical position for 1 minute. Due to the change of position and gravitational force, there is a rapid fall in blood pressure which recovers as soon as the animal is restored to its original position. After taking the control reading, the test compound is administered intravenousiy and the same procedure is repeated. The fall in blood pressure is recorded. EVALUATION A significant increase in postural hypotension with respect to the control would indicate that the test com- pound may produce orthostatic hypotension in human. Moreover, some compounds, like sympathomimetics, can reduce or prevent postural hypotension. MODIFICATIONS OF THE METHOD Sponer et al. (1981) described a method for evaluating postural hypotension in conscious rabbits placed on a tilting table whereby blood pressure was measured from the central artery of the ear. Takata et al. (1999) reported a rabbit model for evaluation of chlorpromazine-induced orthostatic hypotension. Humphrey and McCall (1982) described a model for predicting orthostatic hypotension during acute and chronic antihypertensive drug therapy inrats anes- thetized with chloralose, urethane and pentobarbital using a heated tilting table. Lee et al. (1982) evaluated postural hypotension in- duced by drugs in conscious restrained normotensive rats. Blood pressure was recorded after cannulation of the femoral artery under light ether anesthesia. A special tilting table was build for simultaneous studies in four rats. Martel et al. (1996, 1998) studied the phenomenon of cardiovascular deconditioning observed in crew members of space flights in rats after tail suspension. Socci et al. (2000) studied cardiovascular responses to simulated microgravity in Sprague–Dawley rats. Mi- crogravity is known to induce orthostatic intolerance and baroreflex impairment in astronauts. The authors used 30° head-down tilt, 24-h whole-body suspension or 7-day tail suspension to mimic microgravity and to find treatment ameliorating the symptoms. Baum et al. (1981) studied antihypertensive and orthostatic responses to drugs in conscious dogs. A catheter was placed in the subclavian artery for measurement of blood pressure and exteriorized at the back of the neck some days prior to the experiment. The animals were placed into a sling and tilted to the 90° up- right position for periods of 60 s. every hour by lifting their forelimbs. Blood pressure response before and af- ter treatment with test drugs was measured. A none human primate model for evaluating the potential of antihypertensive drugs to cause orthostatic hypotension was described by Pals and Orley (1983) Polyvinyl catheters were implanted in the abdominal aorta and the vena cava via an external iliac artery and vein to cynomolgus monkeys during ketamine anes- thesia. The catheters were routed subcutaneously from the groin area to the top of the head and exteriorized. After recovery the animals were placed in restraining chairs allowing the change from vertical to horizontal position. A.1.3.19 Bezold-Jarisch Reflex ... PURPOSE AND RATIONALE The circulatory collapse after intravenous injection of veratrine has been first described in cats and is known as BEZOLD-JARISCH-reflex (Bezold and Hirt 1867; Jarisch and Richter 1939a, b, Jarisch 1940; Aviado and Guavera-Aviado 2001). Fleckenstein et al. (1950) recommended this as a suitable animal model of shock. The original observation was a triphasic blood pressure response in cats or dogs characterized by a short lasting fall in blood pressure accompanied by brady- cardia, followed by a short lasting increase and than a long-lasting decrease of blood pressure after intravenous injection of veratridin or other veratrum alka- loids. Kalkman et al. (1984) showed that three distinct subtypes of serotonergic receptors mediate the tripha- sic blood pressure response to serotonin observed in the Bezold-Jarisch reflex. The Bezold-Jarisch reflex has been studied in several species, such as cats (Takei et al. 1995; Vays- settes-Couchay et al. 1997), dogs (Zucker and Cor- nish 1981; Barron and Bishop 1982; Harron and Kob- inger 1984; Giles and Sander 1986; Baugh et al. 1989; Watson et al. 1995), ferrets (Andrews and Bhandari 1993), rabbits (Chen 1979), guinea pigs, rats (Fozard 1984; Gylys et al. 1988; Cohen et al. 1989; Blower 1990; Miyata et al. 1991; Turconi et al. 1991; Mat- sumoto et al. 1992; Meller et al. 1992; Robertson et al. 1992; Kishibayashi et al. 1993; Geissier et al. 1993; Haga et al. 1994; Hegde et al. 1994; Eglen et al. 1995; Gothert et al. 1995; Delagrange et al. 1996; De Vries 1997; Malinowska et al. 2001; Godiewski et al. 2003) and mice (Eglen et al. 1994; Middiefeil et al. 1996), whereby species differences have been observed (Ya- mono et al. 1995). In cats and dogs, the Bezold-Jarisch reflex was elicited by veratrine and veratridine, but also by capsaicin and the 5-HT3 receptor agonists 2-methyl- 5-HT, phenylbiguanide, chlorophenylbiguanide and serotonin itself. In rats, mostly 5-HT or 2-methyl-5-HT were used as stimuli to characterize 5-HT3 receptor antagonists. PROCEDURE Male Sprague Dawley rats weighing 250–380 g are given food and water ad libitum, except those used for intraduodenal drug administration; these rats are deprived of food overnight. The animals are anes- thetized by intraperitoneal injection of 1.5 g/kg ure- thane. Body temperature is maintained at 37 °C by placing the animal on a heating pad. The left jugular vein or duodenum, trachea and left femoral vein are cannulated for drug administration (i.v. or i.d.), facilitation of respiration and injection of 2-methyl 5-HT, respectively. Heart rate is derived from a limb lead II ECG monitored via subder- mal platinum electrodes and is recorded with am- plifiers on a polygraph. A dose–response curve to 2-methyl 5-HT (5–100 μg/kg, i.v.) is constructed in each rat to establish a submaximal dose (usually 10 or 20 μg/kg, i.v.) which elicits a reproducible brady- cardic response. Each rat receives then a single dose of test drug or standard and is then challenged with 2-methyl 5-HT at 5, 15, 30, 60, 120, 180, 240, 300, 360, 420, and 480 min post dosing. A sepa- rate group of rats receiving vehicle (saline for i.v., deionized water for i.d.) is similarly tested in each study. EVALUATION Duration of action of the compounds is assessed by de- termining the period of time for which the inhibitory effects remain significantly different from vehicle controls. Statistical analysis of the data is performed by a repeated measure analysis of variance (ANOVA) followed by pairwise comparisons against control at each time period using Fisher's multiple comparison test. MODIFICATIONS OF THE METHOD Harron and Kobinger (1984) used capsaicin to elicit the Bezold-Jarisch reflex in anesthetized artificially respirated dogs pretreated with a beta-adrenoceptor antagonist to evaluate the activity of clonidine-like drugs on central alpha2 adrenoceptors after intracisternal administration. The Bezoold-Jarisch reflex in rats has been used for evaluation of 5-HT3 receptor agonists (Rault et al. 1996; Lopez-Tudanca et al. 2003). Rocha et al. (2003) found an enhancement of the Bezold-Jarisch reflex in the acute phase of myocardial infarction of the anesthetized rabbit. A.1.3.20 Endotoxin Induced Shock ... PURPOSE AND RATIONALE Many bacterial infections as well as allergic reactions are known to induce pathophysiological events that may lead to shock in man. When experimental animals are injected with endotoxin and galactosamine, shock and death occur in all untreated animals 5–7 h after injection. The endotoxin induced shock is marked by pulmonary embolism, bronchospasm and renal failure. Bacterial liposaccharides (endotoxins) play an important role in the pathogenicity of Gram-negative infections. The reactivity of animals to endotoxin may be enhanced by simultaneous administration of galac- tosamine. Galactosamine is a specific hepatotoxic agent that leads to early metabolic alterations and consequent cellular liver damage. The following procedure is used to detect compounds that prevent the occurrence of endotoxin-induced shocks. Cardiovascular parameters of endotoxin induced shock are greatly influenced by various anesthetics. For this reason, a model was proposed by Brackett et al. (1985) and Schaefer et al. (1987) to study the cir- culatory shock pattern after endotoxemia in conscious unrestrained rats. PROCEDURE Male Sprague–Dawley rats weighing 300 ± 10 g are anesthetized with 5 % enflurane. A tracheal cannula is connected to a rodent respirator delivering 2 % enflu- rane. Via the right jugular vein the tip of one catheter is placed just adjacent to the right atrium for injection of endotoxin, monitoring of central venous pressure, and rapid injection of room-temperature saline to produce thermodilution curves for calculation of car- diac output. The right carotid artery is cannulated with a thermistor-catheter combination for measurement of thermodilution cardiac output curves and aortic blood pressure. The thermistor tip is placed in the aortic arch just distal to the aortic valve. The catheters are guided under the skin exiting through the back of the neck just below the base of the skull. The animals are allowed to regain consciousness and are then placed in cages that allow unrestrained movements about the cage at all times throughout the study with no further handling. The experimental an- imals receive a 20-sec infusion of 40 mg/kg endo- toxin (E. coli, Difco) being paired with sham animals with identical catheters but receiving an equal volume of saline. Test compounds are injected intravenously 10 min prior to endotoxin injection. Cardiac outputs are measured using the thermodilution technique by rapidly injecting a volume calculated to deliver 100 pl of room temperature saline to the circulatory system. Central venous and aortic blood pressure and heart rate are continuously monitored for the following 4 h. Cardiac output measurements are made 5, 15, 30, 60, 120, 180, and 240 min after endotoxin. At the end of the study, the animals are sacrificed and the catheters checked visually to ensure proper placement. EVALUATION Central venous pressure, arterial pressure, and cardiac output of drug treated animals receiving endotoxin are compared with animals receiving endotoxin only and saline sham treated animals. Furthermore, cardiac index, total peripheral resistance, and stroke volume are calculated. The small intestines of all rats are ex- amined for severity of hemorrhage using a five point scale. Repeated-measures analysis of variance is used to analyze the data. MODIFICATIONS OF THE METHOD Lindenbaum et al. (1990) studied the effect of E. coli endotoxin on cardiovascular parameters of anesthetized dogs. Inhibition of the detoriation of metabolic functions and improvement of cardiovascu- lar parameters were found after cocarboxylase treat- ment. Endotoxin induced shock has been tested in mice (Galanos et al. 1979). Groups of 10 male C57BL/6 mice weighing 20–22 g are injected intravenously with a mixture of 0.01 pg of Salmonella abortus equi lipopolysaccharide and 7.5-15 mg galactosamine in 0.02 ml phosphate buffered saline. The test compound is administered either intravenously at the same time or orally 45 min prior challenge. Twenty-four hours later, the number of surviving mice is determined. Metz and Sheagren (1990) reviewed the effects of ibuprofen in animal models of septic shock. Von Asmuth et al. (1990), Luongo et al. (1998), and Cuzzocrea et al. (2004) described a zymosan-induced shock model in mice. Male CD mice (20–22 g) were treated intraperitoneally with zymosan (500 mg/kg, suspended in saline solution) or with zymosan and drug (rosiglitazone 3 mg/kg, intraperitoneally) at 1 and 6 h after zymosan. Eighteen hours after administration of zymosan, animals were assessed for non- septic shock. Clinical severity of systemic toxicity was scored for the whole experimental period (12 days) in the mice after zymosan or saline injection on a subjective scale ranging from 0 to 3: 0 = absence, 1 = mild, 2 = moderate, 3 = serious. The ranging scale was used for each of the toxic signs (conjunctivitis, ruffled fur, diarrhea, and lethargy) observed in the animals. The final score was the sum of the single evaluation (maximum value 12). Overbergh et al. (2003) studied acute shock induced by antigen in NOD mice. The 8-week-old NOD, BALB/c, and C57BL/6 mice were immunized by injection of 100 μg antigen [Hen egg white lysozyme (HEL), GAD65 (p524-542) (SRLSKVAPVIKARM- MEYGTT), bovine insulin B (ins-B) chain, heat shock protein (hsp)-65, PLP peptide (amino acids 135–151), ovalbumin, keyhole limpet hemocyanine (KLH), and tetanus toxin] emulsified at a 1:1 concentration in complete Freund’s adjuvant (CFA) or incomplete Freund’s adjuvant (Difco Laboratories, Detroit, Mich., USA) in the hind footpads. NOD-scid mice were injected with 100 μg HEL antigen suspended in CFA. All mice were reinjected with the same antigen 3 weeks later in a similar manner. Clinical evolution and survival rate after sensitization with various peptides were moni- tored in different mouse strains. Shock was character- ized by pilo-erection, prostration, erythema of the tail, ears, and footpads, and dyspnea with shallow breath- ing. Serum for antibody measurement and spleens for quantification of mRNA levels were collected before immunization and again before booster administration. Baldwin et al. (1991) tested the effect of Polymyxin B on experimental shock from meningo- coccal lipooligosaccharide and Escherichia coli lipopolysaccharide endotoxins in anesthetized rabbits. Muacevic and Heuer (1992) tested the effect of platelet-activating factor antagonists in anesthetized rats. Otterbein et al. (1993) tested the effects of peptides on survival of mice injected with 50 mg/kg lipopolysaccharide endotoxin in mice and on survival of rats with fecal peritonitis. Mountz et al. (1995) reported an increased suscep- tibility of fas mutant MRL-Ipr/Ipr mice to Staphylo- coccal enterotoxin B-induced septic shock. A.1.3.21 Hemorrhagic Shock ... PURPOSE AND RATIONALE Hemorrhagic shock is one of the most severe consequences of accidents. Several animal models in vari- ous species have been developed to resemble the conditions in man and to test therapeutic or prophylac- tic measures (Lamson and de Turk 1945; Seikurt and Rothe 1961; Mills 1976). A method for hemorrhagic shock in anesthetized as well as in unanesthetized rats has been described by van der Meer et al. (1987). Experimental hemorrhagic shock is defined as a situation in which the cardiovascular system, after a period of hypovolemia followed by complete re-infusion of the shed blood, gradually detoriates ending in the death of the animal. PROCEDURE Female rats weighing 170–190 g are anesthetized by i.p. injection of sodium pentobarbital, 25 m/kg, followed after 20 min by 20 mg/kg, and kept in a chamber at 30 °C and relative humidity over 80 %. The left femoral vein is cannulated for application of the test drug. The right common iliac artery is cannulated and the cannula (polyvinyl chloride, 14 cm long, inner di- ameter 2 mm) is filled with heparin and exteriorized in the neck. After intraarterial injection of 0.2 ml heparin 500 IU/ml, the cannula is connected to a siliconized calibrated glass reservoir (inner diameter 18 mm), the height of which can be changed to adjust the surface of the shed blood to a fixed level. The test drug is injected i.v. 5 min prior to bleeding. Bleeding is performed against (at heart level) 30 mm Hg for 1 h, 25 mm Hg for 0.5 h, 30 mm Hg for 1 h, 25 mm Hg for 0.5 h, and finally 30 mm Hg for 1 h. The shed blood is partially taken up again spontaneously. After 4 h, re-infusion is started by increasing the pressure to 60 mm Hg for 5 min, to 80 mm Hg for 5 min, and (if necessary) to 100 mm Hg. During the hypo- volemic phase respiration becomes gradually slower. If respiration arrest is imminent 0.5 ml 5 % glucose are injected intra-arterially, thus avoiding death during the period of hypovolemia. Practically all rats die at an av- erage of 4 h after complete re-infusion. EVALUATION Survival time is taken as the time between complete re-infusion and death. Average survival time of treated animals is compared with that of controls. Further- more, after autopsy the number of gastrointestinal lesions, subendocardial hemorrhage, kidney tubular necrosis and liver cell necrosis are registered by his- tological examination. CRITICAL ASSESSMENT OF THE METHOD In spite of the fact that hemorrhagic shock does not reflect the situation of traumatic shock in man in ev- ery aspect, the condition is close enough to use the model for testing compounds which potentially inhibit or ameliorate shock in man. MODIFICATIONS OF THE METHOD A method to study hemorrhagic shock in dogs has been described in detail by Mills (1967). Large dogs weighing 20–30 kg are anesthetized by an i.v. injection of 25 mg/kg sodium pentobarbital. The animals are respirated by means of a Harvard respirator set at a stroke volume of 400 ml and a rate of 20 respiration/min. Blood pH is regulated between 7.37 and 7.42 by varying the gas flow between 100 % O2 and a mixture of 95 % O2 and 5%CO2. Central arterial blood pressure is recorded by inserting a catheter through one femoral artery to the aortic arch. Pulmonary artery pressure is measured by inserting a PE50 catheter through a small neck vein, reaching the right ventricle and allowing to float into the pulmonary artery. The right atrial catheter is also inserted through a small neck vein. After the chest is opened, the left atrial catheter is tied in place through a small opening in the left atrial appendage. Blood flow is measured in the ascending aorta (cardiac output), carotid, superior mesenteric, renal and femoral arteries using electro- magnetic flowmeters. Furthermore, puise rate is moni- tored from the electrocardiogram. The test drug is injected i.v. 10 min prior bleeding. Blood is removed either at a specific volume or until a selected reduction of blood pressure has occurred. The cardiovascular parameters of treated animals are compared with those of controls. Shock associated with hemoconcentration was pro- duced in dogs by Davis (1941) by bleeding from the carotid artery and injections of 25 % sodium chloride solution subcutaneously in doses of 25 ml. The effect of insulin on glucose uptake in the soleus muscle of rats during hemorrhagic shock was studied by Chaudry et al. (1975). Bauer et al. (1995) used hemorrhagic shock in rats to evaluate the influence of interleukin-1 on leukocyte- endothelial cell interactions and the microcirculation in the liver by means of intravital microscopy after application of an interleukin-1 receptor antagonist. Kitajima et al. (1995) studied gastric mucosal injury induced by hemorrhagic shock in rats. A.1.3.22 Tourniquet Shock ... PURPOSE AND RATIONALE Compression of extremities in man by heavy objects for periods of several hours results in the so-called crush syndrome. The rescued individual shows im- mediately a favorable response to therapy, but within a few hours symptoms of shock develop followed by signs of progressive renal damage leading to death (Duncan and Blalock 1942). Moreover, arte- rial bleeding after accidents needs the applications of tourniquets. During surgical procedures on extremi- ties a tourniquet may be necessary (Wilgis 1971), the time of which has to be limited in order to avoid fatal consequences. The pathophysiological mechanisms of tourniquet induced shock remain still to be eluci- dated. Nevertheless, animal models in rats (Chandra and Dave 1970), rabbits (Little 1974), and dogs (Goto et al. 1988) had to be developed to evaluate drugs capable to inhibit the fatal consequences of crush and tourniquet shock. PROCEDURE Wistar rats of either sex weighing 250–280 g are anes- thetized with phenobarbital. The tourniquets consist of rubber tubes (internai diameter 4 mm, external diameter 5.8 mm). Both tights are fastened by the rubber tubes and the pressure which is monitored by a miniature pressure sensor and an amplifier (e. g. Ky- owa Electronic Instruments Co, Tokyo) is adjusted to 1.5 kg/cm2. The rubber tubes are knotted and the sensor removed. After 3 h the animals are treated with the test compound or the control solution. The tourniquet is left in place for 6 h while the animals remain under pentobarbital anesthesia. Then, the rubber tubes are removed, and the rats are returned to their cages. Within a few min, the reperfused hind limbs, which have been pale blue, turn pink. The animals are then allowed free access to food and water. Blood is withdrawn at different intervals during the tourniquet and afterwards for measurement of hematocrit, transaminases, urea nitro- gen and total protein. Time to death is registered. EVALUATION Statistical evaluation of the survival intervals is per- formed with the log rank test according to Peto et al. (1976). Blood chemical data are analyzed using the Kruskal-Wallis (1952) rank sum test. Multiple compar- isons are corrected by the Bonferroni’s method (1980). CRITICAL EVALUATION OF THE METHOD These methods are valuable to find drugs effective in this life-threatening situation. MODIFICATIONS OF THE METHOD Ghussen et al. (1979) studied the effect of methylpred- nisolone on the experimental tourniquet shock in dogs. Haugan and Kirkebo (1984) used a model in anes- thetized rats with tourniquet shock by bilateral hind- limb occlusion for 3 1/2 h, and burn shock by scalding the hind 50 % of the body surface for 30 s in 90 °C wa- ter. Hori and Hori (1985) investigated the effect of tourniquet ischemia on carbohydrate metabolism in dog skeletal muscle Sáez et al. (1982) followed the time course of appearance of lactic dehydrogenase enzymes in the serum of rats after different periods of ischemia by bilateral application of rubber band tourniquets to the hind legs. Sáez et al. (1986) studied the effects of allopurinol on biochemical changes of the gastrocnemius muscle in rats subjected to tourniquet shock followed by reperfusion. A.1.3.23 Heat Stroke ... PURPOSE AND RATIONALE Heat stroke is a medical emergency where quick di- agnosis and treatment of victims are essential for positive prognosis. Several animal models have been es- tablished by investigators in heat related studies. Rats (Francesconi and Mager 1978; Hubbard et al. 1977, 1979; Kielblock et al. 1982), rabbits (Shih et al. 1984), dogs (Bynum et al. 1977) and sheep (Tayeb and Mar- zouki 1990) are considered to be the most suitable models because of their similarity to man in response to high temperature. PROCEDURE Male Sprague Dawley rats weighing 450 to 550 g are fasted 18–24 h before the experiment. For prevention studies the animals are treated subcutaneously 1 h be- fore either being restrained in an appropriate wire cage which is placed into an environmental cham- ber set at 41.5 °C ambient temperature or being ex- ercised in a motor-driven treadmill. Core temperature (rectal probe inserted 6.5 cm) are measured us- ing copper/constantan thermocouples in conjunction with a thermocouple reference oven and a 10-channel data acquisition system with a teletype printout. After reaching exhaustion or a predetermined core temperature, all rats are monitored at 26 °C ambient temperature while resting in plastic cages lined with wood shavings. After recovery, animals are returned to their cages and allowed water but no food for 24 h. EVALUATION LD 50 values are determined in treated and control ani- mals. MODIFICATIONS OF THE METHOD Kielblock et al. (1982) analyzed cardiovascular func- tion by direct recording of arterial blood pressure and ECG-analysis. Francesconi and Mager (1978) studied pathochemi- cal indices, such as serum lactate concentration, potassium levels and plasma creatine phosphokinase. Kregel et al. (1988) investigated peripheral vascular responses to hyperthermia in the rat by implantation of Doppler flow probes on the superior mesenteric, left iliac or left renal, and external caudal arteries. They concluded that a selective loss of compensatory vasoconstriction triggers the cascade of events that charac- terize heat stroke. Shido and Nagasaka (1990) studied thermoregula- tory responses to acute body heating in rats acclimated to continuous heat exposure. Indirect external warm- ing was performed by raising the jacket water temperature surrounding the calorimeter from 24 to 39 °C. Intraperitoneal heating was made through an electric heater implanted chronically in the peritoneal cavity. Chiu et al. (1995) reported an increased survival in rat heatstroke by reducing hypothalamic serotonin re- lease after administration of interleukin-1 receptor an- tagonist. A.1.3.24 α- and β-Adrenoreceptors in the Mouse Iris ... PURPOSE AND RATIONALE A simple method to test mydriatic substances is the test on the mouse pupil as described by Pulewka (1932). The diameter of the pupil is narrowed by intensive light illumination. A dose-dependent increase of pupil diameter can be achieved by intraperitoneal application of atropine and synthetic mydriatics (Ing et al. 1950; Burn et al. 1950). The mydriatic effect of hexamethonium analogues has been measured by Blackman et al. (1956). Mydriasis is induced by norepinephrine, epinephrine and isoproterenol and can be antagonized by α- or β-blockers (Freundt 1965). PROCEDURE Male mice weighing 15–20 g are used. They are kept for at least 30 min in separate beakers under bright illumination before the pupil diameters are measured with a dissecting microscope containing an arbitrary scale in the eyepiece. To make the illumination as uniform as possible, the beakers containing the mice are placed beneath long low-power fluorescent tubes and on top of glossy white paper. The pupil diameter is measured in mm before and at various time intervals after treat- ment. Groups of 5–10 mice are used for each dose of compound and for vehicle control. To test sympatholytic activity, various doses of the α- or β-blocker are injected subcutaneously 30 min prior to intravenous injection of 0.1 mg/kg norepinephrine, or 0.05 mg/kg epinephrine, or 20 mg/kg isoproterenol. The effect of norepinephrine is blocked by a-blockers, but not by β -blockers, the effect of epinephrine by both α- and β -blockers, and the effect of isoproterenol by β -blockers, but not by a-blockers. EVALUATION The mean values of diameters in the groups treated withα- or β -blockers are compared with those of an- imals treated with norepinephrine, epinephrine or iso- proterenol only. MODIFICATIONS OF THE METHOD Edge (1953) used mydriasis in the mouse as a quantitative method of estimating parasympathetic ganglion block. Håkanson et al. (1987) used the isolated iris sphincter of pigmented rabbits to test multiple tachykinin pools in sensory nerve fibres. The eyes were taken out within 1 min after sacrifice and opened by an incision 2–3 mm posterior to the limbus, followed by excision of the iris from the ciliary margin. The iris sphincter muscle was then opened, cut in half and mounted ver- tically on a Perspex holder in a 7 ml tissue bath main- tained at 35 °C. The mechanical activity after electrical stimulation was recorded isometrically using a force displacement transducer and a polygraph. Kern (1970) used isolated sphincter and dilator muscles from human eyes obtained at autopsy for studies on sympathomimetics and adrenergic blocking agents. Cholinotropic andα- andβ-adrenergic recep- tors were identified. Responses to bradykinin and or capsaicin of the iso- lated iris sphincter were considered to be mediated by substance P released from the trigeminal nerve (Ueda et al. 1984). Pupillary dilatation can be used as an index for central nervous system α 2-adrenoreceptor activation (Koss 1986). Clonidine induces mydriasis which is mediated by α 2-adrenoreceptors located in the brain (Berridge et al. 1983; Hey et al. 1985). Blockade of presynaptically lo- cated α 2-adrenoreceptors is considered as a possible mechanism for antidepressant drugs. Mianserin was able to antagonize clonidine-induced mydriasis in the rat. Gower at al (1988) studied a large number of psy- chotropic drugs in this model with the aim to reveal in vivoα 2-adrenoreceptor blocking effects of new com- pounds. Male Wistar rats weighing 230–300 g were anesthetized with pentobarbital, 60 mg/kg i.p., and a polyethylene catheter was inserted into the femoral vein for drug administration. The rat’s head rested on the base platform of a binocular Olympus microscope positioned so that the pupil diameter of the right eye could be measured by means of a micrometer inserted into one eyepiece of the microscope. A constant light intensity was maintained throughout the experiment. Rats were first injected with saline 25 min after anes- thesia induction. The pupil diameter was measured 1 min after injection. Five min after measurement, mydriasis was induced by clonidine (0.1 mg/kg, i.v.) and the diameter was measured 1 min after injection. This was followed by the test compound, injected at 6 min intervals at increasing doses. The pupil was measured at 1 min after each injection. The dose inhibiting 50 % of the clonidine-induced mydriasis (ID 50 ) was determined per rat from the cumulative dose–response curve. Savontaus et al. (1997) studied the effect of an imidazoline derivative against detomidine-induced mydriasis in anesthetized rats. A.1.3.25 α2-Adrenoreceptor Blockade Measured in Vivo by Clonidine-Induced Sleep in Chicks ... PURPOSE AND RATIONALE In young chicks, clonidine causes a loss of righting reflex which is antagonized by mianserin (Pommier et al. 1982). This phenomenon was used to measureα2- adrenoceptor blockade in vivo by Gower et al. (1988). PROCEDURE Male white Leghorn chicks are used either a few hours after hatching or 1 or 2 days later. Clonidine- induced loss of righting reflex (sleep) is determined with 8 animals at a time. Two animals are treated with placebo and 2 with each of 3 dose levels of the test compound. Tests with groups of 8 animals are con- tinued until 10 animals are tested per dose level or placebo treatment. The chicks are marked with ink and injected intraperitoneally with placebo or the test com- pound. Ten min later, 1.2 mg/kg clonidine is injected into a leg muscle and the animals are placed individu- ally in small Macrolon cages. The beginning of sleep time is defined as the moment at which the animals can be placed on their back and remain in this position. Sleep time is recorded until they return to their feet spontaneously or another attempt to put them on their back fails. Sleep time is recorded for a maximum period of 30 min. EVALUATION Statistical evaluations of differences in median sieep- ing times are done with the Mann–Whitney U-test. Dose–response relations for various drugs can be cal- culated. CRITICAL ASSESSMENT OF THE METHOD Compounds with knownα 2-adrenoceptor blocking ac- tivity antagonize clonidine-induced sleep in chicks dose-dependently. Yohimbine is one of the most active compounds. However, also other centrally active compounds of which their main effect is notα 2-blockade, reduce clonidine-induced sleeping time. One of the most potent is apomorphine acting on dopamine D2- receptors. Therefore, the clonidine-induced sleeping test in chicks can not be regarded as highly specific forα 2-adrenoceptors. A.1.3.26 Activity at β 1- and β 2-Adrenoreceptors in the Rat ... PURPOSE AND RATIONALE The relative potency of catecholamines as stimulants of β-adrenoreceptor mediated responses vary in different tissues indicating the existence of two subtypes of p -receptors (β 1 andβ 2) (Lands et al. 1967). β - adrenoreceptors in the heart have been classified as be- ing of the β 1-subtype.β-adrenoreceptors in the uterus, diaphragm, bronchioles and small intestine have been classified as being of the β 2-subtype, since in these tissues, epinephrine is more potent than norepinephrine. These observations led to the development of selective agonists and antagonists. Isolated organs (see be- low) having predominantly one receptor subtype, such as the isolated heart and the isolated atrium for β 1, and the isolated uterus or the isolated tracheal chain for β 2, are used to test compounds for selective activity. Assessing both activities in the same animal in vivo results in the advantage that pharmacokinetic and metabolic influences of the drug being tested are the same for both parameters. PROCEDURE Female Sprague–Dawley rats (200–220 g) are anesthetized with 60 mg/kg pentobarbital i.p. prior to pithing (Gillespie and Muir 1967). The animals are artificially respired with room air using a Harvard small animal ventilator (90 strokes/min at a pressure of 7 cm H2O). Body temperature is maintained by plac- ing the animals on a heated operating table. The left carotid artery is cannulated for continuous monitoring of blood pressure via a Statham p23Id pressure trans- ducer. The blood pressure signal is used to trigger an instantaneous rate meter for continuous monitoring of heart rate. A femoral vein is cannulated for intravenous administration of drugs. A midiine incision is made to expose one horn of the uterus. The ovarian artery is cut, tied and one horn dissected free from the ovary leaving the myometrial blood supply intact. A cotton thread is attached to the free end of the uterine horn, passed through a glass- jacketed organ bath and connected to an isometric (Pi- oden UF1) transducer for measurement of spontaneous contractions. A cannula is inserted into the peritoneal cavity for administration of drugs by the i.p. route. The organ bath is positioned such that it surrounds the uterine horn without touching it. The tissue is peri- fused with Krebs-Henseleit solution being gassed with 95 % O2/5 % CO2 and maintained at 37 °C. A resting tension of 0.2 g is applied to the tissue, which is al- lowed to stabilize until spontaneous contractions are constant over a period of 5–10 min. All recordings are made on a polygraph. EVALUATION OF AGONISTS Dose–response curves after i.v. injection are estab- lished for isoprenaline (nonselective between β 1- and β 2-adrenoreceptors), salbutamol (selective for β 2- adrenoreceptors), and noradrenaline (selective for β 1- adrenoreceptors) in increasing heart rate (beats/min) and decreasing the height of uterine contraction (calculated as percentage of the original amplitude). Animals given noradrenaline are pretreated with phenoxyben- zamine (3.3 mmol/kg i.v.) in order to antagonize irre- versibly the a-adrenoreceptors. Agonist dose–response curves (n > 4) on heart rate and uterine relaxation are carried out by assessing the activity of at least 3 doses of each agonist. New synthetic compounds can be tested after intraperitoneal administration additionally. EVALUATION OF ANTAGONISTS The ability of a non-selective β -blocker, such as pro- pranoiol (1 mmol/kg i.v.), a β 1-selective β -blocker, such as atenoiol, and a β 2-selective β -blocker to in- hibit responses to isoprenaline on both heart rate and uterine relaxation is assessed by comparing the log linear portion of the dose–response curve to isopre- naline in the absence and in the presence of the β- adrenoreceptor antagonist in the same animal. Dose ratios for each antagonist are calculated. CRITICAL ASSESSMENT OF THE METHOD The method described by Piercy (1988) has the advan- tage to measure both agonistic and antagonistic activity and to differentiate between effects on β 1- and β 2- adrenoreceptors. Compared to tests in isolated organs, in vivo activity can be determined after intraperitoneal or intraduodenal administration. MODIFICATIONS OF THE METHOD Hârtfelder et al. (1958) studied the influence of var- ious agents on the contractions of electrically stimu- lated isolated uteri of rabbits and guinea pigs. Nathason (1985) evaluated the activity of beta- blockers to inhibit the cardio-acceleratory effect of systemically administered isoproterenol in unanesthetized, restrained albino rabbits together with the effect on membrane bound adenylate cyclase in ho- mogenized ciliary process villi in order to find com- pounds selectively lowering intraocular pressure. A.1.3.27 β 1- and β 2-Sympatholytic Activity in Dogs ... PURPOSE AND RATIONALE Intravenous administration of isoprenaline (isopro- terenol) stimulates β 1 -receptors of the heart which can be detected as an increase in contractility (dp/dt max). Intraarterial injection of isoprenaline stimulates β 2 - receptors of peripheral blood vessels leading to an in- creased peripheral blood flow. Therefore, a β 1 - orβ 2 - blocking activity of a compound is revealed by the inhibition of the effects of isoprenaline. The following tests are used to evaluate β -blocking activity of drugs. A β -blocker screening is done in anesthetized dogs (a); in addition, the test allows a differentiation between β- and β-receptor activity and the determination of ED 50 values (b). PROCEDURE Male or female Beagle dogs weighing about 20 kg are used. Animals are premedicated with 1 g Inactin(i.v.) and anesthetized by intravenous administration of 20 mg/kg chloralose and 250 mg/kg urethane. In addition, they receive a subcutaneous injection of 2 mg/kg morphine 1 h after the start of anesthesia. Animals are heparinized. Respiration is maintained through a tracheal tube using a positive pressure respirator. End- expiratory CO2 content is measured continuously; res- piratory rate and depth of respiration are adjusted to 4.5-6 vol% end-expiratory CO2. For administration of isoprenaline, a peripheral vein is cannulated. Preparation for Hemodynamic Measurements For recording of peripheral systolic and diastolic blood pressure, a cannula inserted into a femoral artery is connected to a pressure transducer (Statham p 23 DB). For determination of LVP, a Millar microtip catheter (PC 350) is inserted via the left arteria carotis commu- nis. LVEDP is measured from a high-sensitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate is counted. Peripheral blood flow in the femoral artery is measured with an electromagnetic flow probe. Screening for β -Blocking Effects in Anesthetized Dogs Following a steady-state period of 30–60 min, isopre- naline is administered intravenously 2–3 times to the anesthetized animal and hemodynamic parameters are recorded (control values = 100 %). Then, the test substance is injected intravenously at cumulative doses (final concentrations of 0.01, 0.05 and 0.15 mg/kg). For each dose, 10 min “drug effects” are monitored by measuring hemodynamic parameters. Then the effect of isoprenaline is tested again (3 times). In other experiments, a single dose of the drug is administered to determine the duration of action. If a test compound does not show an inhibitory influence on isoprenaline effects, a second test com- pound is administered. All hemodynamic parameters are registered contin- uously during the whole experiment. Testing for β1- and β2-Blocking Effects; Determination ofED50 Following a steady-state period of 30–60 min, isoprenaline is administered for i.v. administration (β 1 -test) twice at a dose of 0.5 μg/kg and for intraarterial administration (β 2 -test) twice at a dose of 0.05 μg/kg. Hemodynamic parameters are recorded (control values = 100 %). Then, the test substance is injected intra- venously at cumulative doses. Consecutively increas- ing doses are given at 15-min intervals. For each dose, 10 min “drug effects” are monitored by measuring hemodynamic parameters. Thereafter isoprenaline is given intravenously and 5 min later intra-arterially. All hemodynamic parameters are registered contin- uously during the whole experiment. Characteristics: blood pressure systolic, BPs diastolic, BPd heart rate left ventricular pressure, LVP left ventricular enddiastolic pressure, LVEDP dp/dt max peripheral flow, A. femoralis ECG, lead II Standard compounds: propranolol HCl practolol metoprolol tartrate EVALUATION β 1 -receptor antagonism is measured as a decrease in contractility (dp/dt max). Inhibition of the isoprenaline-induced elevation of heart rate is considered as an indicator for non-selective β-blockade. For cardioselective β-receptor block- ers the increase in dp/dt max is inhibited with lower doses of test drug than the rise in heart rate. β 2-receptor blockade by a test drug is measured as inhibition of the isoprenaline-induced increase in pe- ripheral blood flow. The different hemodynamic parameters are deter- mined. Percent inhibition of the isoprenaline-induced effects by a test compound is calculated and compared to the isoprenaline effects before drug administration (=100 %). ED 50 values for β 1 - and β 2 -antagonism are calcu- lated by log-probit analyses. ED 50 is defined as the dose of drug leading to a 50 % inhibition of the iso- prenaline effects. An ED 50 β 1 /ED 50 β 2 -ratio of < 1 indicates that a β - blocking agent predominantly influencesβ 1 -receptors (cardioselectivity). A.1.3.28 Intrinsic β-Sympathomimetic Activity in Reserpine-Pretreated Dogs ... PURPOSE AND RATIONALE β-blocking agents can be classified as β -blocking agents with intrinsic sympathomimetic activity (ISA), β-blocking agents with membrane stabilizing activity (MSA), β -blocking agents with organ selectivity (high affinity to heart p 1-receptors). In the following procedure with reserpine-pretreated dogs, β -blocking agents with intrinsic sympathomimetic activity can be identified. Reserpine administration 24 h before the start of the experiment leads to a depletion of catecholamine depots. Thus, it is possible to differentiate between indirectly acting sympa- thomimetics such as tyramine and directly acting ones such as noradrenaline. This test is used to identify p -blocking drugs with intrinsic sympathomimetic activity. PROCEDURE Male or female Beagle dogs weighing about 15 kg are used. Twenty-four h before the test, dogs receive an intramuscular injection of 0.3 mg/kg reserpine. At the day of the experiment, the animals are anesthetized by intravenous administration of 10–20 mg/kg pentobar- bital sodium. Respiration through a tracheal tube using a positive pressure respirator is controlled by measuring end-expiratory CO2 concentrations (4–5 vol%). Preparation for Hemodynamic Measurements For recording of peripheral systolic and diastolic blood pressure, a femoral artery is cannulated and connected to a pressure transducer (Statham p 23 DB). For determination of LVP, a Millar microtip catheter (PC 350) is inserted into the left ventricle via the left common carotid artery. LVEDP is measured from a high-sen- sitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate is counted. Experimental Course The test substance is administered by continuous intravenous infusion of 0.02 mg/kg (1 ml/min) until a cumulative dose of 3 mg/kg is achieved (within approx- imately 150 min). Thereafter, the velocity of infusion is doubled (0.04 mg/kg, 2 ml/min). The test is finished when a cumulative dose of 7 mg/kg is achieved (after a total time of approximately 250 min). Hemodynamic parameters are registered continuously during the entire experiment. Characteristics: blood pressure systolic blood pressure diastolic blood pressure left ventricular pressure, LVP left ventricular enddiastolic pressure, LVED dp/dt max heart rate, HR EVALUATION The different hemodynamic parameters are deter- mined. As a measure for intrinsic sympathomimetic activity (ISA), the increase in dp/dt max and in heart rate are evaluated. Absolute and relative differences of these parameters in drug-treated animals are compared to vehicle control values. Statistical evaluations are performed by means of the Student's t-test if n > 4. Scores are allotted relative to the efficacy of standard compounds for intensity as well as for duration of the effect. A.1.3.29 Cat Nictitating Membrane Preparation (Ganglion Blocking Activity) ... PURPOSE AND RATIONALE Nicotinic acetylcholine receptors are involved in the ganglionic neurotransmission. Various subtypes are described for nicotinic acetylcholine receptors (Sar- gent 1993; McGehee and Role 1995; Karlin and Ak- abas 1995; Alexander et al. 2001). The nictitating membrane of the cat has been used extensively in pharmacological studies to evaluate ganglion blocking activity because of the ease with which its movements can be recorded, because of the sim- plicity of its innervation (the purely adrenergic fibres have their cell bodies in the easily accessible supe- rior cervical ganglion of the same site) and because its blood supply (via the external carotid artery) is accessible for intraarterial injections. Preganglionic and postganglionic stimulation allow the interpretation of the mode of action of vasoactive drugs. PROCEDURE The animal is anesthetized with 35 mg/kg pentobarbi- talsodium i.p. Tracheostomy is performed and a tracheal cannula is inserted. On one side, the sympathetic nerve is exposed, separated from the vagus nerve and prepared in order to place electrodes for preganglionic and postganglionic stimulation. Preferably, the vagus nerve at this site is severed at the central end. The head of the animal is fixed in a head holder to prevent head movements. A linear transducer is fixed at the mid of the border of the nictitating membrane allowing the registration of the contractions on a polygraph. Pre- ganglionic and postganglionic stimuli are exerted by a square wave stimulator, with a puise width of 0.3 to 0.5 ms, an amplitude of 1–3 V, and a frequency of 20/min. The amplitude and puise width varies from animal to animal. The sympathetic nerve is stimulated before and after the administration of the compound and the changes in the contraction of the nictitating membrane are noted. Furthermore, the response of the nictitating membrane to exogenous adrenaline is reg- istered. EVALUATION The decrease of the response after drug application is expressed as percentage of the control before drug. Ganglionic blockers decrease the response to pregan- glionic stimulation but have no influence on post- ganglionic stimulation or exogenous adrenaline. Neu- ronal blockers decrease the response to both pregan- glionic and postganglionic stimulation but do not af- fect the response to exogenous adrenaline which may even be enhanced.α-receptor blockers decrease the re- sponse to both preganglionic and postganglionic stimulation as well as decrease the effect of exogenous adrenaline. Catecholamine uptake inhibitors increase the response to both preganglionic and postganglionic stimulation as well as enhance the response to exoge- nous adrenaline. CRITICAL ASSESSMENT OF THE METHOD The nictitating membrane preparation has been widely used for differentiation of cardiovascular effects. Since the use of higher animals such as cats has been limited to a great extent, this model is now being used only exceptionally. As alternative, the contraction of the inferior eyelid of anesthetized rats after preganglionic electrical stimulation of the superior cervical ganglion has been rec- ommended (Gertner 1956; Steinbrecher and Schmid- Wand 1986). In the modification used by Steinbrecher and Schmid-Wand (1986) the method is suitable for testing compounds with potential adrenergic and anti- adrenergic activity but not for testing ganglion block- ing activities. Male Sprague Dawley rats are anesthetized with 100 mg/kg thiobutabarbital i.p. and kept on a heated operation table at a rectal temperature of 37 °C. One femoral vein is cannulated and filled with 4 % heparin solution. One femoral artery is cannulated for regis- tration of blood pressure. Tracheotomy is performed and a polyethylene catheter of 5 cm length inserted. The head of the animal is fixed carefully. The vibrissae at the lower eyelid on the right side are cut, a thread attached at the margin of this eyelid and attached to a strain-gauge. To immobilize the musculature of the face, the mouth of the animal is sutured and the head support attached. The right sympathetic nerve is ex- posed, separated from the vagus nerve and prepared in order to place electrodes for preganglionic stimulation. For calibration, stimulation is performed twice with an interval until contraction is back to baseline. Fur- thermore, a dose of 0.001 mg/kg adrenaline is given as bolus injection. Eyelid contraction and blood pressure increase are recorded. Then the putative adrenergic blocker or the standard 1.0 mg/mg phentolamine are injected intravenously. Eyelid contraction after elec- trical stimulation or after adrenaline is reduced dose- dependently. MODIFICATIONS OF THE METHOD Quilliam and Shand (1964) assessed the selectivity of drugs by comparing the effects on ganglionic transmission and on the pre- and post-ganglionic nerves in the isolated superior cervical ganglion preparation of the rat. Langer and Trendelenburg (1969) performed exper- iments with normal nictitating membranes of pithed cats as well as with isolated normal nictitating membranes. Koss and Hey (1992) used frequency-dependent nictitating membrane responses by sympathetic nerve stimulation in anesthetized cats to determine the po- tential role of prejunctional histamine H3 receptors. Gurtu et al. (1992) used contractions of the cat nictitating membrane to explore the effects of calcium channel blockers on neurotransmission in vivo, by comparing the effects of verapamil and nifedip- ine on contractions of nictitating membrane follow- ing either electrical stimulation of the superior cervical ganglion or intravenous injection of phenyle- phrine. Koss (1992) compared the peripheral and central nervous system sympatholytic actions of prazosin us- ing the cat nictitating membrane. Submaximal contractions of the nictitating membranes were evoked by electrical stimulation of the preganglionic cervical sympathetic nerve trunk and by stimulation of the pos- terior hypothalamus in anesthetized cats. Badio et al. (1996) evaluated spiropyrrolizidines, a new structural class of blockers of nicotinic recep- tor channels with selectivity for ganglionic type re- ceptors in rat pheochromocytoma PC12 cells (with an α 3 β 4(5)-nicotinic receptor) and human medulloblas- toma TE671 cells (with anα 1 β 1 δ-nicotinic receptor). A.1.3.30 Assessment of Ganglion-Blocking Activity in the Isolated Bovine Retractor Penis Muscle ... PURPOSE AND RATIONALE The use of the bovine retractor penis muscle for the assessment of ganglion-blocking activity of neuromuscular blocking drugs has been recommended by Alaranta et al. (1990) and Klinge et al. (1993). Klinge and Sjostrand (1974) performed not only extensive studies on the physiology and pharmacology of the re- tractor penis in the bull, but also discussed the vari- ous hypotheses on inhibitory and excitatory innervation of this muscle, which is present in many verte- brates such as horses, cats, dogs and rats, but not in men and rabbits. They also found that the effects on the isolated retractor penis muscle and on penile arter- ies are rather similar. The excitatory innervation was found to be predominantlyα-adrenergic (Klinge et al. 1970; Klinge and Sjostrand 1977) whereas other trans- mitters such as histamine and bradykinin were effective only in some species. Relaxation of the isolated retractor penis muscle could be elicited by nicotine and other nicotinic agonists (Klinge et al. 1988). In the studies on ganglion-blocking activity, strips of the retractor penis muscle are precontracted by 5-hydrox- ytryptamine. Relaxation induced by nicotine is antag- onized by ganglion-blockers. PROCEDURE Retractor penis muscles are obtained from bulls of different breeds weighing 250–500 kg. Samples are dis- sected 10–30 cm distal to the points where the paired muscle bundies pass the anal orifice. Immediately after slaughter, the samples are freed from fat and other surrounding tissue and placed into Tyrode solution at 2–4 °C. Strips, 15–25 mm in length and 2–3 mm wide, are prepared and mounted in 20-ml organ baths con- taining Tyrode solution at 35 °C aerated with 95 % O2and 5%CO2. An equilibrium time of 2 to 4 h is al- lowed. During the equilibrium period washed are per- formed at about 60-min intervals. Changes in tension are recorded by means of Grass FT 03 force displacement transducers coupled to a polygraph. A high-enough tone for studying the nicotine- induced relaxation, usually 8–15 g, is generated by adding 5-HP in a concentration between 0.1 and 6 pM to the organ bath. Washing is performed 2 min after application of nicotine; 60–80 min later the tone is again raised and the application of nicotine is repeated. The effect of a neuromuscuiar blocking drug is studied only if the relaxations caused by nicotine in two consecutive controls are equal in size. EVALUATION The blocking activity of a certain concentration of a drug is expressed as % reduction in the relaxation of the muscle strip, according to the following equation: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \frac{{A - B}}{A} \times 100 $$\end{document} Where A is the size of the control relaxation in millimeters, and B is the size of the relaxation of the blocking drug. In order to construct regression lines, the activity of four or five dose levels from the as- sumed linear part of the concentration-effect curve is studied. The activity of each dose level is studied in at least 5 strips obtained from different animals. IC 50 values are calculated from the regression lines. The par- allelism of the regression lines is tested by covariance analysis. CRITICAL ASSESSMENT OF THE METHOD Molar potency ratios of known ganglion-blocking agents obtained with this method were compared with the results of other methods, such as inhibition of contraction of cat nictitating membrane evoked by preganglionic sympathetic stimulation (Bowman and Webb 1972; see 1.3.29), inhibition of nicotine-induced contraction of the isolated guinea pig ileum (Feld–berg 1951), inhibition of contraction of guinea pig vas deferens evoked by preganglionic stimulation of the hypogastric nerve in vitro (Birmingham and Hus- sain 1980), depression of postganglionic action poten- tials evoked by preganglionic stimulation of the su- perior cervical ganglion of the rat in vitro (Quilliam and Shand 1964), induction of mydriasis in mouse by blocking the ciliary ganglion (Edge 1953). A fair but not a complete agreement between the results obtained with various methods was found. MODIFICATIONS OF THE METHOD Gillespie and Sheng (1990) studied the effects of py- rogallol and hydroquinone on the response to non- adrenergic, non-cholinergic nerve stimulation in the rat anococcygeus and the bovine retractor penis muscles. Parkkisenniemi and Klinge (1996) used samples of retractor penis muscles and penile arteries from bulls for functional characterization of endothelin receptors. La et al. (1997) studied the inhibition of nitrergic nerve-induced relaxations in rat anococcygeus and bovine retractor penis muscles by hydroxycobalamin. A.1.3.31 Angiotensin II Antagonism ... PURPOSE AND RATIONALE Angiotensin II antagonists can be tested in rats after elimination of cardiovascular reflexes by vago- tomy and ganglionic blockade. Several angiotensin II antagonists possess intrinsic agonistic activity. This can be tested by injection of various doses to the vagotomized, ganglion-blocked animal. The antago- nistic activity of the angiotensin II antagonist can be evaluated by antagonism against graded doses of an- giotensin II. The duration of activity can be tested dur- ing continuous infusion of angiotensin II. PROCEDURE Male Sprague–Dawley rats weighing about 300 g are used. They are anesthetized with 60 mg/kg pentobarbital sodium i.v. One carotid artery is cannulated and connected with a Statham transducer P 23 Db. Blood pressure is recorded on a polygraph. Both jugular veins are cannulated for application of test compounds and for infusion. Both vagal nerves are cut 3 mm dorsal of the larynx. For ganglionic blockade, 10 mg/kg pen- tolinium tartrate are injected intravenously. At least 5 animals are used for evaluation of one test drug. Intrinsic Agonistic Activity After the blood pressure has reached a constant value, doses of 1, 2, 4 and 16 μg/kg of the test compound are injected via the jugular vein. Blood pressure is recorded. Antagonistic Activity In 10 min intervals doses of 0.5; 1.0; and 2.0 μg/kg angiotensin II are injected to establish dose–response curves. After 10 min, continuous infusion is started of the potential angiotensin II blocker in a dosage of 10 μg/kg/0.1 ml/min. Ten min after beginning of the infusion, again doses of 0.5; 1.0; and 2.0 μg/kg angiotensin II are injected. Duration of Activity In this set-up, angiotensin II is administered as continuous infusion at a dosage of 1 pg/kg/0.02 ml/min. When blood pressure has reached an elevated steady state level, 0.1 mg/kg of the angiotensin II antagonist is administered. Intensity and duration of the fall of blood pressure are recorded. EVALUATION Intrinsic Agonistic Activity An increase of blood pressure indicates the intrinsic agonistic activity. Antagonistic Activity Increases of blood pressure after graduated doses of angiotensin II during the infusion is expressed as per- centage of the increase before infusion. The results are compared with known angiotensin II antagonists. CRITICAL ASSESSMENT OF THE METHOD In this test not only potency and duration of activity but also the intrinsic agonistic activity of an angiotensin II antagonist can be tested. MODIFICATIONS OF THE METHOD Various other pharmacological models have been used to test angiotensin II antagonists: Blood pressure in conscious unrestrained rats with chronically implanted catheters with normal blood pressure, spontaneous hypertension and chronic renal hypertension (Vogel et al. 1976; Chiu et al. 1989; Brooks et al. 1992; Aiyar et al. 1995; Deprez et al. 1995; Gabel et al. 1995; Hilditch et al. 1995; Keiser et al. 1995; Nagura et al. 1995; Nozawa et al. 1995; Renzetti et al. 1995; Wong 1995; Junggrenet al. 1996), Blood pressure in conscious spontaneously hy- pertensive and in anesthetized ganglion-blocked rats (Olins et al. 1993), Blood pressure in pithed and in conscious renovas- cular hypertensive rats (Criscone et al. 1993; Wienen et al. 1993; Deprez et al. 1995; Kivlighn et al. 1995a; Kushida et al. 1995), Blood pressure in rats after intracerebroventricu- larly injected angiotensin II (Vogel et al. 1976; Batt et al. 1988), Blood pressure in conscious angiotensin I-infused and renin-dependent hypertensive dogs (Brooks et al. 1992; Cazaubon et al. 1993; Aiyar et al. 1995; Deprez et al. 1995; Gabel et al. 1995; Keiser et al. 1995; Wong et al. 1995), Blood pressure and heart rate in conscious sodium- depleted and sodium-repleted cynomolgus monkeys (Lacour et al. 1993; Cazaubon et al. 1993; Keiser et al. 1995), Angiotensin II induced pressor responses in marmosets (Nagura et al. 1995), Blood pressure and heart rate in conscious rhesus monkeys and anesthetized chimpanzees (Gabel et al. 1995; Kivlighn et al. 1995b; Kivlighn et al. 1995c). Inhibition of angiotensin II-induced contraction in isolated aorta rings or strips from rabbits (Chui et al. 1989, 1990; Criscione et al. 1993; Cazaubon et al. 1993; Olins et al. 1993; Wienen et al. 1993; Aiyar et al. 1995; Caussade et al. 1995; Hilditch et al. 1995; Keiser et al. 1995; Kushida et al. 1995; Nagura et al. 1995; Renzetti et al. 1995; Wong et al. 1995), from rats (Nozawa et al. 1997), from neonatal rats (Keiser et al. 1993), from guinea pigs (Mizuno et al. 1995), Inhibition of angiotensin II-induced contraction in isolated rat pulmonary artery (Chang et al. 1995), Antagonism against angiotensin II in isolated strips of rabbit aorta, rabbit jugular vein, rabbit pulmonary artery, rat portal vein, rat stomach, rat urinary bladder, human urinary bladder, human colon, human ileum (Rhaleb et al. 1991), Contractions of guinea pig ileum in situ (Khairal- lah and Page 1961), Antagonism against angiotensin II in the isolated rat uterus (Wahhab et al. 1993), Contractile force and prostaglandin E synthesis in electrically stimulated rabbit isolated vas deferens (Trachte et al. 1990), Antagonism against angiotensin II-induced aldos- terone release in bovine adrenal glomerulosa cells.(Criscione et al. 1993), and in rat dispersed adrenal capsular cells (Chang et al. 1995), Antagonism against angiotensin II-induced inhibition of guanylate cyclase activity in the rat pheochro- mocytoma cell line PC12W (Brechler et al. 1993). Brooks et al. (1995) compared the cardiovascular and renal effects of an angiotensin II receptor antag- onist and captopril in rats with chronic renal failure induced by 5/6 nephrectomy. Under sodium pentobarbital anesthesia the right kidney was removed and approximately two thirds of the left kidney was in- farcted by ligating two or three branches of the left renal artery. Kim et al. (1997) studied the effects of an an- giotensin AT1 receptor antagonist on volume over- load-induced cardiac gene expression in rats. An abdominal aortacaval shunt was prepared in 9-weeks old male Wistar rats under sodium pentobarbital anesthe- sia. The vena cava and the abdominal aorta were ex- posed by opening the abdominal cavity via a midline incision. The aorta was punctured at the union of the segment two thirds caudal to the renal artery and one third cephalic to the aortic bifurcation with a 18-gauge disposable needle. The needle was advanced into the aorta, perforating its adjacent wall and penetrating the vena cava. After the aorta was clamped, the needle was withdrawn, and a drop of cyanoacrylate glue was used to seal the aortic puncture point. The patency of the shunt was verified visually by swelling of the vena cava and mixing of arterial and venous blood. The rats were treated either with vehicle or the angiotensin antagonist. Four days after the preparation of the AC shunt, 24 h-urine volume, electrolytes and aldosterone were measured. Six days after the AC shunt blood was collected by puncture of a tail vein and plasma renin activity and aldosterone were measured. Seven days after AC shunt, hemodynamic studies were performed in pentobarbital anesthesia. Afterwards, the heart was rapidly excised, left and right atria and ventricles were separated and frozen in liquid nitrogen for the extraction and measurement of cardiac tissue RNA. Shibasaki et al. (1997) tested the effect on the renin- angiotensin-aldosterone system in conscious rats af- ter cannulation of the abdominal aorta under anesthe- sia 3–4 days before the experiment. After oral dosing of the angiotensin II receptor antagonist blood samples were withdrawn and plasma renin and aldosterone de- termined by radioimmunoassay. Similar to the effects of ACE inhibitors, lifespan of hypertensive rats could be doubled by long-term treat- ment with an angiotensin II type 1 receptor blocker (Linz et al. 2000). Ledingham and Laverty (1996) treated geneti- cally hypertensive New Zealand rats with a specific AT1 receptor antagonist via osmotic minipumps for several weeks and measured the effects on blood pressure, cardiac hypertrophy and the structure of resistance arteries. Transgenic animals were recommended for further studies to influence the human renin-angiotensin system (Müller et al. 1995; Wagner et al. 1995; Bohiender et al. 1996). A.1.3.32 ACE Inhibition Measured in Vivo in the Rat ... PURPOSE AND RATIONALE The angiotensin-converting enzyme (ACE) is respon- sible for the cleavage of the almost inactive an- giotensin I to the active angiotensin II. The same enzyme (kininase II) is responsible for the degradation of the active peptide bradykinin to inactive products. ACE activity can therefore be measured in two ways: activity of the newiy formed angiotensin II and diminution of the activity of bradykinin. ACE inhibition results in decreased activity of the precursor an- giotensin I and potentiation of the bradykinin effect. The cardiovascular system is sensitive to both peptides, reacting with an increase of blood pressure to angiotensin II and with a decrease to bradykinin. These reactions can be used for quantitative determination of ACE inhibiting activity. PROCEDURE Male Sprague–Dawley rats weighing 300–400 g are used. The animals are anesthetized by i.p. injection of 70 mg/hg pentobarbital. After intubation of the trachea they are artificially respirated with 30 strokes/min and a stroke volume of 6–8 ml. The right carotid artery is cannulated and blood pressure registered with a Statham-element (P23Db) and a polygraph. One jugular vein is cannulated for i.v. injections. After la- parotomy a catheter is inserted into the duodenum for enteral administration and the wound closed again. Blood pressure is stabilized 30 % below the normal level by i.m. injection of 5 mg/kg pentolinium. In order to prevent excessive mucus production in the bronchial system, 40 pg/kg atropine sulfate are injected intra- muscularly. Inhibition of Angiotensin I Cleavage After stabilization of blood pressure, 310 ng/kg an- giotensin I is injected intravenously in 0.1 ml saline. The injection is repeated in 5-min intervals until an identical pressure reaction occurs. The test compounds are administered at doses of 1 and 10 mg/kg intravenousiy or 25 mg/kg intraduodenally. 3 min after iv. injection or 10 min after i.d. administration, again 310 ng/kg angiotensin I is injected. Standards are ramipril, enalapril or captopril. Potentiation of Bradykinin-Induced Vasodepression A low dose of bradykinin has to be chosen in order to visualize the bradykinin potentiation. One μg/kg, even- tually 3 μg/kg bradykinin are injected intravenously at 5 min intervals until a stable reaction is achieved. Three min after i.v. injection or 10 min after in- traduodenal administration of the test substance, the bradykinin injection is repeated. EVALUATION Inhibition of Angiotensin I Cleavage The diminution of the pressure reaction to angiotensin I after administration of a potential ACE inhibitor is the parameter for the activity of the new com- pound. The inhibition is calculated as percent of controls. Using various doses of the ACE inhibitor, dose- response curves can be established and ID 50 values be calculated. Potentiation of Bradykinin-Induced Vasodepression Potentiation of bradykinin induced vasodepression is expressed as percentage of controls. Using various doses of the test compound and the standard, dose- response curves can be established and potency ratios calculated. CRITICAL ASSESSMENT OF THE METHOD Both parameters, inhibition of angiotensin I response and potentiation of bradykinin-induced vasodepres- sion have been proven as reliable parameters for evaluation of ACE inhibitors. MODIFICATIONS OF THE METHOD Natoff et al. (1981) used the ratio of responses to an- giotensin I and angiotensin II in spontaneously hy- pertensive rats, either pithed or anesthetized with ure- thane, to determine the degree and the duration of ef- fect of captopril. Blood levels of angiotensin II can also be measured by radioimmunoassay. Several studies in rats showed the beneficial effects of prolonged treatment with ACE inhibitors. Postoper- ative mortality in rats with left ventricular hypertrophy and myocardial infarction was decreased by ACE inhibition (Linz et al. 1996). Inhibition of angiotensin I-induced pressure re- sponse by administration of ACE-inhibitors can be measured not only in anesthetized rats, but also in anesthetized dogs, conscious rats and conscious dogs (Becker et al. 1984). Life-long ACE inhibition doubles lifespan of hypertensive rats not only if the treatment is started at the age of one month (Linz et al. 1997), but ramipril also in- creases survival in old spontaneously hypertensive rats if treatment is started at the age of 15months (Linz et al. 1999). Panzenbeck et al. (1995) reported that captoprilinduced hypotension is inhibited by the bradykinin blocker HOE 140 in Na + depleted marmosets. A.1.3.33 Evaluation of Renin Inhibitors in Dogs ... PURPOSE AND RATIONALE Highly specific inhibitors of the enzyme renin are con- sidered to be potential antihypertensive agents. These agents cause a fall in blood pressure of sodium-deficient dogs and decrease plasma renin activity as well as angiotensin II level. PROCEDURE Animal Experiment Adult mongrel dogs (8–14 kg) of either sex are given water ad libitum and maintained on a low sodium diet for 1-2weeks before the experiment. A single intra- muscular injection of 5 mg/kg furosemide is given 48 h before the experiment. On the day of the experiment the dogs are anesthetized with sodium pentobarbital (30 mg/kg i.v.) and a cuffed endotracheal tube is positioned to allow artificial respiration. To measure arterial blood pressure a femoral artery is catheterized with polyethylene tubing. The right and left femoral veins are catheterized for drug administration and de- livery of a maintenance infusion of sodium pentobarbital (5 mg/kg/h). Blood pressure is measured directiy through the catheter, which is connected to a Gould- Statham pressure transducer. Blood samples are col- lected from the arterial catheter. Increasing doses of the potential renin inhibitor are infused over 30 min followed by a 30 min recovery period. Immediately after the last recovery period, the dogs are given an i.v. infusion of the angiotensin receptor antagonist saralasin (20 μg/kg/min) for 30 min. For measurement of plasma renin activity and an- giotensin II levels, the dogs are infused over a period of 30 min with the test compound and blood is with- drawn at 0, 15, 30, 60, 90, 120, 180, and 240 min after the start of the infusion. After the final blood drawing, 20 μg/kg/min saralasin is infused for 30 min. Analytical Procedures The antibody-trapping method is preferred to mea- sure plasma renin activity (PRA). In this procedure PRA is determined at pH7.4 by RIA quantification of angiotensin I (ANG I) generated and then trapped by excess anti-ANG I antibody (Poulsen and Jor- gensen 1973; Nussberger et al. 1987). In tubes coated with rabbit anti-ANG I antibody (Gamma Coat™ 125I Plasma renin activity RIA kit; Baxter Travenol Diagnostics) and incubated in an ice-water bath, 75 μl plasma are mixed with 7 μl 3 M TRIS base buffer (pH7.2) containing 200 mM EDTA, and 3 μl 0.2 M TRIS base (pH7.5) containing 3 g/L human serum al- bumin (fraction V, Sigma). Tubes are vortexed and incubated at 37 °C for 60 min. The incubation is termi- nated by placing the tubes in an ice-water bath. Next, 75 pl of the TRIS albumin buffer are added, followed by 1 ml phosphate RIA buffer (Gamma Coat™) containing 15,000 cpm of 125I ANG I. Standard ANG I (0.2-50 ng/ml) is also incubated at 37 °C for 60 min with 10 μl TRIS/albumin buffer. In an ice-water bath, low renin plasma (75 μl) is added to the standards be- fore the addition of a 1 ml tracer solution. Samples and standards are incubated for 24 h at 4 °C. Tubes are then aspirated and counted in a gamma counter. Levels of immunoreactive angiotensin II (ir- ANG II) are measured using a procedure described by Nussberger et al. (1985). Two-three ml of whole blood are collected in prechilled glass tubes con- taining 125 μl of the following “inhibitor” solution: 2 % ethanol, 25 mM phenanthroline, 125 mM EDTA, 0.5 mM pepstatin A, 0.1 mM captopril, 2 g/l neomycin sulfate, and 0.1 mM of the renin inhibitor CGP 38560. The tubes are then centrifuged and the plasma quickly frozen in liquid nitrogen and stored at −70 °C. For extraction of angiotensin peptides, Bond-Elut cartridges (Bond-Elut-pH) containing 100 mg phenylsilica are used, along with a Vac Elut SPS24 vacuum manifold (Analytichem; Harbor City, CA). Each cartridge is pre- conditioned with 1.0 ml methanol (HPLC grade) followed by 1.0 ml of water (HPLC grade) at a vacuum pressure of 5 mm Hg. One ml of the thawed sam- ple is then applied to the cartridge and washed with 3 ml HPLC grade water. The angiotensin peptides re- tained at the columns are eluted with 0.5 ml methanol (HPLC grade, vacuum pressure less than 5 mm Hg) into polypropylene tubes coated with a buffer con- taining 0.2 M TRIS, 0.02 % NaN3, and 2.5 mg/ml fatty acid-free bovine serum albumin (pH7.4 with glacial acetic acid). The methanol is evaporated at 40 °C and ir-ANG II measured using an antibody (IgG Corp., Nashville, TN) with greater than 1000-fold selectivity for ANG II. EVALUATION All data are expressed as mean ± SEM. The hypotensive responses after various doses of the renin antagonist are compared with the inhibition of plasma renin activity and the decrease of immunoreactive angiotensin II. CRITICAL ASSESSMENT OF THE METHOD The antibody-trapping method, reported here, gives a better correlation with the blood pressure lowering effect in dogs than the conventional method based on RIA for generated ANG I (Palmer et al. 1993). MODIFICATIONS OF THE METHOD Pals et al. (1990) described a rat model for evaluating inhibitors of human renin using anesthetized, nephrectomized, ganglion-blocked rats. The blood pressure rise induced by sustained infusion of renin was dosedependently decreased by a renin inhibitor. A.1.3.34 Evaluation of Renin Inhibitors in Monkeys ... PURPOSE AND RATIONALE The renin-angiotensin-system as the main regulator of blood pressure can be influenced in several ways. One approach involves the inhibition of renin. Renin is an aspartyl protease that hydrolyzes angiotensinogen to release the dekapeptide angiotensin I, which is subsequently converted to angiotensin II by angiotensin-converting-enzyme. Sequencing of renin and angiotensinogen from various species revealed marked species differences for both the enzyme and the substrate. Inhibitors developed for human renin show a high specificity for primate renin and show only weak inhibition of renin from subprimate species. This means that the most common laboratory animals, such as rats and dogs, are not suitable for the in vivo evaluation of renin inhibitors. The marmoset was chosen by Wood et al. (1985,1989) as a primate model. PROCEDURE Marmosets (Callithrix jacchus) of both sexes weighing between 300 and 400 g are fed a pellet diet supplemented with fruit. Two days prior to the experi- ment the animals are anesthetized and catheters are implanted in a femoral artery for measurement of blood pressure and in a lateral tail vein for injection or infusion of test substances. Thirty min before the experiment, the animals receive an intravenous injection of 5 mg/kg furosemide in order to stimulate renin release. During the experiment, the marmosets are sedated with diazepam (0.3 mg/kg i.p.) and kept in restraining boxes. Mean blood pressure is recorded continuously, and heart rate is measured at fixed intervals. The test compound or the standard are injected at various doses by intravenous infusion or administered orally. EVALUATION Blood pressure is recorded after 30 min of intravenous infusion and 30 min after stopping the infusion. Comparing the changes from pretreatment values after various doses, dose–response curves can be established. MODIFICATIONS OF THE METHOD Fischli et al. (1991) monitored arterial pressure in conscious and chronically instrumented monkeys using a telemetry system. One week before the experiment, the animals were anesthetized, and a 3 F high fidelity pressure tip transducer (Millar Instruments, Inc.) was inserted into the abdominal aorta through the right femoral artery. Then the catheter was tunneled subcutaneousiy to the back of the monkey in the interscapular region. The proximal part of the catheter was connected to a transmitter located in a jacket worn by the monkey. The blood pressure was transmitted continuousiy to a receiver, which transformed the signal to an analogue value of blood pressure. Linz et al. (1994) reported on the effects of renin inhibitors in anesthetized rhesus monkeys weighing between 5 and 13 kg. The animals are sodium-depleted by administration of 10 mg/kg/day furosemide-Na for 6consecutive days. At day 7, 10 mg/kg furosemide is given i.v. 30 min before the start of the experiment. Anesthesia is induced with 20 mg/kg ketaminehydrochloride i.m. and continued with 40 mg/kg pentobarbitone-Na, slow i.v. drip. After completion of surgical procedures and after insertion of catheters under fluoroscopic control, the following hemodynamic parameters are measured: Puise rate, and systolic and diastolic blood pressures are registered with a transducer (Statham P23ID) in one femoral artery. A catheter tip manometer (Millar Instruments, Houston, Texas, USA) is introduced into the left ventricular cavity for the determination of left ventricular pressure. Contractility is electronically deduced from left ventricular pressure with appropriate amplifiers (Hellige GmbH, Freiburg, Germany). The electrocardiogram (ECG) from conventional lead II is taken using an ECG transducer (Hellige GmbH). Heart rate is measured from QRS-peaks using a biotachometer (Hellige GmbH). Cardiac output is determined using the thermodilution method. Thermodilution is integrated and converted to cardiac output readings by commer- cially available equipment (HMV7905, Hoyer, Bre- men). To determine cardiac output, 2 ml chilled 0-5 °C isotonic glucose solution (5 %) is injected rapidly into the right ventricle by a catheter via the right jugular vein. A thermistor is placed into the aortic arch via the right carotid artery. Hemodynamics are monitored for 30 min following i.v. injection of various doses of the potential renin inhibitor. At the end of the experiments the ACE inhibitor ramiprilat 100 μg/kg is given i.v. to probe for an additional blood pressure lowering effect. Blood sampies for the determination of ANG II concentration, renin inhibition and plasma drug levels are withdrawn at 10, 30 and 60 min after i.v. injection of the renin inhibitor. The volume is replaced by i.v. injections of isotonic glucose solution (5 %). After all data and blood samples have been obtained, animals are sacrificed by an overdose of pentobarbitone-Na. For experiments after intraduodenal administration sodium depletion and anesthesia are done as described above. A small side branch of the femoral or radial artery is surgically exposed and cannulated for blood pressure measurements using a pressure transducer (P23 ID). Heart rate is determined from a conventional ECG lead by a biotachometer. Blood samples are withdrawn via a catheter placed into the saphenous vein. A gastric fiberscope (Olympus XP10) is introduced into the duodenum under visual control and the renin inhibitor is administered intraduodenally through the service channel of the fiberscope in a volume of 5 ml. Blood samples are withdrawn before and at 15, 30,45, 60, 90 and 120 min after intraduodenal administration. Wood et al. (2005) tested an orally effective renin inhibitor (aliskiren) in marmosets. Blood pressure and heart rate were measured by telemetry in conscious animals moving freely in their home cages. Pressure transmitters (AM Unit, model TA11PA-C40Data Sciences, USA) were implanted into the peritoneal cavity under aseptic conditions and light anesthesia. The sensor catheter was placed in the aorta below the renal artery pointing upstream. CRITICAL ASSESSMENT OF THE METHOD Due to the high species specificity of renin and its substrate, angiotensinogen, renin inhibitors for treatment of hypertension have to be tested in primate models. The marmoset as well as the rhesus monkey have been proven to be suitable models. A.1.3.35 Penile Erection in Rabbits ... PURPOSE AND RATIONALE The discovery of inhibitors of phosphodiesterase as effective drugs for patients with erectile dysfunction (Klotz et al. 2001; Porst et al. 2001) has stimulated the use of appropriate in vivo animal models. In particular, rabbits have been recommended as models for impotence research (Bischoff and Schneider 2000, 2001; Bischoff 2001; Bischoff et al. 2001; Saenz de Tejadaet al. 2001) confirming earlier work in this area (Thielen et al. 1969; Sjostrand andKline 1979; Naganumaet al. 1993; Lin and Lin 1996). PROCEDURE Adult male Chinchilla rabbits weighing 3.5-4.5 kg are housed in individual cages for at least 1 week after arrival, at room temperature with water and food ad libitum. For the study, an indwelling catheter filled with saline is inserted into a marginal ear vein and taped in position. The drugs are injected into the ear vein, fol- lowed by a small volume of saline. The time is noted and at appropriate times the animal gently removed from the cage and held by one research worker. The rabbit penis is not visible when it is not erect (Na- ganuma et al. 1993). However, when erection occurs, it is possible to examine the pudendal area and measure the length of the uncovered penile mucosa with sliding calipers. EVALUATION Penile erection is evaluated by measuring the length to the nearest millimeter of the uncovered penile mucosa with a sliding caliper at 5, 10, 15, 30, 50, 60, 90, and 120 min after administration of the test compounds and continued hourly for up to 5 h. Mean values are calculated and results expressed as means ± SEM. The area under the curve is calculated by an integration program. MODIFICATIONS OF THE METHOD Choi et al. (2002) compared the efficacy of verdenafil and sildenafil in facilitating penile erection in anesthetized rabbits. Penile erections were elicited by submaximal pelvic nerve stimulation every 5 min for 30 min. Response was assessed by continuously recording intracavernosal pressure and systemic arterial pressure. Min et al. (2000) tested the augmentation of pelvicnerve-mediated sexual arousal in anesthetized female rabbits by sildenafil. The following parameters were measured before, during and after pelvic nerve stimulation at 4, 16, and 32 Hz: (1) hemoglobin concentration and oxygen saturation in female genital (vaginal, labial, clitoral) tissues by laser oximetry; (2) clitoral blood flow by laser Doppler flowmetry; (3) vaginal luminal pressure by a balloon catheter pressure transducer; (4) vaginal lubrication by tampon. Carter et al. (1998) tested the effect of the selective phosphodiesterase type 5 inhibitor sildenafil on erectile dysfunction in pentobarbital-anesthetized dogs. Increases in intracavernosal pressure in the corpus cavernosum and penile blood flow were induced by pelvic nerve stimulation over a frequency range of 1–16 Hz. The effects of increasing doses of sildenafil on electricstimulated intracavernosal pressure, penile blood flow, blood pressure, and heart rate were evaluated. A.1.4 Cardiovascular Safety Studies See: Brian D. Guth Methods in Cardiovascular Safety Pharmacology Chapter I. D. In: Drug Discovery an Evaluation Safety and Pharmacokinetic Assays By: H.G: Vogel (Ed), F.J. Hock, J. Maas, D. Mayer (CoEds) Springer Verlag Berlin Heidelberg New York, 2006 A.2 Methods to Induce Experimental Hypertension ... A.2.0.1 Acute Renal Hypertension in Rats ... PURPOSE AND RATIONALE Since the classical experiments of Goldblatt et al. (1934) there is clear evidence that the ischemia of the kidneys causes elevation of blood pressure by activation of the renin-angiotensin system. The principle can be used both for acute and chronic hypertension. In rats acute renal hypertension is induced by clamping the left renal artery for 4 h. After reopening of the vessel, accumulated renin is released into circulation. The protease renin catalyzes the first and rate-limiting step in the formation of angiotensin II leading to acute hypertension. The test is used to evaluate antihypertensive activities of drugs. PROCEDURE Male Sprague–Dawley rats weighing 300 g are used. The animals are anesthetized by intraperitoneal injection of 100 mg/kg hexobarbital sodium. A PVC-coated Dieffenbach clip is placed onto the left hilum of the kidney and fixed to the back muscles. The renal artery is occluded for 3.5–4 h. 3.5 h following the surgery, the animals are anesthetized by intraperitoneal injection of 30–40 mg/kg pentobarbital sodium. The trachea is cannulated to facilitate spontaneous respiration. To measure systolic and diastolic blood pressure, the cannula in the carotid artery is connected to a pressure transducer (Statham P 23 Db). For administration of the test compound, a jugular vein is cannulated. Following a stable blood pressure state, ganglionic blockade is performed with pentolinium (10 mg/kg i.v.). After obtaining stable reduced blood pressure values, the renal arterial clip is removed. This leads to a rise in blood pressure as a consequence of elevated plasma renin level. Within 15 min a stable hypertension is achieved (control = 100 %). The test substance is then administered by intravenous injection at doses of 10 and 100 μg/kg. Blood pressure is monitored continuously until a renewed increase to the starting level is obtained. Ten-twelve animals are used per compound. EVALUATION Increase in blood pressure after reopening of the renal artery and reduction in blood pressure after administration of the test drug are determined [mm Hg]. Percent inhibition of hypertensive blood pressure values under drug treatment are calculated as compared to pretreatment hypertension values. Duration of the effect is determined [min]. Statistical significance is assessed by the paired t-test. MODIFICATIONS OF THE METHOD A sharp and transient in systemic arterial blood pressure associated with reflex bradycardia can be elicited by injection of 5-hydroxytryptamine, cyanide, nicotine or lobeline into the coronary artery blood stream of dogs (Berthold et al. 1989). The phenomenon is named the cardiogenic hypertensive chemoreflex and 5-HT proved to be the most powerful agent for its initiation (James et al. 1975). A.2.0.2 Chronic Renal Hypertension in Rats ... PURPOSE AND RATIONALE On the basis of the findings of Goldblatt et al. (1934) that ischemia of the kidneys induces hypertension, various modifications of the technique have been described for several animal species. One of the most effective modifications in rats is the so called 1-kidney- 1-clip method. PROCEDURE Male Sprague–Dawley rats weighing 200–250 g are anaesthetized with 50 mg/kg i.p. pentobarbital. The fur on the back is shaved and the skin disinfected. In the left lumbar area a flank incision is made parallel to the long axis of the rat. The renal pedicel is exposed with the kidney retracted to the abdomen. The renal artery is dissected clean and a U-shaped silver clip is slipped around it near the aorta. Using a special forceps (Schaffenburg 1959) the size of the clip is adjusted so that the internai gap ranges from 0.25–0.38 mm. The right kidney is removed through a flank incision after tying off the renal pedicle. The skin incisions are closed by wound clips. 4–5 weeks after clipping blood pressure is measured and rats with values higher than 150 mm Hg selected for the experiments. Blood pressure readings are taken on each of 3 days prior to drug treatment. Drugs are administered orally in volumes of 10 ml/kg. The rats are divided into 4 animals per dose and each animal is used as his own control. Compounds are administered for 3 days and predrug and 2 h postdrug blood pressure readings are taken. EVALUATION Changes in systolic blood pressure are expressed in mm Hg. Activity is determined by comparing treatment blood pressure values with the control blood pressure value (Day 1, predrug blood pressure). Comparisons are made using the paired t-test for evaluation of statistical significance. MODIFICATIONS OF THE METHOD Duan et al. (1996) induced renal hypertension in male Hartley guinea pigs by a two-step procedure consisting of ligation of the left caudal renal artery and right nephrectomy. Arterial blood pressure and heart rate were monitored in conscious animals. ACE-inhibitors reduced blood pressure in sham-operated and in renal hypertensive guinea pigs, whereas renin inhibitors were effective only in renal hypertensive animals. A.2.0.3 Chronic Renal Hypertension in Dogs ... PURPOSE AND RATIONALE Production of hypertension by clamping renal arteries has been first described by Goldblatt et al. (1934) in dogs. Later on, the method has been modified, e. g., as the “wrapping” technique (Abram and Sobin 1947). PROCEDURE Dogs weighing 8–12 kg are anesthetized with i.v. injection of 15 mg/kg thiopental. Anesthesia is maintained with a halothane-oxygen mixture. Under aseptic conditions, a midline abdominal incision is made. One kidney is exposed and wrapped in cellophane and then replaced. The contralateral kidney is exposed. The artery, vein and ureter are ligated and the kidney is removed. The abdomen is closed by sutures and clips. On the day of surgery and for 3 days following, the dogs are given antibiotics. Body temperature is measured twice daily for 4 days following surgery. Six weeks following surgery, blood pressure is measured using a tail-cuff method. For recording, the tail-cuff is attached to a polygraph. Only animals with a systolic blood pressure higher than 150 mm Hg are considered to be hypertensive and can participate in studies evaluating potential antihypertensive compounds. For the experiment, blood pressure is recorded either by the indirect tail-cuff method or by direct measurement via an implanted arterial cannula. On day 1 readings are made every 2 h, just before, and 2 and 4 h after oral treatment with the potential antihypertensive compound. Drug administration is repeated for 5 days. On days 3 and 5 blood pressure readings are taken before and 2 and 4 h after treatment. At least 3 dogs are used per dose and compound. EVALUATION The starting value is the average of the 2 readings before application of the drug. Each of the following readings is subtracted from this value and recorded as fall of blood pressure at the various recording times. MODIFICATIONS OF THE METHOD Renal hypertension in rats has been achieved by many modifications of the method (Stanton 1971) such as the technique according to Grollman (1944). The kidney is exposed through a lumbar incision, the renal capsule is removed by gentle traction, and a figure-8 ligature is applied being tight enough to deform the kidney but not tight enough to cut the tissue. Renal hypertension may be induced in the rat by encapsulating both kidneys with latex rubber capsules (Abrams and Sobin 1947). Moulds are formed from plastic using a rat kidney as a model. The capsules are prepared by dipping the moulds in liquid latex allowing them to dry in the air. Three applications of latex are applied before the capsules are toughened by placing them under warm running tap water. The kidney is exposed by lumbar incision, the renal capsule gently removed and the capsule applied. A.2.0.4 Neurogenic Hypertension in Dogs ... PURPOSE AND RATIONALE Vasodilator and depressor reflexes, originating in the baroreceptor areas of the carotid sinus and aortic arch, play an important part in the regulation of blood pressure. Stimulation of the afferent buffer fibres exerts an inhibitory influence on the vasomotor center, and their sectioning leads to a persistent rise in blood pressure. In this way, acute neurogenic hypertension can be induced in dogs. PROCEDURE Adult dogs of either sex weighing 10–15 kg are anesthetized using 15 mg/kg sodium thiopental, 200 mg/kg sodium barbital and 60 mg/kg sodium pentobarbital i.v. A femoral vein and artery are cannulated using polyethylene tubing to administer compounds i.v. and record arterial pressure and heart rate, respectively. Left ventricular pressure anddp/dt are recorded via the left common carotid artery (post-deafferentiation) using a Millar microtip pressure transducer. P max is recorded by speeding up the chart paper. Cardiac output is determined by introducing a Swan-Ganz catheter into the right heart and pulmonary artery via a jugular vein. Five ml of cold 5 % dextrose is injected into the right atrium and an Edwards Cardiac output computer is used to calculate the cardiac output from the temperature change in the pulmonary artery. All recordings are made with a polygraph. Both of the carotid arteries are cleared up to the bifurcation of the internal and external carotid arteries. The carotid sinus nerves are isolated, ligated and sectioned and a bilateral vagotomy is performed to produce neurogenic hypertension (mean arterial pressure more than 150 mm Hg). The dog is allowed to equilibrate for approximately 30 min and a bolus of the test compound is administered by intravenous injection. Heart rate, arterial pressure, left ventricular pressure,Pmax and dp/dt are monitored for 90 min. A minimum of 3 dogs are used for each compound. EVALUATION Changes of the cardiovascular parameters are expressed as percentage of the values before administration of the drug. MODIFICATIONS OF THE METHOD Neurogenic hypertension through baroreceptor denervation has also been described in rabbits (Angell- James 1984) and in rats (Krieger 1984). CRITICAL ASSESSMENT OF THE METHOD The neurogenic hypertension is useful for acute experiments. However, it is less useful for chronic experiments since the elevated blood pressure caused by buffer nerve section is more labile than that caused by renal ischemia. A.2.0.5 DOCA-salt Induced Hypertension in Rats ... PURPOSE AND RATIONALE Mineralocorticoid-induced hypertension is thought to be due to the sodium retaining properties of the steroid causing increases in plasma and extracellular volume. The hypertensive effect is increased by salt loading and unilateral nephrectomy in rats. PROCEDURE Male Sprague Dawley rats weighing 250–300 g are anesthetized with ether. Through a flank incision the left kidney is removed. The rats are injected twice weekiy with 20 mg/kg s.c. desoxycorticosteroneacetate in olive oil for 4 weeks. Drinking water is replaced with a 1 % NaCl solution. Blood pressure starts to rise after one week and reaches systolic values between 160 and 180 mm Hg after 4 weeks. MODIFICATIONS OF THE METHOD The regimen to induce DOCA-salt hypertension has been modified by many authors (Stanton 1971). DOCA pellets (Peterfalvi and Jequier 1960; Passmore and Jimenez 1990) or implants in silastic devices (Ormsbee and Ryan 1973; King and Webb 1988) were used instead of repeated injections. DOCA-salt hypertension can also be achieved without nephrectomy (Bockman et al. 1992). Using kininogen-deficient Brown Norway Katholiek (BN-Ka) rats, Majima et al. (1991, 1993) showed suppression of rat desoxycorticosterone-salt hypertension by the kallikrein-kinin system. Li et al. (1996) examined small-artery structure on a wire myograph and quantified endothelin-1 messenger RNA by Northern blot analysis in DOCA-salt hypertensive rats after administration of an ACE-inhibitor, a calcium channel antagonist and a nitric oxide synthase inhibitor. Ullian (1997) described the Wistar-Furth rat as a model of mineralocorticoid resistance. These rats developed two-kidney, one-clip hypertension to the same degree as did Wistar rats and reacted to glucocorticoid treatment with a rapid onset of hypertension, but were resistant to the development of DOCA-NaCl hypertension. Studies in DOCA-salt hypertensive mice were reported by Gross et al. (1998, 1999), Honeck et al. (2000), Peng et al. (2001). A.2.0.6 Fructose Induced Hypertension in Rats ... PURPOSE AND RATIONALE Increases in dietary carbohydrate intake can raise blood pressure in experimental animals. The increased intake of either sucrose or glucose was shown to enhance the development of either spontaneous hypertension or salt hypertension in rats (Hall and Hall 1966; Preuss and Preuss 1980; Young and Landsberg 1981). Hwang et al. (1987) first reported that hypertension could be induced in normal rats by feeding a high-fructose diet. Fructose feeding was also found to cause insulin resistance, hyperinsulinemia, and hypertriglyceridemia in normal rats (Zavaroni et al. 1980; Tobey et al. 1982). Dai and McNeill (1995) studied the concentration- and duration-dependence of fructose- induced hypertension in rats. PROCEDURE Groups of 8 male Wistar rats weighing 210–250 g are used. The are housed two per cage on a 12-h light 12- h dark cycle and are allowed free access to standard laboratory diet (Purina rat chow) and drinking fluid. Drinking fluid consists either of tap water or 10 %- fructose solution. Body weight, food intake and fluid intake of each rat are measured every week during treatment. Using the taii-cuff method, systolic blood pressure and pulse rate is measured before and every week during treatment. Blood samples are collected before and every second week during treatment for determination of plasma glucose, insulin, and triglycerides. EVALUATION Since maximum effects on the chosen parameters are achieved after 6 weeks, the duration of treatment can be limited to this time. Statistical analysis is performed using a one-way or two-way analysis of variance, followed by the Newman-Keuls test. MODIFICATIONS OF THE METHOD Reaven et al. (1988, 1989) found an attenuation of fructose-induced hypertension by exercise training and an inhibition by somatostatin treatment. Brands et al. (1991,1992) found an increase of arterial pressure during chronic hyperinsulinemia in con- scious rats. Hall et al. (1995) reported the effects of 6 weeks of a high-fat diet on cardiovascular, renal, and endocrine functions in chronically instrumented conscious dogs.Body weight increased by approximately 16.9 kg, whereas MAP, cardiac output, and heart rate increased by 28 %, 77 %, and 68 %, respectively. A.2.0.7 Genetic Hypertension in Rats ... SURVEY Inherited hypertension in rats has been described by Smik and Hall 1958; Phelan and Smirk 1960; Laverty and Smirk 1961; Phelan 1968 as genetically hypertensive (GH) rats (Simpson and Phelan 1984). Okamoto et al. (1963, 1966) reported the development of a strain of spontaneously hypertensive rats from mating one Wistar male rat with spontaneously occurring high blood pressure with a female with slightly elevated blood pressure. By inbreeding over several generations a high incidence of hypertension with blood pressure values of 200 mm Hg or more was achieved. These strains were called“Spontaneously hypertensive rats (Akamoto-Aoki)” = SHR or“Wis- tar-Kyoto rats” = WKY. Hypertension in these rats is clearly hereditary and genetically determined, thus comparable to primary hypertension in humans. Cardiac hypertrophy (Sen et al. 1974) and cellular ionic transport abnormalities have been observed (Yamori 1984). Inbred strains being salt-hypertension-sensitivey and salt-hypertension-resistant (RD) have been de;veloped by Dahl et al. (1962, 1963), Rapp (1984), Cicila et al. (1993). Inoko et al. (1994) reported the transition from compensatory hypertrophy to dilated, fail- ing left ventricles in Dahl salt-sensitive rats. Two strains of rats with inbred dissimilar sensitivity to DOCA-salt hypertension ("Sabra strain") have been separated by Ben-Ishay et al. (1972, 1984). Another hypertensive strain derived from Wistar rats was producedby brother-sister mating in the group of Bianchi et al. (1974, 1986) at the University of Milan called“Milan hypertensive strain” = MHS. These rats show a cell membrane defect resulting in abnormal kidney function. Salvati et al. (1990) studied the diuretic effect of bumetanide in isolated perfused kidneys of Milan hypertensive rats. Furthermore, the“Lyon” strains of hypertensive, normotensive and low-blood-pressure rats were developed (Dupont et al. 1973; Vincent et al. 1984; Dubay et al. 1993). These rats show a genetically determined defect in central nervous function. Spontaneously hypertensive rats which develop failure before 18 months have been selectively bred. Several substrains of spontaneous hypertensive rats were separated by the group of Okamoto et al. (1974) including the stroke-prone strain SHR = SHRSP. These rats have an increased sympathetic tone and show a high incidence of hemorrhagic lesions of the brain with motor disturbances followed by death (Yamori 1984; Feron et al. 1996). A strain of obese spontaneously hypertensive rats has been described by Koletsky (1975), Ernsberger et al. (1993). With new techniques of genetic engineering, transgenic rats with hypertension could be created. Increase of blood pressure of spontaneously hypertensive rat is determined by multiple genetic loci (Deng and Rapp 1992; Dubay et al. 1993). With new technology not only these loci could be defined but also new models in hypertension research and models to detect antihypertensive drugs could be established (Bohlen- der et al. 1997; Pinto et al. 1998). Mullins et al. (1990) reported fulminant hypertension in transgenic rats harboring the mouse Re-2 gene. A rat strain TGR(mREN2)27 as a monogenetic model in hypertension research was described by Pe- ters et al. (1993), Lee et al. (1996), Langheinrich et al. (1996), and Ohta et al. (1996). Bohlender et al. (1996) reconstructed the human renin-angiotensin system in transgenic rats overex- pressing the human angiotensin gene TGR(hOGEN) 1623 by chronically injecting human recombinant renin intravenously using Alzet pumps. Zolk et al. (1998) described the effects of quinapril, losartan and hydralazine on cardiac hypertrophy and P-adrenergic neuroeffector mechanisms in transgenic TGR(mREN2)27 rats. CRITICAL ASSESSMENT OF THE METHOD The use of spontaneously hypertensive rats to detect potential antihypertensive compounds is well established. On the basis of available data no preference can be given to a particular strain. The most abundant experience has been gained with the Wistar-Kyoto strain. Transgenic rats with well defined genomes are gaining more importance. MODIFICATIONS OF THE METHOD Pijl et al. (1994) described streptozotocin-induced diabetes mellitus in spontaneously hypertensive rats as a pathophysiological model for the combined effects of hypertension and diabetes. Rosenthal et al. (1997) used rats of the CohenRosenthal diabetic hypertensive strain to examine the effects of an ACE-inhibitor, an ATII antagonist and a calcium antagonist on systolic pressure and sponta- neous blood glucose levels. Holycross et al. (1997) used hypertensive SHHF/ Mcc-facp rats to study plasma renin activity during development of heart failure. Linz et al. (1997) compared the outcome of lifelong treatment with the ACE inhibitor ramipril in young prehypertensive stroke-prone spontaneously hyperten- sive rats and age-matched normotensive Wistar-Kyoto rats. Lifelong ACE inhibition doubled the lifespan in hypertensive rats matching that of normotensive rats. Studies in genetically hypertensive mice were reported by Rosenberg et al. (1985), Hamet et al. (1990) Meneton et al. (2000). Ohkubo et al. (1990) generated transgenic mice with elevated blood pressure by introduction of the rat renin and angiotensinogen genes. A.2.0.8 Hypertension Induced by Chronic NO-Synthase Inhibition ... PURPOSE AND RATIONALE Tonic basal release of nitric oxide (NO) by vascular endothelial cells controls blood pressure in the basal state. Chronic blockade of NO synthesis in the rat produces systemic hypertension and glomerular damage (Baylis et al. 1992). This was recommended by Ribeiro et al. (1992) as a model of hypertension. Yang et al. (1996) found an increase of vascular angiotensin II receptor expression after chronic inhibition of NO synthase in spontaneously hypertensive rats. The detrimental sequels of chronic NO synthase inhibition in rats can be inhibited by treatment with ACE inhibitors (Hropot et al. 1994; Küng et al. 1995). Hsieh et al. (2004) reported that NO inhibition by L-NAME accelerates hypertension and induces perivascular inflammation in rats. Hropot et al. (2003) reported that angiotensin II subtype AT1 receptor blockade prevents hypertension and renal insufficiency induced by chronic NO synthase inhibition in rats. PROCEDURE Male Wistar rats at an age of 7–8 weeks weighing 210 ± 10 g were placed at random in metabolic cages, divided in four to six groups of six to eight rats each. Group 1 (control) had free access to tap water and food. Groups 2–4 were treated with 0.02 % L-NAME water solution for 6 weeks in a daily dose of 25 mg/kg. Groups 3 and 4 received the angiotensin receptor antagonists fonsartan (10 mg/kg) or lorsatan (30 mg/kg) for 6 weeks daily per stomach tube. Groups 5 and 6 received fonsartan and lorasatan alone. At the end of the study, 24-h urine samples were collected and retrobulbar blood samples were taken in short inhalation anesthesia. Plasma values of creatine, PRA and electrolytes were determined. For clearance evaluation rats were anesthetized with 50 mg/kg thiopentone i.p. In order to determine glomerular filtration rate and renal plasma flow, clearances of inulin and para-aminohippurate were performed. After the clearance experiments, the rats were sacrificed and hearts and kidneys removed. Hearts were perfused in the isolated working heart preparation via the aorta with modified Krebs-Henseleit buffer containing solvents or drugs. After a preischemic period of 20 min, acute regional myocardial ischemia was produced by clamping the left coronary artery close to its origin for 15 min (ischemic period). Thereafter, the clip was removed and changes during reperfusion were monitored (reperfusion period). The following cardio-dynamic and cardio-metabolic parameters were measured: incidence and duration of ventricular fibrillation, left ventricular pressure, contractility (dP/dt max), heart rate and coronary flow; in the coronary effluent lactate dehydrogenase, creatine kinase and lactate; in the myocardial tissue lactate, glycogen, ATP and creatine phosphate. Left ventricular pressure was measured with a Statham pressure transducer (P 23 DB) which on differentiation yielded LV dP/dt max and heart rate. Coronary flow was determined by electromagnetic flow probes in the aortic cannula. For the determination of lactate release, lactate dehydrogenase (LDH) and creatine kinase (CK) activities in the perfusate samples were taken from the coronary effluent and analyzed spectrophotometrically. EVALUATION Results are presented as arithmetical means ± SEM. A one-way ANOVA was calculated with SYSTAT for Windows (SYSTAT, Evanston, Ill., USA) followed by multiple pairwise comparisons according to Tukey. MODIFICATIONS OF THE METHOD Arnal et al. (1993) measured cardiac weight of rats in hypertension induced by NO synthase blockade. Linz et al. (1999) reviewed the interactions between ACE, kinins and NO. Sampaio et al. (2002) reported that hypertension plus diabetes mimics the cardiomyopathy induced by NO inhibition in rats. Rossi et al. (2003) found that chronic inhibition of NO synthase induces hypertension and cardiomyocyte mitochondrial and myocardial remodeling in the absence of hypertrophy. A.2.0.9 Pulmonary Hypertension Induced by Monocrotaline ... PURPOSE AND RATIONALE The pyrrolizidine alkaloid monocrotaline, derived from Crotalaria spectabilis, is hepatotoxic and pneumotoxic in the rat. A single injection of monocrotaline leads to progressive pulmonary hypertension resulting in right ventricular hypertrophy and cardiac failure (Gillespie et al. 1986, 1988; Todorovich-Hunter et al. 1988). Pathologic changes and hemodynamic changes associated with monocrotaline administration include blebbing of the lung, degeneration and fragmentation of endothelial cells, perivascular edema, extravasation of red blood cells, and muscularization of the pulmonary arteries and arterioles (Valdiva et al. 1967; Lalich et al. 1977; Huxtable et al. 1978; Hislop and Reid 1979; Meyrick and Reid 1979; Meyrick et al. 1980; Ghodsi andWill 1981; Hilliker et al. 1982; Sugita et al. 1983; Hilliker and Roth 1985; Stenmark et al. 1985; Altieri et al. 1986; Molteni et al. 1986; Lai et al. 1996). Rats given monocrotaline develop severe right ventricular hypertrophy often accompanied by ascites and pleural effusions (Ceconi et al. 1989). Amelioration by angiotensin-converting enzyme inhibitors and by penicillamine has been demonstrated (Molteni et al. 1985, 1986). PROCEDURE Treatment of male Sprague Dawley rats weighing 200–225 g with the test drug (angiotensin converting enzyme inhibitor or vehicle) is started one week prior to a single subcutaneous injection of 100 mg/kg monocrotaline up to sacrifice 4, 7, or 14 days later by pentobarbital anesthesia and exsanguination. Heart and lungs are excised from thoracic cavity. After removing atria from the heart, the right ventricle is separated from the left ventricle plus septum which are blotted and weighed separately. Left lung is blotted, weighed, minced and reweighed after drying at room temperature for 14 days. Three pulmonary artery segments, main pulmonary artery, right extrapulmonary artery and an intrapulmonary artery from the from the right lower lobe, are isolated for study of vascular responsiveness. Cylindrical segments of each vessel are suspended between stainless steel hooks in 10-ml isolated tissue baths containing modified Krebs-Henseleit buffer aerated with 95%O2/5%CO2 at 37 °C. At the end of each experiment, vessel segments are blotted and weighed and their dimensions measured. Cross-sectional area of each artery is determined from tissue weight and diameter. Arteries are equilibrated for 1 h at 1 g of passive applied load and then are made to contract to KCl (6 × 10–2 M). After washout, the procedure is repeated with applied loads increased by 1 g increments. Responses are normalized to the maximum active force development generated by an artery in each experiment and the data are plotted as a function of applied force. Changes in isometric force are monitored through force displacement transducers (Grass FT03) and recorded on a polygraph. Responsiveness to contractile and relaxant agonists is assessed in pulmonary arteries from salineand monocrotaline-treated rats both in verum- and placebo-treated groups. Cumulative concentration-response curves to hypertonic KCl, angiotensin II and norepinephrine are generated sequentially in vessels at resting tone. Arteries are then contracted submaximally with norepinephrine and cumulative concentration-response curves to the vasorelaxants isoproterenol and acetylcholine are determined. EVALUATION Contractions are expressed as active tension development, force generated per cross-sectional area and relaxations are normalized to precontraction tone. Both contractile and relaxation responses are plotted as a function of the negative logarithm of agonist concentration. Differences in mean responses are compared by a t-test for grouped data. MODIFICATIONS OF THE METHOD Molteni et al. (1986) treated rats continuously with monocrotaline in the drinking water at a concentration of 2.4 mg/kg/day for a period of 6weeks. Test rats received an ACE-inhibitor during this time in the drinking water and controls the vehicle only. At the end of the experiment, hearts and lungs were weighed and examined by light and electron microscopy. Madden et al. (1995) determined L-arginine-related responses to pressure and vasoactive agents in monocrotaline-treated rat pulmonary arteries. Ono et al. (1995) studied the effects of prostaglandin E1 (PGE1) on pulmonary hypertension and lung vascular remodelling in the rat monocrotaline model of human pulmonary hypertension. Yamauchi et al. (1996) studied the effects of an orally active endothelin antagonist on monocrotalineinduced pulmonary hypertension in rats. Gout et al. (1999) evaluated the effects of adrenomedullin in isolated vascular rings from rats treated with monocrotaline (60 mg/kg s.c.) causing pulmonary hypertension and ventricular hypertrophy within 3 to 4weeks. Kanno et al. (2001) studied the effect of an angiotensin-converting enzyme inhibitor on pulmonary arterial hypertension and endothelial nitric oxide synthase expression in monocrotaline-treated rats. For evaluation of right ventricular hypertrophy as a result of pulmonary arterial hypertension, multislice spinecho MRI images were acquired at 8–12 time points in a cardiac cycle with respiratory and ECG gating (Kanno et al. 2000) at 2, 3, 4, and 5 weeks after monocrotaline treatment. Kang et al. (2003) reported that a phosphodiesterase-5 inhibitor attenuated monocrotaline-induced pulmonary hypertension in rats. A.2.0.10 Portal Hypertension in Rats ... PURPOSE AND RATIONALE Portal hypertension is associated with hyperdynamic splanchnic circulation and reduced vascular resistance (Vorobioff et al. 1983). Tanoue et al. (1991) developed a method for inducing portal hypertension and esophageal varices in rats – partial ligation of the portal vein after devascularization of the circumference of the left renal vein and complete ligation of the portal vein on the fifth day thereafter. Tsugawa et al. (2000) used this model to study the role of nitric oxide and endothelin-1 in rat portal hypertension. PROCEDURE Male Sprague-Dawley rats were anesthetized with 50 mg/kg Nembutal intraperitoneally. The portal vein was isolated and stenosis created by a single ligature of 3–0 silk placed around the portal vein and a 20-gauge blunt-tipped needle after devascularization of the left renal vein. This devascularization is indispensable in preventing the development of excess collateral vessels, which inhibit the formation of esophageal varices and the portal hypertensive state. The needle was then removed from the ligature. In addition, 3–0 silk was also placed at the area of partial ligation (loose ligation), and both ends were then drawn out through the abdominal wall. Five days after the operation, the ends of the silk that had been placed in the flank were simultaneously pulled to induce complete portal vein ligation. Two weeks later, this portal hypertension model was completed. Portal venous pressure, blood flow volume in the intra-abdominal viscera, plasma NO and plasma endothelin-1 were measured. EVALUATION Results were expressed as mean ± standard deviation. The Student’s t-test was used to determine significance between portal hypertension rats and sham-operated controls. MODIFICATIONS OF THE METHOD Portal hypertension by portal vein ligation without devascularization of the left renal vein was used by Lee et al. (1985), Braillon et al. (1986), Oren et al. (1995), Fernandez et al. (1996), Moreno et al. (1996), Connolly et al. (1999), Hilzenrat et al. (1999), Chagneau et al. (2000), Yu et al. (2000), and Sakurabayashi et al. (2002). Dieguez et al. (2002) used a surgical technique based on the development of a triple stenosing ligation to worsen the complications inherent to the prehepatic chronic portal hypertension. Jaffe et al. (1994) and Li et al. (1998) used injection of different sized microspheres into the portal vein of male Wistar rats to induce portal hypertension. A.3 Coronary (Cardiac) Drugs A.3.1 Isolated Organs A.3.1.1 Heart-Lung Preparation ... PURPOSE AND RATIONALE The isolated heart-lung of the dog was introduced by Knowlton and Starling (1912). Since then, the dog model has been used for many physiological and pharmacological studies (Krayer 1931;Krayer andMendez 1942; Somani and Blum 1966; Takeda et al. 1973; Ishikawa et al. 1978, 1983; Ono et al. 1984a, b; Caffrey et al. 1986; Hausknecht et al. 1986; Fessler et al. 1988; Seifen et al. 1987, 1988; Naka et al. 1989).More recently, the rat model has been preferred (Dietz 1984, 1987; Onwochei et al. 1987, 1988; Kashimoto et al. 1987, 1990, 1994,1995, Fukuse et al. 1995). PROCEDURE Wistar rats weighing 300–320 g are anesthetized with 50 mg/kg pentobarbitone i.p. Tracheotomy is performed and intermittent positive pressure ventilation is instituted with air. The chest is opened and flooded with ice-cold saline and the heart arrested. Cannulae are inserted into the aorta and the superior (for measurement of central venous pressure) and inferior venae cavae. The heart-lung preparation is perfused with a solution containing rat blood cells from another rat and Krebs-Ringer bicarbonate buffer, with hematocrit and pH of 25 % and 7.4, respectively. Concentration of the buffer constituents (mM): NaCl 127, KCl 5.1, CaCl2 2.2, KH2PO4 1.3, MgSO4 2.6, NaHCO3 15, glucose 5.5 and heparin. The perfusate pumped from the aorta passes through a pneumatic resistance and is collected in a reservoir maintained at 37 °C and then returned to the inferior vena cava. In this model, no other organs except the heart and lung are perfused. Cardiac output is determined by the inflow as long as the heart does not fail. Mean arterial pressure is regulated by the pneumatic resistance. Heart rate is recorded by a bioelectric amplifier and cardiac output is measured with an electromagnetic blood flow meter. Arterial pressure and right atrial pressure are measured with transducers and amplifiers. The heart is perfused initially with cardiac output of 30 ml/min and mean arterial pressure of 80 mm Hg. Test drugs are administered into the perfusate 5 min after start of the experiment. EVALUATION Hemodynamic data within groups are analyzed by two-way analysis of variance (ANOVA) with repeated measures. Recovery time is measured by the Kruskal-Wallis test. The other data are analyzed by one-way ANOVA followed by the Dunnett test for multiple comparisons. MODIFICATIONS OF THE METHOD Using the Starling heart-lung preparation in dogs,Wollenberger (1947) studied the energy-rich phosphate supply of the failing heart. Shigei and Hashimoto (1960) studied the mechanism of the heart failure induced by pentobarbital, quinine, fluoroacetate and dinitrophenol in dog’s heartlung preparation and effects of sympathomimetic amines and ouabain on it. Imai et al. (1961) used heart-lung preparations of the dog to study the cardiac actions of methoxamine with special reference to its antagonistic action to epinephrine. Capri and Oliverio (1965), Beaconsfield et al. (1974) used the heart-lung preparation of the guinea pig. Robicsek et al. (1985) studied the metabolism and function of an autoperfused heart-lung preparation of the dog. The dog heart-lung preparation was used by Seifen et al. (1988) to study the interaction of a calcium channel agonist with the effects of digoxin, by Somani and Blum (1966) to study blockade of epinephrine- and ouabain-induced cardiac arrhythmias in the dog, by Riveron et al. (1988) to investigate the energy expenditure of an autoperfusing heart-lung preparation, by Namakura et al. (1987) to study the role of pulmonary innervation in an in situ lung-perfusion preparation as a new model of neurogenic pulmonary edema, by Hausknecht et al. (1986) to investigate the effects of lung inflation on blood flow during cardiopulmonary resuscitation, by Caffrey et al. (1986) to evaluate the effect of naloxone on myocardial responses to isoproterenol, by Ono et al. (1984) to estimate the cardiodepressant potency of various beta-blocking agents, by Ishikawa et al. (1983) for a graphical analysis of drug effects in the dog heart-lung preparation – with particular reference to the pulmonary circulation and effects of norepinephrine and 5-hydroxytryptamine, by Iizuka (1983) to study the cardiac effects of acetylcholine and its congeners, by Fessler et al. (988) to investigate the mechanism of reduced LV afterload by systolic and diastolic positive pleural pressure, by Takeda et al. (1973) to study the cardiac actions of oxprenolol. Beaconsfield et al. (1974) used the heart-lung preparation of guinea pigs to study the cardiac effect of delta-9-tetrahydrocannabinol. The rabbit autoperfusing heart-lung preparation was used by Muskett et al. (1986, 1988). The isolated heart-lung preparation in the cat was described by Beaufort et al. (1993). Kontos et al. (1987, 1988) harvested heart-lung blocks from calves. A.3.1.2 Isolated Heart According to Langendorff ... PURPOSE AND RATIONALE More than 100 years ago Langendorff (1895) described studies on isolated surviving mammalian hearts using mainly cats as donors. Since then, the method has been improved from the technical site and is nowadays used for studies with guinea-pig, rabbit or rat hearts. In principle, the heart is perfused in retrograde direction from the aorta either at constant pressure or at constant flow with oxygenated saline solutions. Retrograde perfusion closes the aortic valves, just as in the in situ heart during diastole. The perfusate is displaced through the coronary arteries flowing off the coronary sinus and the opened right atrium. In this original set-up the ventricles do not fill with perfusate and therefore do not perform pressure-volume work. Parameters usually measured are: contractile force, coronary flow and cardiac rhythm. PROCEDURE Guinea pigs of either sex weighing 300–500 g are sacrificed by stunning. For studies of biochemical parameters in tissue and perfusate, removal of the heart during barbiturate anesthesia and artificial respiration is recommended. The heart is removed as quickly as possible and placed in a dish containing Ringer’s solution at 37 °C. Associated pericardial and lung tissue are removed. The aorta is located and cut just below the point of its division. A glass or plastic cannula is introduced into the aorta, tied with two threads and perfusion is started with oxygenated Ringer’s solution or Krebs-Henseleit buffer. The heart is transferred to a double walled plexiglass perfusion apparatus which is kept at 37 °C by the water from a thermostat. Oxygenated Ringer’s solution is perfused at a constant pressure of 40 mm Hg and at a temperature of 37 °C from a reservoir. A small steel hook with a string is attached to the apex of the heart. Contractile force is measured isometrically by a force transducer with a preload of 2.5 g and recorded on a polygraph. Coronary flow is measured by a drop counter. Alternatively, flow measurements can be performed using a mechanic-electronic flow meter consisting of a vertical pipe and a magnetic valve (Hugo Sachs Electronic KG, Germany). Heart rate is measured through a chronometer coupled to the polygraph. Drugs are injected into the perfusion medium just above the aortic cannula. CRITICAL ASSESSMENT OF THE METHOD A reappraisal of the LANGENDORFF heart preparation was given by Broadley (1979) underlining the usefulness to test coronary vasodilating drugs. The value of the LANGENDORFF method can be best assessed by demonstrating a few of its applications in physiology and pharmacology.Direct effects can be measured as well as the antagonism against various physiological and pharmacological agents. MODIFICATIONS OF THE METHOD A survey on various modifications of the LANGENDORFF-technique and the isolated working heart preparation has been given by Ross (1972). Neely et al. (1967) inserted a second cannula into a pulmonary vein or the left atrium. Perfusate from a reservoir flows via this cannula through the mitral valve into the left ventricle. During the systole of the heart, the left ventricle repumps the perfusate through the aorta into the reservoir. The perfusate flowing through the coronary arteries and dripping off from the outside of the heart is collected in a vessel below the heart and recirculated into the reservoir with a roller pump. Flynn et al. (1978) underlined the difference of this working heart preparation to the original LANGENDORFF method and reported the effects of histamine and noradrenaline on peak left ventricular systolic pressure, contractility, sinus rate, coronary flow, aortic flow, total cardiac output, and external pressure-volume work. Therefore, this method is reported separately. Ishiu et al. (1996) measured simultaneously Ca2+-dependent indo-1 fluorescence and left ventricular pressure on a beat-to-beat basis in Langendorff guinea pig hearts and investigated the changes in Ca+2 transient and left ventricular function during positive inotropic stimulation and myocardial ischemia. Hukovic and Muscholl (1962) described the preparation of the isolated rabbit heart with intact sympathic nervous supply from the right stellate ganglion. Hendrikx et al. (1994) used the isolated perfused rabbit heart to test the effects of an Na+/H+ exchange inhibitor on postischemic function, resynthesis of high-energy phosphate and reduction of Ca2+ overload. Michio et al. (1985) modified the Langendorff method in rabbits to a working heart preparation by cannulating the left atrium. At a pressure of 20 cm H2O in the left atrium, the heart pumped the solution against a hydrostatic pressure of 100 cm H2O. Aortic flow, systolic aortic pressure, coronary flow, and heart rate were measured. The influence of an ACE-inhibitor on heart rate, lactate in the coronary effluate and GTP-level in the myocardium after 60-min hypothermic cardiac arrest was studied in working heart preparation of rabbits by Zegner et al. (1996). Gottlieb and Magnus (1904) introduced the so called “balloonmethod”. A small balloon fixed to the tip of a catheter is filled with water and inserted into the left ventricle via one of the pulmonary veins, the left atrium and the mitral valve. The balloon size has to fit the volume of the left ventricle and therefore its size depends on the animal species and body weight. The catheter can be fixed by tying the pulmonary vein stems. Via a three-way valve, the balloon can be extended to a given preload. The beating heart now exerts a rhythmic force to the balloon and thus to the membrane of a pressure transducer. The advantages of this method are that force development and preload can be stated reproducibly in pressure units [mm Hg], left ventricular contraction curves can be used for further calculations, and continuous heart rate recordings can be carried out without any problems when using a rate meter. Sakai et al. (1983) reported a similar method adapted to mice. Bardenheuer and Schrader (1983) described a method whereby the balloon is inserted into the left ventricle as described above. However, isovolumetric pressure in the left ventricle is not measured. Instead, the fluid in the balloon is pumped through the cannula into a closed extra corporal circulation. The fluid is forced into one direction by 2 recoil valves. The balloon is made of silicone material using a Teflon form (Linz et al. 1986). The dimensions of the form are derived from casts of the left ventricle of K+-arrested heart by injection of dental cement (Palavit 55, Kulzer and Co, GmbH, Germany). During each heart beat the fluid volume expelled from the balloon corresponding to the stroke volume of the heart, can be recorded by means of a flow meter probe and an integrator connected in series. Preload and afterload can be adjusted independently from each other. The perfusate flow (retrograde into the aorta and through the coronary arteries) is recorded separately. The following parameters were measured in isolated rat hearts (Linz et al. 1986; Linz et al. 1990): LVP (left ventricular pressure) with Statham pressure transducer P 23DB, which on differentiation yielded LV dp/dt max and HR (heart rate). Cardiac output and coronary flow (CF) are determined by electromagnetic flow probes in the outflow system and in the aortic cannula, respectively. Coronary venous pO2 is measured with a catheter placed in the pulmonary artery by a type E 5046 electrode connected to a PMH 73 pH/blood gas monitor (Radiometer). An epicardial electrocardiogram recording is obtained via two silver electrodes attached to the heart. All parameters are recorded on a Brush 2600 recorder. Myocardial oxygen consumption (MWO 2) [ml/min/g wet weight] is calculated according to the equation: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ MVO_2 = CF \times (P_{\rm a} = P_{\rm v} ) \times (c/760) \times 100 $$\end{document} where CF is the coronary flow [ml/min/g], P a is the oxygen partial pressure of arterial perfusate (650 mm Hg), P v is the oxygen partial pressure of the venous effluent perfusate [mm Hg], and c is the 0.0227 ml O2/ml perfusate representing the Bunsen solubility coefficient of oxygen dissolved in perfusate at 37 °C (Zander and Euler 1976). For the determination of lactate dehydrogenase (LDH) and creatine kinase (CK) activities in the perfusate, samples are taken from the coronary effluent. After the experiments, hearts are rapidly frozen in liquid nitrogen and stored at –80 °C. Of the left ventricle, 500 mg are taken, put into 5 ml ice-cold HClO4 and disrupted with an Ultra-Turrax (Junke and Kunkel, Ika-Werk, Type TP). Glycogen is hydrolyzed with amyloglycosidase (pH 4.8) and determined as glucose. Furthermore, ATP and creatine phosphate are measured. Avkiran and Curtis (1991) constructed a dual lumen aortic cannula which permits independent perfusion of left and right coronary beds in isolated rat hearts without necessitating the cannulation of individual arteries. Igic (1996) described a modification of the isolated perfused working rat heart. A special double cannula was designed consisting of an outer cannula that is inserted into the aorta and an inner cannula that is advanced into the left ventricle. The perfusion fluid flows through the inner cannula into the left ventricle, and is ejected from there into the aorta. If the outer cannula system is closed, the fluid perfuses the coronary vessels and drips off outside the heart. When the outer cannula is open and certain pressure resistance is applied, a fraction of the ejected fluid perfuses coronary vessels and the rest is expelled. Because the inner cannula can be easily retracted into the outer cannula, which is placed in the aorta, the preparation provides an opportunity to use the same heart as a “working” or “non-working” model for investigating functions of the heart. By labeling glucose, lactate, or fatty acids in the perfusate with 3H or 14C, Barr and Lopaschuk (1997) directly measured energy metabolism in the isolated rat heart. Krzeminski et al. (1991) described a new concept of the isolated heart preparation with on-line computerized data evaluation. Left ventricular pressure was recorded by means of a balloon-catheter, while special suction electrodes obtained the high-amplitude, noisefree electrogram recordings. The coronary effluent partial pressure of oxygen was continuously monitored, which enabled the calculation of myocardial oxygen consumption (MVO2). The effluent partial pressure of carbon dioxide and pH value were also measured simultaneously. A computerized system of data acquisition, calculation, storage, and end report was described. Döring and Dehnert (1988) described continuous simultaneous ultrasonic recording of two cardiac diameters in an isolated perfused guinea-pig heart. For the measurement of the left ventricular transversal diameter the ultrasonic transmitter was positioned at the epicardium at the largest cardiac diameter. The corresponding ultrasonic receiver was inserted through the right atrium into the right ventricle to approximately the same height as the transmitter. In the right ventricle, which is empty in the isolated perfused LANGENDORFF-heart, it was automatically positioned opposite to the transmitter. Additional transducers were placed both at the heart’s base and apex for assessment of the ventricular longitudinal diameter. Several authors used the isolated perfused mouse heart. Bittner et al. (1996) described a work-performing heart preparation for myocardial performance analysis in murine hearts using a modified Langendorff apparatus. Sumaray and Yellon (1998a, b) constructed a specially designed Langendorff apparatus that allows perfusion of the isolated mouse heart. These authors reported that ischemic preconditioning reduces infarct size following global ischemia in the murine myocardium. Brooks and Apstein (1996) measured left ventricular systolic and diastolic pressures in the isovolumically contracting (balloon in the left ventricle) mouse hearts. Sutherland et al. (2003) reviewed characteristics and cautions in the use of the isolated perfused heart of mice. Wang et al. (2001) studied the relationship between ischemic time and ischemia/reperfusion injury in isolated Langendorff-perfusedmouse hearts. Tejero-Taldo et al. (2002) reported that α-adrenergic receptor stimulation produces late preconditioning through inducible nitric oxide synthase in mouse heart. Ross et al. (2003) found that the α 1B-adrenergic receptor decreases the inotropic response in the mouse Langendorff heart model. Bratkovsky et al. (2004) measured coronary flow reserve in isolated hearts from mice. Plumier et al. (1995) generated transgenic mice expressing the human heart heat shock protein 70. Upon reperfusion of the hearts after 30 min of ischemia in the Langendorff preparation, transgenic hearts versus non transgenic hearts showed significantly improved recovery of contractile force. Hannan et al. (2000) compared ENOS knockout and wild-type mouse hearts which were perfused in a Langendorff apparatus with Krebs bicarbonate buffer and subjected to 20 min of global normothermic ischemia followed by 30 min of reperfusion. Myocardial function was measured using a ventricular balloon to determine time to onset of contraction, left ventricular developed pressure (LVDP), left ventricular end-diastolic pressure (LVEDP), and heart rate-pressure product (RPP). Sheikh et al. (2001) generated transgenicmice overexpressing fibroblast growth factor (FGF)-2 protein in the heart. An isolated mouse heart model of ischemiareperfusion injury was used to assess the potential of endogenous FGF-2 for cardioprotection. APPLICATIONS Positive Inotropic Effects While negative inotropic substances can be tested in a heart beating with normal force, the evaluation of a positive inotropic compound usually requires that cardiac force is first reduced. Acute experimental heart failure can be induced by an overdose of barbiturates, such as sodium thiopental, or calcium antagonists. This kind of cardiac failure can be reversed by β-sympathomimetic drugs, cardiac glycosides, or increased Ca+2 concentration. In this way, the potential β-sympathomimetic activity of a new drug can be measured using isoproterenol as standard. After thiopental-Na treatment, left ventricular pressure (LVP) and dp/dt max decrease considerably, whereas coronary flow is slightly enhanced. β-Sympathomimetic drugs restore LVP and dp/dt max and keep coronary blood flow elevated. Cardiac glycosides increase LVP and dp/dt max and leave coronary flow unchanged. Negative Inotropic Effects The effects of a β-sympathomimetic drug such as isoproterenol at doses of 0.05 to 0.2 μg increasing contractile force as well as heart frequency are registered. After injection of a β-blocker, the effects of isoproterenol are attenuated. The effects of a potential β-blocking agent can be tested comparing the isoproterenol inhibition versus a standard such as propranolol (0.1 mg). Coronary Vessel Dilating Effect The LANGENDORFF heart has been extensively used for assessing the coronary dilating activity of drugs (Broadley 1979). Rothaul and Broadley (1982) demonstrated the release of coronary vasodilator mediators from guinea pig isolated hearts by a technique employing donor and recipient hearts in series. Calcium-Antagonism In order to demonstrate the effect of calcium-antagonists, 1 to 5 mg BaCl2 are injected which induce a pronounced spasm of the coronary arteries thereby reducing the coronary flow. Five min later, the test drug is injected. Active compounds have a relaxing effect on coronary arteries indicated by an increase of coronary flow. After this effect has weaned, BaCl2 is injected again and the test drug or a standard drug, e. g. nifedipine, is tested. The increase of coronary flow is expressed as percentage of flow during BaCl2 spasm and compared with the effect of the standard. Using various doses, dose-response curves can be established. Effect on Potassium Outflow Induced by Cardiac Glycosides Lindner and Hajdu (1968) described a method using the LANGENDORFF heart in which contractile force, coronary flow, and the potassium content in the coronary outflow was determined by flame photometry. Increase in potassium outflow correlates well with the positive inotropic effect. Gradual Determination of Hypoxic Damage Lindner and Grötsch (1973) measured the enzymes creatine phosphokinase (CPK), lactate dehydrogenase (LDH), α-hydroxybutyrate dehydrogenase (α-HBDH), and glutamicoxalacetic transaminase (GOT) in the effluent of a guinea pig heart preparation under varying degrees of hypoxia. Potassium content and oxygen tension in the inflowing and outflowing solution were determined. The heart rate, the amplitude of contraction and the rate of coronary vessel perfusion were recorded additionally. Metabolic Studies with Nuclear Magnetic Resonance Using 31P, studies on metabolism of nucleotides and phosphorylated intermediates of carbohydrates in isolated hearts have been performed (Garlick et al. 1977; Jacobus et al. 1977; Hollis et al. 1978; Matthews and Radda 1984). Arrhythmogenic, Anti-Arrhythmic and Antifibrillatory Effects The LANGENDORFF heart preparation is also used to test the influence of compounds on cardiac rhythm. For recording monophasic action potentials, suction electrodes are applied on the heart. Ventricular fibrillation can be induced by simultaneous injection of digitoxin (12.5–25.0 μg) and aconitine (12.5–25.0 μg) into the perfusion fluid (Lindner 1963). Cardiac glycosides shorten the refractory period, decrease the conduction velocity and increase heterotopic stimulus generation. Aconitine increases markedly heterotopic stimulus generation. Both compounds together induce invariably ventricular fibrillation. Anti-arrhythmic compounds can be tested in this way. Fibrillation is inhibited, at least partially, by 20 μg prenylamine, 10–20 μg quinidine or 20 μg ajmaline. Takeo et al. (1992) described protective effects of anti-arrhythmic agents on oxygen-deficiency-induced contractile dysfunction of isolated perfused hearts. Hypoxia in isolated rabbit hearts was induced by perfusing the heart for 20 min with Krebs-Henseleit buffer saturated with a gas mixture of 95 % N2 and 5%CO2 containing 11 mM mannitol. After hypoxic perfusion, the heart was reoxygenated for 45 min with oxygenated buffer containing glucose. Dhein et al. (1989) studied the pathway and time course of the epicardial electrical activation process by means of a computer-assisted epicardial potential mapping, using a matrix of 256 unipolar AgCl electrodes (1 mm spatial and 0.25 ms temporal resolution) in isolated rabbit hearts perfused according to the Langendorff technique. From the activation times of the surrounding electrodes, the direction and velocity of activation for each electrode were calculated, thereby allowing construction of an epicardial vector field. The method was used for the assessment of arrhythmogenic and anti-arrhythmic drug activity. Electrical Stimulation and Antifibrillatory Effect Ventricular fibrillation can be induced in the LANGENDORFF preparation by reducing the glucose content of the perfusion medium to 0.25 g/1000 ml and the KCl content to 0.12 g/1000 ml. (Burn et al. 1957, 1960; Lindner 1963). After a perfusion period of 20 min, 10 μg epinephrine are injected into the perfusion cannula. Immediately afterwards, the heart is stimulated with a current of 40Hz and 5 mA for 2 min. This procedure is repeated every 10 min. Standard conditions are achieved when the fibrillation continues without further electrical stimulation. Hearts treated in this way serve as controls. Other hearts stimulated in the same way are treated with continuous infusion of the test drug or the standard via the perfusion medium. Differences in the incidence of fibrillations are calculated using the χ 2 test. Electrophysiological Evaluation of Cardiovascular Agents Balderston et al. (1991) modified the Langendorff technique in rabbit hearts in order to perform electrophysiologic studies. His bundle electrograms were measured with a plunge electrode and allowed atrioventricular nodal physiology to be evaluated directly. Atrial conduction and refractoriness, atrioventricular node conduction and refractoriness, His-Purkinje conduction, and ventricular conduction and refractoriness could be accurately measured. The effects of verapamil and flecainide were described. EDRF Release from the Coronary Vascular Bed Lamontagne et al. (1992) isolated platelets from blood of healthy human donors and injected platelets boluses into the perfusion line of the Langendorff preparation of a rabbit heart. In the effluent cyclic GMP was determined as an index for EDRF release. A.3.1.3 Coronary Artery Ligation in Isolated Working Rat Heart ... PURPOSE AND RATIONALE In working heart preparations of rats, ischemia can be induced by clamping the left coronary artery close to its origin. After removal of the clip, changes in the reperfusion period can be observed. Prevention of these symptoms can be an indicator of the efficacy of coronary drugs. PROCEDURE The preparation used is a modification of an isolated working heart preparation originally used for guinea pig hearts (Bardenheuer and Schrader 1983). Wistar rats of either sex weighing 280–300 g are sacrificed by decapitation. The hearts are removed and dissected free from the epicard and surrounding connective tissue. A cannula is introduced into the aorta from where the coronary vessels are perfused with the non-recirculated perfusion medium according to the Langendorff technique. In the left ventricle a balloon closely fitting the ventricular cavity is placed and connected to an artificial systemic circulation. The fluid in the balloon is pumped through a cannula into the closed extra corporal circulation being forced into one direction by 2 recoil valves. The balloon is made of silicone material using a Teflon form (Linz et al. 1986). The dimensions of the form are derived from casts of the left ventricle of K+-arrested heart by injection of dental cement (Palavit 55, Kulzer and Co, GmbH, Germany). During each heart beat the fluid volume pressed from the balloon, corresponding to the stroke volume of the heart, can be recorded by means of a flow meter probe and an integrator connected in series. Preload and afterload can be adjusted independently from each other. The perfusate flow (retrograde into the aorta and through the coronary arteries) is recorded separately. The following parameters were measured in isolated rat hearts (Linz et al. 1986): LVP (left ventricular pressure) with Statham pressure transducer P 23 DB, which on differentiation yielded LV dp/dt max and HR (heart rate). Cardiac output and coronary flow (CF) are determined by electromagnetic flow probes in the outflow system and in the aortic cannula, respectively. Coronary venous pO2 is measured with a catheter placed in the pulmonary artery by a type E 5046 electrode connected to a PMH 73 pH/blood gas monitor (Radiometer). An epicardial electrocardiogram recording is obtained via two silver electrodes attached to the heart. All parameters are recorded on a Brush 2600 recorder. Myocardial oxygen consumption (MWO 2) [ml/ min/g wet weight] is calculated according to the equation: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ MVO_2 = CF \times (P_{\rm a} = P_{\rm v} ) \times (c/760) \times 100 $$\end{document} where CF is the coronary flow [ml/min/g], Pa is the oxygen partial pressure of arterial perfusate (650 mm Hg), P v is the oxygen partial pressure of the venous effluent perfusate [mm Hg], and c is the 0.0227 ml O2/ml perfusate representing the Bunsen solubility coefficient of oxygen dissolved in perfusate at 37 °C (Zander and Euler 1976). Coronary Artery Ligation For coronary artery occlusion experiment (Scholz et al. 1992, 1993), the isolated working hearts are perfused for a period of 20 min (pre-ischemic period) with modified Krebs-Henseleit buffer at a constant pressure of 65 mm Hg. Thereafter, acute myocardial ischemia is produced by clamping the left coronary artery close to is origin for 15 min (ischemic period). The clip is then reopened, and changes during reperfusion are monitored for 30 min (reperfusion period). After coronary artery ligation and reperfusion the hearts develop ventricular fibrillation. From the coronary effluent samples are taken for lactate, lactate dehydrogenase (LDH), and creatine kinase (CK) determinations. After the experiment, glycogen, lactate, ATP, and creatine phosphate in myocardial tissue are measured. The test drugs are given into the perfusion medium either before occlusion or 5 min before reperfusion. For ex vivo studies, the rats are treated orally with the test drug 1 h before sacrifice and preparation of the isolated working heart. EVALUATION The incidence and duration of ventricular fibrillation after treatment with coronary drugs is compared with controls. Left ventricular pressure, LV dP/dt max, and coronary flow are reduced after coronary constriction by angiotensin II, whereas enzyme activities in the effluent are increased and the myocardial content of glycogen, ATP and creatine phosphate are decreased. Cardiac protective drugs have the opposite effects. The values of each parameter are statistically compared with controls. MODIFICATIONS OF THE METHOD Vogel and Lucchesi (1980) described an isolated, blood perfused, feline heart preparation for evaluating pharmacological interventions during myocardial ischemia. Ventricular function was measured with a fluid-filled latex balloon within the left ventricle. Vleeming et al. (1989) ligated the left coronary artery in rats after thoracotomy in ether anesthesia. Forty-eight hours after the operation, the hearts were prepared for retrograde constant pressure perfusion, according to the Langendorff technique. Igic (1996) presented a new method for the isolated working rat heart. A special double cannula was designed consisting of an outer cannula that is inserted in the aorta and an inner cannula that is advanced into the left ventricle. The perfusion fluid flows through the inner cannula into the left ventricle, and is ejected from there into the aorta. If the outer cannula system is closed, the fluid perfuses the coronary vessels and drips off outside the heart. When the outer cannula is open and certain pressure resistance is applied, a fraction of the ejected fluid perfuses the coronary vessels and the rest is expelled. Because the inner cannula can easily be retracted into the outer cannula, which is placed in the aorta, this preparation provides an opportunity to use the same heart as a “working” or “non-working” model for investigating functions of the heart. Pepe and McLennan (1993) described a maintained afterload model of ischemia in erythrocyte-perfused isolated working hearts of rats. Further characterization of the pathophysiological reactions or the isolated working heart was performed by Linz et al. (1999). The external heart power (EHP) [mJ/min/g] was calculated using the formula: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \begin{array}{l} EHP_{{\rm LV}} = {\rm pressure} - {\rm volume} + {\rm acceleration}\;{\rm work} \\ \qquad \quad\;\; = [SV(MAP - LAP)] \\ \qquad \qquad\;\; + \,[1/2SV \times d \times (SV/\pi r^2 e^2 )]HR\,g_{{\rm LVwwt}}^{ - 1} \\ \end{array} $$\end{document} SV indicates stroke volume; MAP, mean aortic pressure; LAP, mean left arterial pressure; d, specific weight perfusate (1.004 g/cm3); r, inner radius of aortic cannula; e, ejection time; HR, heart rate; LV, left ventricle; LVwwt, left ventricular wet weight. The function of the left ventricle was altered by changing the aortic pressure (afterload) at constant left atrial filling load (preload). By adjusting the Starling resistance, the aortic outflow could be switched during 1 min from the fixed baseline afterload to a preset higher afterload producing step-wise rises in mean arterial pressure. Lee et al. (1988) studied the effects of acute global ischemia on cytosolic calcium transients in perfused isolated rabbit hearts with the fluorescent calcium indicator indo 1. Indo 1-loaded hearts were illuminated at 360 nm, and fluorescence was recorded simultaneously at 400 and 550 nm from the epicardial surface of the left ventricle. The F400/F550 ratio was calculated by an analog circuit, which allowed cancellation of optical motion artifact. The resulting calcium transients were registered simultaneously with the ventricular pressure and demonstrated a rapid upstroke and slow decay similar to those recorded in isolated ventricular myocytes. Global ischemia rapidly suppressed contraction, but it produced a concurrent increase in the systolic and diastolic levels of calcium transients, together with an increase in the duration of the peak. A.3.1.4 Isolated Working Heart Model in Infarcted Rat Heart ... PURPOSE AND RATIONALE The model of chronic heart failure in spontaneously hypertensive rats described by Itter et al. (2004a) (see A.6.0.1.2) has been used by the same group to study the isolated working heart in rats after chronic infarction (Itter et al. 2004b). PROCEDURE Animals and Methods WKY/NHsd and SHR/NHsd rats at an age of 4 months were randomized into two groups – sham and myocardial infarction (MI). The sham procedure consisted of opening the pericardium and placing a superficial suture in the epicardium of the left ventricle (LV). Chronic heart failure (CHF) was induced by permanent (8 weeks) occlusion of the left coronary artery 2 mm distal to the origin from the aorta resulting in a large infarction of the free left ventricular wall. Eight weeks after surgery, parameters indicating CHF were measured. Cardiac hypertrophy, function and geometric properties were determined by the “working heart” mode and in vivo determinations by MRI and heart weight. Surgery The rats were anesthetized with a mixture of ketamine/xylazine (35/2 mg/kg i.p.). The left ventrolateral thorax was shaved and prepared to create a disinfected surgical access area. When stable anesthesia was achieved the animals were placed on a small animal operation table, intubated and ventilated with room air using a small animal ventilator (KTR-4, Hugo Sachs Elektronik, March-Hugstedten, Germany). The level of anesthesia was deemed as adequate following loss of the pedal withdrawal reflex and absence of the palpebral reflex. Reflexes were evaluated before surgery. The operation took 5 min. The tidal volume was adjusted at 3–5 ml and the ventilation rate was 40 breaths/min. Left thoracotomy was performed via the third intercostal space. The heart was exposed and the pericardium opened. The left main coronary artery was ligated with Perma-Hand silk 4–0 USP (Ethicon, Nordersredt, Germany) near its origin at the aorta (2 mm distal to the edge of the left atrium). Ligation resulted in infarction of the free left ventricular wall. Ligation was deemed successful when the anterior wall of the left ventricle turned pale. At this point the lungs were hyperinflated by increasing the positive end-expiratory pressure, and the chest was closed. The rats were placed on a heating pad and covered with a layer of unbleached tissue paper. The rats were extubated following return of reflexes. They were continuously monitored until they started moving in their cages. To avoid ventricular arrhythmias, lidocaine (2 mg/kg i.m.) was given before surgery. To prevent acute lung edema, the rats received furosemide (Lasix, 2 mg/kg bodyweight twice daily for 3 days) via the drinking water. To avoid pain and distress the rats received metamizol treatment (Novalgin, 0.1 mg/kg body weight i.m.) once, directly after the recovery period. Before killing the animals 8 weeks after MI, non-invasive sequential nuclear magnetic resonance (NMR) measurements of heart geometric properties were done. Thereafter the animals were anesthetized with pentobarbitone (180 mg/kg i.p. Pentobarbital) and subsequently heparinized (Heparin Natrium 500 I.U./100 g body weight i.p.). Once stable anesthesia was achieved (stage III 3, reflexes absent), the animals were connected to an artificial respirator via a PE (polyethylene) tube inserted into the trachea and ventilated with room air. A transverse laparotomy and a right anterolateral thoracotomy were performed, and the heart was rapidly removed for the evaluation of its function in the working heart mode. The heart was immersed in physiological buffer chilled to 4 °C. The aorta was dissected free and mounted onto a cannula (internal diameter: 1.4 mm) attached to perfusion apparatus. The hearts were perfused according to the method of Langendorff with an oxygenated (95 % O2/5 % CO2) non-circulating Krebs–Henseleit solution of the following compositions (mM): NaCl, 118; KCl, 4.7; CaCl2, 2.52; MgSO4, 1.64; NaHCO3, 24.88; KH2PO4, 1.18; glucose, 5.55; and Na pyruvate, 2.0 at a perfusion pressure of 60 mmHg. Any connective tissue, thymus or lung was carefully removed. A catheter placed into the pulmonary artery drained the coronary effluent perfusate that was collected for the determination of coronary flow and venous pO2 measurements. The left atrium was cannulated via an incision of the left auricle. All pulmonary veins were ligated close to the surface of the atria. When a tight seal with no leaks had been established and after a 15-min equilibration period, the hearts were switched into the working mode, using a filling pressure (preload) of 12 mmHg in WKY/NHsd and 18 mmHg in SH rats. The afterload pressure was 60 mmHg in WKY/NHsd and 80 mmHg in SH rats. After validation of the basis parameters the afterload pressure was enhanced in a cumulative manner from an additional 20 mmHg to 140 mmHg. Thereafter the isovolumetric maxima were determined by enhancing the preload pressure in steps of 5 mmHg to 30 mmHg. Flow and pressure signals for computation were obtained from the PLUGSYS-measuring system (Hugo Sachs Elektronik, March-Hugstedten, Germany). Computation of data was performed with a sampling rate of 500 Hz, averaged every 2 s, using the software Aquire Plus V1.21f (PO-NE-MAH, Hugo Sachs Elektronik, March-Hugstedten, Germany). Determination of Infarct Size After the evaluation of the external heart work, the total heart weight, and the left and right ventricular weights were determined. The left ventricle was then sectioned transversely into four slices from the apex to the base. Eight pictures were taken of each rat heart, two from each slice. Total infarct size was determined by planimetry of the projected and magnified slices. The areas of infarcted tissue as well as the intact myocardium of each slice were added together and averaged. The infarcted fraction of the left ventricle was calculated from these measurements and expressed as a percentage of the left ventricular mass. The left ventricular perimeter, diameter, infarct scar length, as well as wall thickness and infarct wall thinning were determined as well. EVALUATION The data are given as mean ± SEM. Statistics were performed using the SAS system statistics package (SAS Insititute, Cary, N.C., USA) with a sequential rejection t-test according to Holm (1979). A.3.1.5 Relaxation of Bovine Coronary Artery ... PURPOSE AND RATIONALE Eicosanoids can regulate the tonus of coronary arteries. Prostacyclin induces relaxation, whereas thromboxane A2 causes contraction. Spiral strips from bovine coronary artery can be used for assaying relaxation activity of test compounds (Dusting et al. 1977) PROCEDURE Freshly slaughtered beef hearts are immersed in cold oxygenated Krebs solution and immediately transported in a thermos flask to the laboratory. The left descending coronary artery and several of its primary branches are cut into spiral strips (about 20 mm long and 2–3 mm wide). The specimens can be stored up to 48 h at 4 °C. The artery strips are suspended in a 4 ml organ bath under an initial tension of 2 g and immersed in a Krebs’ bicarbonate solution at 37 °C being gassed with oxygen containing 5%CO2 throughout the experiment. The Krebs solution contains a mixture of antagonists to inhibit any actions from endogenous acetylcholine, 5-hydroxytryptamine, histamine or catecholamines (hyoscine hydrobromide 10–7 g/ml, methysergide maleate 2 × 10–7 g/ml, mepyramine maleate 10–7 g/ml, propranolol hydrochloride 2 × 10–6 g/ml). The strips are superfused with a solution of the test compounds in concentrations of 0.01, 0.1, 1.0 μg/ml at a rate of 10–20 ml/min with oxygenated Krebs solution containing the mixture of antagonists. Isometric contractions are recorded with Grass force-displacement transducers (type FT 03C) on a Grass polygraph. The strips are superfused with Krebs’ solution 3 h prior to the experiment. Standard compounds are 100 ng/ml PGE2 inducing contraction and 100 ng/ml PGI2 inducing pronounced relaxation. EVALUATION The relaxation induced by the test compound is expressed as percentage of maximal response to 100 ng/ml PGI2. MODIFICATIONS OF THE METHOD Campell and Paul (1993) measured the effects of diltiazem on isometric force generation, [Ca2+]i, and energy metabolism in the isolated porcine coronary artery. Li et al. (1997) determined the ability of analogues of human α-calcitonin gene-related peptide to relax isolated porcine coronary arteries precontracted with 20 mM KCl. A.3.2 In Vivo Methods A.3.2.1 Isoproterenol Induced Myocardial Necrosis in Rats ... PURPOSE AND RATIONALE Cardiac necrosis can be produced by injection of natural and synthetic sympathomimetics in high doses. Infarct-like myocardial lesions in the rat by isoproterenol have been described by Rona et al. (1959). These lesions can be totally or partially prevented by several drugs such as sympatholytics or calcium-antagonists. PROCEDURE Groups of 10 maleWistar rats weighing 150–200 g are pretreated with the test drug or the standard either s.c. or orally for 1 week. Then, they receive 5.25 and 8.5 mg/kg isoproterenol s.c. on two consecutive days. Symptoms and mortality in each group are recorded and compared with those of rats given isoproterenol alone. Forty-eight hours after the first isoproterenol administration, the rats are sacrificed and autopsied. The hearts are removed and weighed, and frontal sections are embedded for histological examination. EVALUATION Microscopic examination allows the following grading: Grade 0: no change Grade 1: focal interstitial response Grade 2: focal lesions in many sections, consisting of mottled staining and fragmentation of muscle fibres Grade 3: confluent retrogressive lesions with hyaline necrosis and fragmentation of muscle fibres and sequestrating mucoid edema Grade 4: massive infarct with occasionally acute aneurysm and mural thrombi For each group themain grade is calculated with the standard deviation to reveal significant differences. CRITICAL ASSESSMENT OF THE METHOD The test has been used by many authors for evaluation of coronary active drugs, such as calcium-antagonists and other cardioprotective drugs like nitroglycerin and molsidomine (Vértesy et al. 1991; Classen et al. 1993). MODIFICATIONS OF THE METHOD Yang et al. (1996) reported a protective effect of human adrenomedullin13–52, a C-terminal fragment of adrenomedullin10–52 on the myocardial injury produced by subcutaneous injection of isoproterenol into rats. A.3.2.2 Myocardial Infarction After Coronary Ligation in Rodents ... PURPOSE AND RATIONALE Ligation of the left coronary artery in rats as described by Selye (1960) induces an acute reduction in pump function and a dilatation of left ventricular chamber. The method has been used to evaluate beneficial effects of drugs after acute (Chiariello et al. 1980; Flaim and Zelis 1981; Bernauer 1985) or chronic (Innes and Weisman 1981; Pfeffer et al. 1985; Linz et al. 1996) treatment. PROCEDURE Male Sprague Dawley rats weighing 200–300 g are anesthetized with diethylether. The chest is opened by a left thoracotomy, and a thread is inserted near the middle of the lateral margin of the cutaneous wound and carried through a tunnel of the left pectoral muscle around the cranial half of the incision. The heart is gently exteriorized by pressure on the abdomen.A ligature is placed around the left coronary artery, near its origin, and is tightened.Within seconds, the heart is repositioned in the thoracic cavity, and the ends of the musculocutaneous thread are tightened to close the chest wall and enable the animal to breathe spontaneously. The speed of the procedure renders mechanical respiration unnecessary. To evaluate drug effects, the rats are treated 5 min after and 24 h after occlusion by subcutaneous injection (standard 5 mg/kg propranolol). Two days after surgery, the rats are anesthetized with 60 mg/kg i.p. pentobarbital and the right carotid artery is cannulated with a polyethylene catheter connected to a pressure transducer. The fluid-filled catheter is then advanced into the left ventricle through the aortic valve for measurement of left ventricular systolic and end-diastolic pressure. After hemodynamic measurements, the heart is arrested by injecting 2 ml of 2.5 M potassium chloride. The chest is opened, and the hearts are isolated and rinsed with 300 mM KCl to maintain a complete diastole. A double-lumen catheter is advanced into the left ventricle through the ascending aorta, the right and left atria are tied off with a ligature, and the right ventricle is opened. The left ventricular chamber is filled with a cryostatic freeze medium through the smaller of the two catheter lumens and connected to a hydrostatic pressure reservoir maintained at a level corresponding to the end-diastolic pressure measured in vivo. The outlet (larger lumen) is then raised to the same level as the inlet to allow fluid in the two lumens to equilibrate. The heart is rapidly frozen with hexane and dryice. The hearts are serially cut with a cryostat into 40-μm-thick transverse sections perpendicularly to the longitudinal axis from apex to base. At a fixed distance, eight sections are obtained from each heart and collected on gelatin-coated glass slides. Sections are air-dried and incubated at 25 °C for 30 min with 490 μM nitroblue tetrazolium and 50 mM succinic acid in 0.2 M phosphate buffer (pH 7.6), rinsed in cold distilled water, dehydrated in 95 % ethyl alcohol, cleared in xylene, and mounted with a synthetic resin medium. Viable tissue appears dark blue, contrasting with the unstained necrotic tissue. EVALUATION The infarct size can be determined by planimetry and expressed as percentage of left ventricular area, and thickness can be expressed as percentage of noninfarcted ventricular wall thickness (MacLean et al. 1978; Chiariello 1980; Roberts et al. 1983). An automatic method for morphometric analysis with image acquisition and computer processing was described by Porzio et al. (1995). CRITICAL ASSESSMENT OF THE METHOD Myocardial infarction following coronary artery ligation in Sprague-Dawley rats is a widely used rat model of heart failure. If the left coronary artery is not completely ligated, heart failure may occur as a consequence of chronic myocardial ischemia (Kajstura et al. 1994). MODIFICATIONS OF THE METHOD Johns and Olson (1954) described the coronary artery patterns for mouse, rat, hamster and guinea pig. Kaufman et al. (1959), Fishbein et al. (1978, 1980) used various histochemical methods for identification and quantification of border zones during the evolution of myocardial infarction. Sakai et al. (1981) described an experimental model of angina pectoris in the intact anesthetized rat. In anesthetized rats the tip of a special carotid cannula was placed closely to the right and left coronary ostium. Single intra-aortic injections of methacholine or acetylcholine (in the presence of physostigmine) developed a reproducible elevation of the ST segment and the T wave of the electrocardiogram. Coronary drugs were tested to prevent these changes. Ytrehus et al. (1994) analyzed the effects of anesthesia, perfusate, risk zone, and method of infarct sizing in rat and rabbit heart infarction. Leprán et al. (1981) placed a loose ligature of atraumatic silk around the left anterior descending coronary artery under ether anesthesia in rats. Ten days later, acute myocardial infarction was produced by tightening the ligature. Kouchi et al. (2000) found an increase in Giα protein accompanying progression of post-infarction remodelling in hypertensive cardiomyopathy in rats. G protein α subunits were studied with immunoblotting techniques (Böhm et al. 1990). The polyclonal antiserum MB1 was raised in rabbits against the carboxyl-terminal decapeptide of retinal transduction (KENLKDCGLF) coupled to keyhole limpet hemocyanine. The MB1 recognized Giα 1 and Giα 2 but not G0α and Giα3 (Böhm et al. 1994). The membrane fractions were electrophoresed in SDS-polyacrylamide gels and were transferred to nitrocellulose filters. The filters were incubated with the first antibodies for Giα (MB1) or Gsα (RM/1) and then with the second antibody (horseradish peroxidase-conjugated goat anti-rabbit IgG, Amersham). Immunoreactive signals were detected by means of the ECL kit (Amersham). Liu et al. (1997) found that ligation of the left descending coronary artery in Lewis inbred rats produces an uniformly large infarct with low mortality. The model may be superior to the usual model in Sprague-Dawley rats with a marked variability in infarct size and cardiac dysfunction. Coronary artery ligation induces left ventricular remodeling with cardiomyocyte apoptosis, myocardial fibrosis indicated by morphological studies and by collagen accumulation, which can be prevented by drug treatment (Yang et al. 1992; Belichard et al. 1994; Nguyen et al. 1998; Sia et al. 2002; Bäcklund et al. 2004). The naturally occurring peptide N -acety-serylaspartyl-lysyl-proline (Ac-SDKP) is a inhibitor of pluripotent hematopoietic stem cell proliferation and is normally present in human plasma and circulating mononuclear cells. It is cleaved to an inactive form by the NH2-terminal catalytic domain of ACE (Azizi et al. 1996). Acute angiotensin converting enzyme inhibition increases the plasma level of N-acetyl-serylaspartyl-lysyl-proline (Azizi et al. 1996). By morphological studies and collagen determinations, Rasoul et al. (2004) found an antifibrotic effect of Ac-SDKP and angiotensin converting enzyme inhibition in hypertension in rats. Similarly, Yang et al. (2004) found that Ac-SDKP reverses inflammation and fibrosis in rats with heart failure after myocardial infarction. Moreover, Azizi et al. (1997) and Le Meur et al. (1998) discussed whether the plasma Ac-SDKP level is a reliable marker of chronic angiotensin converting enzyme inhibition in hypertensive patients. An AcSDKP EIA Kit is available from Cayman, Ann Arbor, Mich., USA. Chen et al. (2004) found inhibition and reversal of myocardial -infarction-induced hypertrophy and heart failure by NHE-1 inhibition. Johns and Olson (1954) described a method of experimental myocardial infarction by coronary occlusion in small animals, such as mouse, hamster, rat and guinea pig. Scholz et al. (1995) described a dose-dependent reduction of myocardial infarct size in rabbits by a selective sodium-hydrogen exchange subtype 1 inhibitor. Gomoll and Lekich (1990) tested the ferret for a myocardial ischemia/salvage model. Varying combinations of duration of left anterior descending coronary occlusion and reperfusion were evaluated. Coronary artery ligation in mice Michael et al. (1995, 1999), and Gould et al. (2001) described the surgical procedure to induce myocardial ischemia in mice by ligation of the left anterior descending branch of the left coronary artery. Infarct and Reperfusion Model Male C57BL/6 mice 12–16 weeks of age (22.5–30.5 g body weight) were used. Anesthesia was produced by an intraperitoneal injection of pentobarbital sodium (4 mg/ml; 10 μl/g body weight). Mice were placed in a supine position with paws taped to the operating table. With direct visualization of the trachea, an endotracheal tube was inserted and connected to a Harvard rodent volume-cycled ventilator cycling at 100 /min with volume sufficient to adequately expand the lungs but not overexpand. The inflow valve was supplied with 100 % oxygen. For studies of the myocardial response to permanent occlusion, ligation of the anterior descending branch of the left coronary artery was achieved by tying an 8–0 silk suture around the artery. The suture was passed under the artery at a position ∼ 1 mm from the tip of the normally positioned left auricle. For studies of the effect of reperfusion after coronary artery occlusion, the ligature was tied at the same location on the coronary artery used for the permanent occlusion. However, to allow subsequent reestablishment of blood flow, occlusion was produced by placing a 1-mm length of polyethylene (PE) tubing (OD = 0.61 mm) on the artery and fixing it in place with the ligature. The artery was then compressed by tightening the ligature, producing myocardial blanching and electrocardiographic (ECG) S-T segment elevation as observed in permanent ligations. After occlusion for the desired time, blood flow was restored by removing the ligature and PE tubing. The chest wall was then closed by a 6–0Ticron suture with one layer through the chest wall and muscle and a second layer through the skin and subcutaneous layer. After surgical closing of the chest, the endotracheal tube was removed, warmth was provided by a heat lamp, and 100 % oxygen was provided via a nasal cone. The animal was given 0.1 mg/kg butorphanol tartrate as an analgesic, and it became sternally recumbent within 1 h. After surviving the experimental infarct the mice recovered, and this allowed postoperative physiological measurement. Sham-operated mice underwent an identical procedure with placement of the ligature but did not undergo coronary artery occlusion. MODIFICATIONS OF THE METHOD Guo et al. (1998) demonstrated the effects of an early and a late phase of ischemic preconditioning in mice. The results demonstrated that, in the mouse, a robust infarct-sparing effect occurred during both the early and the late phases of ischemic preconditioning, although the early phase was more powerful. Guo et al. (2005) found that late preconditioning induced by NO donors, adenosine A1 receptor agonists, and δ 1-opioid receptor agonists is mediated by inducible NO synthase. Lutgens et al. (1999) reported cardiac structural and functional changes after chronic myocardial infarction in the mouse. Scherrer-Crosbie et al. (1999) described echocardiographic determination of risk area in a murine model of myocardial ischemia. Myocardial contrast echocardiography was performed before and after coronary artery ligation in anesthetized mice by intravenous injection of contrast microbubbles and transthoracic echo imaging. Time-video intensity curves were obtained for the anterior, lateral, and septal myocardial walls. After myocardial ischemia, myocardial contrast echocardiography defects were compared with the area of no perfusion measured by Evans blue staining. Jones and Lefer (2001) described cardioprotective actions of acute HMG-CoA reductase inhibition in the setting of myocardial infarction. Janssens et al. (2004) reported that cardiomyocytespecific overexpression of NO synthase 3 (NOS3) improves left ventricular (LV) performance and reduces compensatory hypertrophy after myocardial infarction. The effect of cardiomyocyte-restricted overexpression of one NO synthase isoform, NOS3, on LV remodeling after myocardial infarction in mice was tested. LV structure and function before and after permanent left anterior descending (LAD) coronary artery ligation were compared in transgenic mice with cardiomyocyte-restricted NOS3 overexpression (NOS3-TG) and their wild-type littermates (WT). Before myocardial infarction, systemic hemodynamic measurements, echocardiographic assessment of LV fractional shortening (FS), heart weight, and myocyte width (as assessed histologically) did not differ in NOS3-TG and WT mice. The inotropic response to graded doses of isoproterenol was significantly reduced in NOS3-TG mice. One week after LAD ligation, the infarcted fraction of the LV did not differ in WT and NOS3-TG mice. Four weeks after myocardial infarction, however, end-systolic LV internal diameter (LVID) was greater, and FS and maximum and minimum rates of LV pressure development were less in WT than in NOS3-TG mice. LV weight/body weight ratio was greater in WT than in NOS3-TG mice. LaPointe et al. (2004) found that inhibition of cyclooxygenase-2 (COX-2) improves cardiac function after myocardial infarction in the mouse. Myocardial infarction was produced by ligation of the LAD coronary artery in mice. Two days later, mice were treated with a selective COX-2 inhibitor, or vehicle in drinking water for 2 weeks. After the treatment period, mice were subjected to two-dimensional M-mode echocardiography to determine cardiac function. Hearts were then analyzed for determination of infarct size, interstitial collagen content, brain natriuretic peptide (BNP) mRNA, myocyte cross-sectional area, and immunohistochemical staining for transforming growth factor (TGF)β and COX-2. Shibuya et al. (2005) reported that N-acetyl-serylaspartyl-lysine-proline prevents renal insufficiency and matrix expansion in diabetic db/db mice. Weinberg et al. (2005) found in coronary ligation experiments in mice, that rosuvastatin reduces experimental left ventricular infarct size after ischemiareperfusion injury but not total coronary occlusion. Yang et al. (2005) found that the infarct-sparing effect of A2A-adenosine receptor activation is due primarily to its action on lymphocytes. Chimeric mice were created by bone marrow transplantation from A2AAR-knockout or green fluorescent protein (GFP) donor mice to irradiated congenic C57BL/6 (B6) recipients. In the GFP chimeras, we were unable to detect GFP-producing cells in the vascular endothelium, indicating that bone-marrow-derived cells were not recruited to endothelium at appreciable levels after bone marrow transplantation and/or acute myocardial infarction. Injection of 5 or 10 μg/kg of a potent and selective agonist of A2A adenosine receptor had no effect on hemodynamic parameters but reduced infarct size in B6 mice after 45 min of LAD artery occlusion followed by 24 h of reperfusion. Kanno et al. (2003) found connexin43 to be a determinant of myocardial infarct size following coronary occlusion in mice. Regulation of myocardial connexins during hypertrophic remodeling was reviewed by Teunissen et al. (2004). Kuhlmann et al. (2006) reported that granulocyte colony stimulating factor (G-CSF), alone or in combination with stem cell factor (SCF), can improve hemodynamic cardiac function after myocardial infarction in mice and reduces inducible arrhythmias in the infarcted heart potentially via increased connexin43 expression and arteriogenesis. A.3.2.3 Occlusion of Coronary Artery in Anesthetized Dogs and Pigs ... PURPOSE AND RATIONALE The size of infarcts is studied after proximal occlusion of the left anterior descending coronary artery in openchest dogs. Compounds potentially reducing infarctsize are tested. To delineate the post-mortem area at risk, coronary arteriograms are made after injection of a BaSO4-gelatin mass into the left coronary ostium. The infarct’s area is visualized with nitro-blue tetrazolium chloride in myocardial sections. PROCEDURE Dogs of either sex weighing approximately 30 kg are used. The animals are anesthetized by intravenous injection of pentobarbital sodium (bolus of 35 mg/kg followed by continuous infusion of 4 mg/kg/h). The animals are placed in the right lateral position. Respiration is maintained through a tracheal tube using a positive pressure respirator. Arterial blood gases are checked, and the ventilation rate and/or oxygen flow rate are adjusted to achieve physiological blood gas values (PO2: 100–140 mm Hg, PCO2: 32–40 mm Hg, and pH7.47). A peripheral vein (saphenous vein) is cannulated for the administration of test compound. The ECG is recorded continuously from lead II (Einthoven). Preparation for Hemodynamic Measurements For recording of peripheral systolic and diastolic blood pressure, the cannula of a femoral vein is connected to a pressure transducer (Statham P 23DB). For determination of left ventricular pressure (LVP), a Millar microtip catheter (PC350) is inserted via the left carotid artery. Left ventricular enddiastolic pressure (LVEDP) is measured from a high-sensitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate is counted. Experimental Procedure The heart is exposed through a left thoracotomy between the fourth and fifth intercostal space, the pericard is opened and the left anterior descending coronary artery (LAD) is exposed. After reaching steady state conditions for the hemodynamic parameters (approx. 45 min), the LAD is ligated just below the first diagonal branch for 360 min. No attempt is made to suppress arrhythmic activity after the ligation. The test substance or the vehicle (controls) is administered by intravenous bolus injection and/or continuous infusion. The schedule of administration may vary. Hemodynamic parameters are registered continuously during the whole experiment. At the end of the experiment, the animals are sacrificed with an overdose of pentobarbital sodium and the heart is dissected. Preparation to Determine Area at Risk Coronary arteriograms are made according to Schaper et al. (1979) to delineate the anatomic post-mortem area at risk. A purse-string suture is placed around the left coronary ostium in the sinus of Valsalva; a cannula is then placed in the ostium and the purse-string suture is tightened. Micronized BaSO4 suspended in 12 % gelatin solution (37 °C) is injected under increasing pressure (2 min at 100 mmHg, 2 min at 150 mmHg and 2 min at 200 mm Hg). The heart is placed in crushed ice to gel the injectate. The right ventricle is removed and the left ventricle plus septum is cut into transverse sections (approx. 1 cm thick) from the apex to the level of the occlusion (near the base). From each slice angiograms are made with a X-ray tube at 40 kV to assess the post-mortem area at risk (by defect opacity: reduction of BaSO4-filled vessels in infarct tissue). Preparation to Determine Infarct Size The slices are then incubated in p-nitro-blue tetrazolium solution (0.25 g/L in Sörensen phosphate buffer, pH7.4, containing 100 mM D,L-maleate) in order to visualize the infarct tissue (blue/violet-stained healthy tissue, unstained necrotic tissue). The slices are photographed on color transparency film for the determination of the infarct area. Left ventricle and infarct area, and area at risk are measured by planimetry from projections of all slices with the exclusion of the apex and of the slice containing the ligature. EVALUATION Mortality and the different hemodynamic parameters are determined. Changes of parameters in drug-treated animals are compared to vehicle controls. The different characteristics are evaluated separately. Mean values ± SEM of infarct area and of area at risk are calculated. Statistical analyses consist of regression and correlation analyses and of the Student’s t-test. Results are considered significant at p < 0.05. MODIFICATIONS OF THE METHOD Nachlas and Shnitka (1963) described the macroscopic identification of early myocardial infarcts by alterations in dehydrogenase activity in dogs by staining the cardiac tissue with Nitro-BT [2,2′-di-p-nitrophenyl-5,5′ diphenyl-3,3′-(3,3′-dimethoxy-4,4′-biphenylene) ditetrazolium chloride] yielding a dark blue formazan in viable muscle but not in necrotic muscle fibers. Chiariello et al. (1976) compared the effects of nitroprusside and nitroglycerin on ischemic injury during acute myocardial infarction in dogs. Black et al. (1995) studied the cardioprotective effects of heparin or N-acetylheparin in an in vivo dog model of myocardial and ischemic reperfusion injury. The hearts were removed after 90 min of coronary occlusion and a 6 h-reperfusion period. Area at risk was determined by the absence of Evans blue dye after perfusion of the aorta in a retrograde fashion and infarct zone by the absence of formazan pigment within the area at risk after perfusion of the circumflex coronary artery with triphenyltetrazolium chloride. Reimer et al. (1985) tested the effect of drugs to protect ischemic myocardium in unconscious and conscious dogs. In the conscious model, dogs of either sex weighing 10–25 kg were anesthetized with thiamyal sodium (30–40 mg/kg i.v.) and underwent thoracotomy through the 4th intercostal space. Heparinfilled polyvinyl chloride catheters were positioned in the aortic root, the left atrium via the left atrial appendage, and a systemic vein. A mechanical adjustable snare type occluder was placed around the proximal left circumflex coronary artery above or below the first marginal branch, so that temporary occlusion resulted in cyanosis of at least 75 % of the inferior wall. The catheters and snare were either exteriorized or positioned in a subcutaneous pocket at the back of the neck. Penicillin, 1000,000 units, and streptomycin, 1.0 g, were given i.m. for the first 4 postoperative days, and at least 7 days were allowed for recovery from surgery. Dogs were fasted overnight prior to the study. After exteriorization and flushing of the catheters, 30–40 min were allowed for the animals to adjust to laboratory conditions. Morphine sulfate, 0.25 mg/kg, i.m., was given 30 min before occlusion, and an additional 0.25 mg/kg, i.v., was given 20 min later. Heart rate and aortic and left atrial pressures were monitored continuously. Permanent coronary occlusion was produced by a sudden one-stage tightening of the snare occluder. Drugs were administered by continuous i.v. infusion over 6 h. Hemodynamic measurements were taken 5 min before occlusion and 10, 25, 105, 180, and 360 min after occlusion. Raberger et al. (1986) described a model of transient myocardial dysfunction in conscious dogs. Mongrel dogs, trained to run on a treadmill, were chronically instrumented with a miniature pressure transducer in the left ventricle and a hydraulic occluder placed around the circumflex branch of the left coronary artery. Two pairs of piecoelectrical crystals for sonomicrometry were implanted subendocardially to measure regional myocardial functions. Comparable episodes of regional dysfunction of the left coronary artery area during treadmill runs were found after partial left coronary artery stenosis induced by external filling of the occluder. Hartman and Warltier (1990) described a model of multivessel coronary artery disease using conscious, chronically instrumented dogs. A hydraulic occluder was implanted around the left anterior descending coronary artery (LAD) and an Ameroid constrictor around the left circumflex coronary artery (LCCA). Pairs of piecoelectric crystals were implanted within the subendocardium of the LAD and LCCA perfusion territories to measure regional contractile function. A catheter was placed in the left atrial appendage for injection of radioactive microspheres to measure regional myocardial perfusion. Bolus injections of adenosine were administered daily via the left atrium to evaluate LAD and LCCA coronary reserve. After stenosis by the Ameroid constrictor, radioactive microspheres were administered to compare regional perfusion within normal myocardium to flow in myocardium supplied by the occluded or stenotic coronary arteries. Holmborn et al. (1993) compared triphenyltetrazolium chloride staining versus detection of fibronectin in experimental myocardial infarction in pigs. Klein et al. (1995) used intact pigs and found myocardial protection by Na+/H+ exchange inhibition in ischemic reperfused hearts. Klein et al. (1997) measured the time delay of cell death by Na+/H+ exchange inhibition in regionally ischemic, reperfused porcine hearts. Garcia-Dorado et al. (1997) determined the effect of Na+/H+ exchange blockade in ischemic rigor contracture and reperfusion-induced hypercontracture in pigs submitted to 55 min of coronary occlusion and 5 h reperfusion. Myocardial segment length analysis with ultrasonic microcristals was used to detect ischemic rigor (reduction in passive segment length change) and hypercontracture (reduction in end-diastolic length). Symons et al. (1998) tested the attenuation of regional dysfunction in response to 25 cycles of ischemia (2 min) and reperfusion (8 min) of the left circumflex coronary artery in conscious swine after administration of a Na+/H+ exchange inhibitor. The animals were instrumented to measure arterial blood pressure, regional myocardial blood flow (colored microspheres), systolic wall thickening in the normally perfused left anterior descending and left circumflex coronary artery regions (sonomicrometry), left circumflex coronary artery blood flow velocity (Doppler) and reversibility to occlude the left circumflex coronary artery (hydraulic occluder). Etoh et al. (2001) studied myocardial and interstitial matrix metalloproteinase activity after acute myocardial infarction in pigs. A.3.2.4 Acute Ischemia by Injection of Microspheres in Dogs ... PURPOSE AND RATIONALE Severe left ventricular failure is induced by repeated injections of 50 μm plastic microspheres into the left main coronary artery of anesthetized dogs. Hemodynamic measurements are performed under theses conditions testing drugs which potentially improve cardiac performance. The test can be used to evaluate the influence of drugs on myocardial performance during acute ischemic left ventricular failure in dogs. PROCEDURE Dogs of either sex weighing approximately 30 kg are anesthetized by an intravenous bolus injection of 35–40 mg/kg pentobarbital sodium continued by an infusion of 4 mg/kg/h. The animals are placed in the right lateral position. Respiration is maintained through a tracheal tube using a positive pressure respirator and controlled by measuring end-expiratory CO2 concentration as well as blood gases. Two peripheral veins are cannulated for the administration of narcotic (brachial vein) and test compounds (saphenous vein). The ECG is recorded continuously in lead II (Einthoven). Preparation for Hemodynamic Measurements For recording of peripheral systolic and diastolic blood pressure, the cannula of the right femoral vein is connected to a pressure transducer (Statham P 23DB). For determination of left ventricular pressure (LVP), a Millar microtip catheter (Gould PC 350) is inserted via the left carotid artery. Left ventricular enddiastolic pressure (LVEDP) is measured on a high-sensitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate (HR) is counted. To measure right ventricular pressure, a Millar microtip catheter is inserted via the right femoral vein. Systolic, diastolic and mean pulmonary artery pressure (PAP), mean pulmonary capillary pressure, and cardiac output are measured by a thermodilution technique using a Cardiac Index Computer (Gould SP 1435) and a balloon-tip triple lumen catheter (Gould SP 5105, 5 F) with the thermistor positioned in the pulmonary artery via the jugular vein. The heart is exposed through a left thoracotomy between the fourth and fifth intercostal space, the pericard is opened and the left circumflex coronary artery (LCX) is exposed. To measure coronary blood flow, an electromagnetic flow probe (Hellige Recomed) is placed on the proximal part of the LCX. Polystyrol microspheres (3 M Company, St. Paul, Minnesota, USA) with a diameter of 52.5 ± 2.24 μm are diluted with dextran 70, 60 mg/ml and saline at a concentration of 1 mg microspheres/ml (1 mg = approx. 12,000 beads). For administration of microspheres, an angiogram catheter (Judkins-Schmidt Femoral-Torque, William Cook, Europe Aps.BP 7) is inserted into the left ostium via the left femoral artery. Induction of Failure The microspheres are injected through the angiogram catheter into the left ostium initially as 10 ml and later as 5 ml boluses about 5 min apart. The microsphere injections produce stepwise elevations of LVEDP. Embolization is terminated when LVEDP has increased to 16–18 mm Hg and/or PAPm has increased to 20 mm Hg and/or heart rate has reached 200 beats/min. The embolization is completed in about 70 min and by injection of an average dose of 3–5 mg/kg microspheres. Hemodynamic variables are allowed to stabilize after coronary embolization for at least 30 min. Experimental Course The test substance or the vehicle (controls) is then administered by intravenous bolus injection or continuous infusion, or by intraduodenal application. Recordings are obtained before embolization after embolization before administration of test compound 5, 30, 45, 60, 90, 120 and, eventually, 150 and 180 min following administration of test drug. At the end of the experiment, the animal is sacrificed by an overdose of pentobarbital sodium. EVALUATION Besides the different directly measured hemodynamic parameters, the following data are calculated according to the respective formula: stroke volume [ml/s], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ SV = \frac{{{\rm cardiac}\;{\rm output}}}{{{\rm heart}\;{\rm rate}}} $$\end{document} tension index [mmHgs], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ IT = \frac{{BPs \times {\rm heart}\;{\rm rate}}}{{1000}} $$\end{document} Coronary vascular resistance [mm Hgmin/ml], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ CVR = \frac{{BPm \times RAPm}}{{CBF}} $$\end{document} total peripheral resistance [dyns/cm5], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ TPR = \frac{{BPm \times RAPm}}{{{\rm cardiac}\;{\rm output}}} \times 79.9 $$\end{document} Pulmonary artery resistance [dyn s/cm5], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ PAR = \frac{{PAPm - PCPm}}{{{\rm cardiac}\;{\rm output}}} \times 79.9 $$\end{document} right ventricle work [kgm/min], RVW = (PAPm − RAPm) × cardiac output × 0. 0136 left ventricle work [kgm/min], LVW = (BP m  − LVEDP) × cardiac output × 0. 0136 left ventricular myocardial oxygen consumption [ml O2/min/100 g], \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \begin{array}{l} MVO_2 = K_1 (BPs \times HR) \\ \qquad \qquad\; + K_2 \frac{{(0.8BPs + 0.2BPd) \times HR \times SV}}{{BW}} \\ \qquad \qquad\; + \;1.43 \\ \end{array} $$\end{document} K 1 =4.08 × 10−4 K 2 =3.25 × 10−4 BPs = systolic blood pressure [mm Hg] BPd = diastolic blood pressure [mm Hg] BPm = mean blood pressure [mm Hg] CBF = coronary blood flow in left circumflex coronary artery [ml/min] RAPm = mean right atrial pressure [mm Hg] PAPm = mean blood pressure A. pulmonalis [mm Hg] PCPm = mean pulmonary capillary pressure HR = heart rate [beats/min] SV = stroke volume [ml] BW = body weight [kg] Changes of parameters in drug-treated animals are compared to vehicle controls; statistical significance of the differences is calculated with the Student’s t-test. Mean embolization times, doses of microspheres and number of microsphere applications are evaluated. MODIFICATIONS OF THE METHOD Gorodetskaya et al. (1990) described a simple method to produce acute heart failure by coronary vessel embolization with microspheres in rats. A.3.2.5 Influence on Myocardial Preconditioning ... PURPOSE AND RATIONALE Damage to the mammalian heart produced by prolonged ischemia and reperfusion can be reduced by “preconditioning” the myocardium via a brief cycle of ischemia and reperfusion prior to the protracted ischemic event. Ischemic preconditioning has been shown to decrease infarct size and increase recovery of post-ischemic ventricular function (Murray et al. 1986), and to reduce leakage of cellular marker proteins indicative for cardiac myocyte death (Volovsek et al. 1992). In addition, preliminary preconditioning also attenuates cardiac arrhythmia associated with subsequent occlusion and reperfusion (Vegh et al. 1990). The mechanistic basis of this phenomenon is under discussion (Parratt 1994; Parratt and Vegh 1994). Adenosine receptor involvement in myocardial protection after ischemic preconditioning in rabbits has been shown by Baxter et al. (1994). Adenosine (A1 receptor) antagonists have been demonstrated to block the protection produced by preconditioning (Liu et al. 1991), and short term administration of adenosine was shown to simulate the protective effects of ischemic preconditioning (Toombs et al. 1993). These observations together suggest that adenosine is generated by the short preconditioning ischemia. Other recent pharmacological studies (Gross and Auchampach 1992; Yao and Gross 1994) indicate the involvement of the ATP-sensitive potassium channel. Recent investigations indicate that an increase of NO production after ACE inhibitors may be a part of the protective mechanism (Linz et al. 1992, 1994).Moreover, the involvement of prostanoids and bradykinin in the preconditioning process has been discussed (Wiemer et al. 1991). Gho et al. (1994) found a limitation of myocardial infarct size in the rat by transient renal ischemia, supporting the hypothesis that the mechanism leading to cardiac protection by ischemic preconditioning may not only reside in the heart itself. PROCEDURE New Zealand rabbits of either sex weighing 2.5–3.5 kg are initially anesthetized with an intramuscular injection of ketamine (50 mg/ml) /xylazine (10 mg/ml) solution at a dose of 0.6 ml per kg body weight. A tracheotomy is performed to facilitate artificial respiration. The left external jugular vein is cannulated to permit a constant infusion (0.15–0.25 ml/min) of xylazine (2 mg/ml in heparinized saline) to assist in maintaining anesthesia and fluid volume. Anesthesia is also maintained by i.m. injections (0.4–0.6 ml) of ketamine (80 mg/ml) and xylazine (5 mg/ml) solution. After the xylazine infusion is started, animals are respired with room air at a tidal volume of 10 ml/kg and a frequency of 30 inflations per min (Harvard Apparatus, USA). Thereafter, ventilation is adjusted or inspiratory room air is supplemented (5%CO2/95%O2) to maintain arterial blood chemistry within the following ranges: pH 7.35–7.45, PCO2 25–45 mm Hg, PO2 90–135 mm Hg. The right femoral artery and vein are isolated and catheterized for measurement of arterial pressure and administration of drugs, respectively. A thoracotomy is performed in the fourth intercostal space, and the lungs are retracted to expose the heart. The pericardium is cut to expose the left ventricle, and a solid-state pressure transducer catheter (e. g.,MicroTip 3 F, Millar Instruments, Houston, USA) is inserted through an apical incision and secured to enable measurement of pulsatile left ventricular pressure. The maximal rate of increase in left ventricular pressure (LVdP/dt max) is determined by electronic differentiation of the left ventricular pressure wave form. A segment of 4–0 prolene suture is looped loosely around a marginal branch of the left main coronary artery to facilitate coronary occlusion during the experiment. Needle electrodes are inserted subcutaneously in a lead II configuration to enable recording of an ECG in order to determine heart rate and help confirm the occurrence of ischemia (ST segment elevation) and reperfusion of the myocardium distal to the coronary occlusion. Continuous recording of pulsatile pressure, ECG, heart rate, and LVdP/dt are simultaneously displayed on a polygraph (e. g. Gould chart recorder, Gould Inc., Valley View, USA) and digitized in real time by a personal computer. Hemodynamic data are condensed for summary and later statistical analysis. Ischemic preconditioning is induced by tightening the prolene loop around the coronary artery for 5 min and then loosening to reperfuse the affected myocardium for 10 min prior to a subsequent 30 min occlusion. After surgical preparation, and prior to 30 min of occlusion, rabbits are randomly selected to receive ischemic preconditioning, no preconditioning, or ischemic preconditioning plus treatment with test drugs. After 30 min of occlusion, the ligature is released and followed by 120 min of reperfusion. Occlusion is verified by epicardial cyanosis distal to the suture, which is usually accompanied by alterations in hemodynamics and ECG. Reperfusion is validated by return of original color. Systemic hemodynamics are summarized for each experimental period. The experiment is terminated after 120 min of reperfusion, and the heart is excised for determinations of infarct size and area at risk. Immediately before the animal is sacrificed, the marginal branch of the left coronary artery is reoccluded and India ink is rapidly injected by syringe with a 18-g needle into the left ventricular chamber to demarcate blackened normal myocardium from unstained area at risk. After the rabbits are sacrificed, the heart is removed and sectioned in a breadloaf fashion from apex to base perpendicular to the long axis. The right ventricle is removed from each slice leaving only the left ventricle and septum. After each slice is weighed, the portions are washed and incubated in a phosphate buffered saline solution of triphenyl tetrazolium chloride (1 g/ml, Sigma) for 10–15 min. Salvaged myocardium in the area at risk stains brick red, whereas infarcted tissue remains unaltered in color. Slices are then placed between sheets of Plexiglas and the areas (normal, risk, infarct) of each slice are traced on a sheet of clear acetate. Traces are then digitized and analyzed using computerized planimetry to compare the relative composition of each slice with respect to normal tissue, area at risk, and infarcted myocardium. Planimetry is performed with a computerized analysis system, e. g., Quantimet 570C image analysis system (Leica, Deerfield, USA). Surface areas of normal tissue, area at risk, and infarcted myocardium on both sides of each slide are averaged for the individual slide. The contribution of each slide to total infarcted and area at risk (%) and area at risk as a percentage of total left ventricular mass for the entire left ventricle is prorated by the weight of each slice (Garcia-Dorado et al. 1987). By adding the adjusted contributions from each slice to infarcted tissue, area at risk, and left ventricular mass, a three-dimensional mathematical representation of total myocardial infarct size and risk zone can be calculated for each rabbit, and a mean tabulated for each treatment group for statistical comparison. EVALUATION All data are presented as mean ± SD. Systemic hemodynamic data are analyzed by ANOVA using Statistica/W software. Means are considered significantly different at p < 0.05. MODIFICATIONS OF THE METHOD Li et al. (1990) found in dog experiments that preconditioning with one brief ischemic interval is as effective as preconditioning with multiple ischemic periods. In contrast, Vegh et al. (1990) found in other dog experiments that two brief preconditioning periods of coronary occlusion, with an adequate period of reperfusion between, reduce the severity of arrhythmias. Yang et al. (1996) found a second window of protection after ischemic preconditioning in conscious rabbits which minimizes both infarction and arrhythmias. Late preconditioning against myocardial stunning in conscious pigs together with an increase of heat stress protein (HSP) 70 was described Sun et al. (1995). Szilvassy et al. (1994) described the anti-ischemic effect induced by ventricular overdrive pacing as a conscious rabbit model of preconditioning. Rabbits were equipped with right ventricular electrode catheters for pacing and intracavital recording and polyethylene cannulae in the left ventricle and right carotid artery to measure intraventricular pressure and blood pressure. One week after surgery in conscious animals, ventricular overdrive pacing at 500 beats/min over 2, 5, or 10 min resulted in an intracavital S-T segment elevation, shortening of ventricular effective refractory period, decrease in maximum rate of pressure development and blood pressure, and increase in left ventricular end-diastolic pressure proportional to the duration of stimulus. A 5-min preconditioning ventricular overdrive pacing applied 5 or 30 min before a 10-min ventricular overdrive pacing markedly attenuated ischemic changes, whereas a 2-min ventricular overdrive pacing had no effect. The ventricular overdrive pacing induced preconditioning effect was lost in atherosclerotic rabbits (Szilvassy et al. 1995), however, delayed cardiac protection could be induced in these animals (Szekeres et al. 1997). A.3.2.6 MRI Studies of Cardiac Function ... PURPOSE AND RATIONALE Magnetic resonance imaging (MRI) is the preferred technique for the visualization of lesions in the brain and spinal cord of patients with MS. It visualizes the resonance signals of tissue protons when they are placed in a time-varying strong magnetic field. The most frequently used parameters measured in MS are the spin-lattice relaxation time (T1) and the spin-spin relaxation time (T2). MRI is routinely used as a tomographic imaging technique, where anatomical pictures are created of 1-mm-thick tissue sections. The contrast differences between brain structures in most MRI techniques are determined by the different densities and diffusion of protons, as well as differences in relaxation times. T2 images are sensitive to water and, because all pathological alterations in MS brains are associated with altered distribution of tissue water (edema), this technique is highly useful for visualization of the spatial distribution of lesions. Contrast in T1 images is determined mainly by different lattice densities. Dense structures, such as compact white matter, have low T1 values, whereas relatively loose structures, such as grey matter or lesions, have higher T1 values. To distinguish inflammatory active from inactive lesions, the paramagnetic dye gadolinium-DTPA is intravenously injected (0.1–0.3 mmol kg−1) and, in areas of increased blood–brain barrier permeability, leaks into the brain parenchyma, causing local enhancement of the T1-weighted signal intensity. A third important MRI technique in MS is magnetization transfer ratio (MTR) imaging. The MTR of a given tissue is defined as the ratio of free protons versus protons bound to tissue macromolecules. MRI has emerged as a highly accurate and quantitative tool for the evaluation of cardiac function (Peshock et al. 1996). Al-Shafei et al. (2000a, 2002b) performed MRI analysis of cardiac cycle events in diabetic rats and tested the effect of angiotensin-converting enzyme inhibition. PROCEDURE Diabetes was induced in Wistar rats at an age of 7, 10, and 13 weeks. The rats were anesthetized using 1 %–2 % halothane in oxygen, their blood glucose levels were checked. They were then given a single intraperitoneal injection of streptozotocin 65 mg/kg body weight. The control rats received sham injections of the citrated buffer when they were 7 weeks old. One diabetic group was treated with 2 g/l captopril in the drinking water For MR imaging, rats were anesthetized using 1 %–2 % halothane in oxygen, weighed and their systolic blood pressures measured non-invasively using a rat tail blood pressure monitor both before and after imaging sessions to confirm physiological stability. Electrocardiographic (ECG) monitoring used shielded subcutaneous electrodes and a Tektronix 2225 oscilloscope. The cine imaging protocols were performed with the anesthetized animal placed in a specially designed home-built half-sine-spaced birdcage radiofrequency (RF) probe unit contained within a cylindrical plastic holder fitted within a gradient set of internal diameter 11 cm. The RF probe unit was made up of a half-sine spaced birdcage RF probe of internal diameter of 4.5 cm with open ends, an RF shield consisting of a cylinder of copper gauze surrounding and sliding over the birdcage, a tuning capacitor and a coaxial cable to carry the RF (Ballon et al. 1990). The assembly included ECG leads, attachment plugs for the ECG leads and a unit to anchor anesthetic delivery tubes near the nose of the animal. All experiments used a 2 T Oxford Instruments (UK) superconducting magnet with a horizontal internal bore of 31 cm. A gated cine protocol synchronized line acquisition to set times following alternate electrocardiographicR waves. This acquisition was then repeated at the same slice position at 12 equally incremented times through the cardiac cycle. This sequence in turn was repeated for each of the 128 lines to generate each 128 × 128 image, which itself was acquired twice for signal averaging. The preceding procedure was in turn repeated 12 times to obtain signal-averaged images for every one of the 12 contiguous transverse slices examined. Each imaging session therefore required (128 × 12 × 2 × 2) times the cardiac cycle duration. The effective repeat time (TR) was approximately 13 ms. The short echo time (TE) of 4.3 ms reduced motion artifacts and ensured good contrast between blood and myocardium. EVALUATION The image data were transferred from the MRI console using in-house hardware and software to remote UNIX workstations for quantitative analysis using inhouse software based on CaMReS libraries (CaMReS, Dr N. J. Herrod, Herchel Smith Laboratory for Medicinal Chemistry, University of Cambridge). MODIFICATIONS OF THE METHOD Itter et al. (2004) used non-invasive MRI techniques in a model of chronic heart failure in spontaneously hypertensive rats. Bryant et al. (1998) and Franco et al. (1999) described MRI and invasive evaluation of development of heart failure in transgenic mice with myocardial expression of tumor necrosis factor-α. Wiesmann et al. (2002) reported analysis of right ventricular function in healthy mice and a murine model of heart failure byin vivo MRI. Kraitchman et al. (2003) described quantitative ischemia detection during cardiac magnetic resonance stress testing by use of fast harmonic phase MTI (FastHARP) in dogs. Reddy et al. (2004) discussed the feasibility of a porcine model of healed myocardial infarction by integration of cardiac MRI with three-dimensional electroanatomic mapping to guide left ventricular catheter manipulation. Pelzer et al. (2005) reported that the estrogen receptor-α agonist 16α-LE2 inhibits cardiac hypertrophy and improves hemodynamic function in estrogendeficient spontaneously hypertensive rats. Improved left ventricular function upon 16α-LE2 treatment was also observed in cardiac MRI studies. A.3.2.7 MRI Studies After Heart and Lung Transplantation ... PURPOSE AND RATIONALE Acute cardiac allograft rejection continues to be the cause of graft loss and contributes to the morbidity and mortality after cardiac transplantation. Endomyocardial biopsy is used routinely for cardiac transplant rejection surveillance. A sensitive and non-invasive method for detecting rejection is desirable. Kanno et al. (2001) developed a rat model of heterotopic heart and lung transplantation for MRI experiments. Allotransplantations were performed with syngeneic transplantations serving as controls. MR images were obtained with a gradient echo method. PROCEDURE Animals All rats used in the experiments were male, 2–3 months of age, and weighed 220–250 g each. Animals were housed individually and provided with food and water ad libitum. Inbred Brown Norway (BN; RT1n) andDA (RT1a) rats were obtained from Harlan Sprague Dawley (Indianapolis, Ind). Heart and Lung Transplantation Under anesthesia with injection of 35 mg/kg body weight of sodium pentobarbital IP, 500U/kg body weight of heparin was injected. In the syngeneic group, an en bloc donor heart and lung were taken from a BN rat and transplanted to another BN rat. In the allogeneic group, a graft from a DA rat was transplanted to a BN rat. This group was divided into two groups: one group was treated with 3 mg/kg per day ciclosporin (CsA), and the other group was not given CsA. Graft survival was monitored every day by palpating contraction of the transplanted heart. Operative procedures have been described by Kanno et al. (2000). In brief, after the chest wall of the donor rat was opened, the left lung was ligated and excised. The azygos vein with the left superior and right superior venae cavae was ligated and divided. The descending thoracic aorta was transected, and 10 ml of cold University of Wisconsin solution (UW solution, Dupont Pharma) was infused into the inferior vena cava until the fluid draining from the aorta was clear, followed by ligation and division of the inferior vena cava. The ascending aorta was dissected and transected at the portion between the left common carotid artery and the left subclavian artery, followed by ligation and division of the right brachiocephalic artery and the left common carotid artery. After removal of the heart and lung from the donor, the right lung was washed 3 times through the bronchus with UW solution containing penicillin G. The grafts were then placed into cold UW solution for ≈ 5 min until transplantation. Next, the left inguinal portion of the recipient rat was opened and dissected to make enough space for the transplanted organs. The left lower part of the abdominal wall was opened in a transverse fashion from the left femoral vessels to the midline. The abdominal organs were retracted to the right, and both the aorta and the inferior vena cava just beyond the bifurcation were dissected. The vessels were clamped, and an appropriate opening of the aorta was made to receive the aorta of the graft in an end-to-side fashion. Rhythmic heartbeats commenced spontaneously as the heart and the lung regained circulation after removal of the clamp. After hemostasis of the surgical field, the abdominal wall was sutured, with care taken not to kink or obstruct the aorta of the graft. MRI EXPERIMENTS MRI measurements were carried out on a 4.7-T/40-cm Bruker AVANCE DRX MR instrument equipped with 15-cm, 10-gauss/cm shielded gradients. In vivo MR images of transplanted heart-lung were obtained over a period of 24 h after infusion of dextran-coated ultrasmall superparamagnetic iron oxide (USPIO) particles. The imaging sequence consisted of a gradient echo sequence, triggered to ECG and ventilator (60 strokes/min, 10 ml/kg), with TR/TE 500/10 ms, flip angle equal to Ernst angle, slice thickness 1 mm, field of view 6.0 cm, data matrix size 256 × 130 (zero-filled to 256 × 256), and scan time 5 min. ECG leads were placed on both of the hind limbs of the rat with the transplant to pick up the heartbeat from the transplanted heart more effectively. The change of MRI signal intensity was measured in whole ventricular wall in each transplanted heart. The MR signal intensity of the heart was normalized to that of the leg muscle, because USPIO particles are not readily taken up by muscular tissue, according to Gellissen et al. (1999) Dextran-coated USPIO particles were synthesized according to the method of Palmacci and Josephson (1993) with slight modifications (Dodd et al. 1999) The MR relaxivities R1 (spin-lattice relaxation rate constant, 1/T2, per mol of Fe in USPIO) and R2 (spin-spin relaxation rate constant, 1/T2, per mol of Fe in USPIO) measured at 4.7 T were 3.8 × 104 and 9.1 × 104 (mol/l)/s, respectively. For in vivo studies, dextran-coated USPIO particles were dialyzed against PBS solution and diluted to a concentration of 18 μmol Fe/ml, and 0.8 ml of the suspension (i. e., ≈3 mg Fe/kg body weight) was injected intravenously for each study. At 6 days after transplantation, dextran-coated USPIO particles were injected intravenously as mentioned above, and the animals were subjected to MRI. Then 24 h later, these animals were again placed inside the magnet and scanned. The regions of interest were defined manually with Bruker software. MR signal intensity in the entire ventricular wall in the plane was measured. After injection of USPIO particles at postoperative day (POD) 6, animals with allotransplants were given CsA for 4 (POD 7 to 10) or 7 (POD 7 to 13) days and reinjected with USPIO particles on POD 14. Pathological Analysis and Immunohistochemistry After an MR experiment was completed, the transplanted hearts were extirpated, fixed in 3.7 % formaldehyde, and embedded in paraffin for 5-μm sections. Hematoxylin-eosin staining and Perl’s Prussian blue staining were performed in the Transplantation Pathology Laboratory of the University of Pittsburgh Medical Center. Histological analysis for pathological grading of heart rejection, which is based on the criteria established by the International Society for Heart and Lung Transplantation, was also performed by this laboratory in a blinded manner. Monoclonal antirat macrophage antibody (ED1, Serotec) was used as a primary antibody for macrophages. Immunohistochemistry was carried out with the ABC staining system (Santa Cruz Biotechnology) according to the manufacturer’s protocol. EVALUATION The results are presented as mean ± SD. The results were analyzed by ANOVA with StatView software (SAS Institute). A value of P < 0.05 was considered to be statistically significant. A.3.3 Ex Vivo Methods A.3.3.1 Plastic Casts from Coronary Vasculature Bed PURPOSE AND RATIONALE Prolonged administration of coronary drugs has been shown to increase the number and size of interarterial collaterals of dogs and pigs after coronary occlusion (Vineberg et al. 1962; Meesmann and Bachmann 1966). An increased rate of development of collateral arteries was observed after physical exercise in dogs (Schaper et al. 1965), as well as after chronic administration of coronary dilating drugs (Lumb and Hardy 1963). An even more effective stimulus for collateral development is an acute or gradual occlusion of one or several major coronary branches. Filling the arterial coronary bed with a plastic provides the possibility to make the collaterals visible and to quantify them (Schmidt and Schmier 1966; Kadatz 1969). PROCEDURE Dogs weighing 10–15 kg are anesthetized with pentobarbital sodium 30 mg/kg i.v. They are respirated artificially and the thorax is opened. After opening of the pericard, Ameroid cuffs are placed around major coronary branches. Gradual swelling of the plastic material occludes the lumen within 3–4weeks. The dogs are treated daily with the test drug or placebo. After 1 week recovery period they are submitted to exercise on a treadmill ergometer. After 6weeks treatment, the animals are sacrificed, the heart removed and the coronary bed flushed with saline. The liquid plastic Araldite is used to fill the whole coronary tree from the bulbus aortae. The aortic valves are glued together in order to prevent filling of the left ventricle. Red colored Araldite is used to fill the arterial tree. The venous part of the coronary vasculature can be filled with blue colored Araldite from the venous sinus. The uniformity of the filling pressure, the filling time, and the viscosity of the material are important. Polymerization is complete after several hours. Then, the tissue is digested with 35 % potassium hydroxide. The method gives stable preparations which can be preserved for a long time. EVALUATION Plastic casts from drug treated animals are compared with casts from dogs submitted to the same procedure without drug treatment. CRITICAL ASSESSMENT OF THE METHOD The procedure allows impressive demonstration of the formation of arterial collaterals. The results of post mortem Araldit impletion agree with the functional results of experimental coronary occlusion. MODIFICATIONS OF THE METHOD Boor and Reynolds (1977) described a simple planimetric method for determination of left ventricular mass and necrotic myocardial mass in postmortem hearts. A.4 Calcium Uptake Inhibiting Activity ... A.4.0.1 General Considerations Cellular calcium flux is regulated by receptor-operated and voltage-dependent channels, which are sensitive to inhibition by calciumentry blockers. The term calcium `antagonist was introduced by Fleckenstein (1964, 1967) when two drugs, prenylamine and verapamil, originally found as coronary dilators in the LANGENDORFF-experiment, were shown to mimic the cardiac effects of simple Ca2+-withdrawal, diminishing Ca2+-dependent high energy phosphate utilization, contractile force, and oxygen requirement of the beating heart without impairing the Na+-dependent action potential parameters. These effects were clearly distinguishable from β-receptor blockade and could promptly be neutralized by elevated Ca2+, β-adrenergic catecholamines, or cardiac glycosides, measures that restore the Ca2+ supply to the contractile system. In the following years many Ca2+-antagonists were introduced to therapy. Specific Ca2+-antagonists interfere with the uptake of Ca2+ into the myocardium and prevent myocardial necrotization arising from deleterious intracellular Ca2+ overload. They act basically as specific inhibitors of the slow transsarcolemnal Ca2+ influx but do not or only slightly affect the fast Na+ current that initiates normal myocardial excitation. Calcium channels and the sites of action of drugs modifying channel function have been classified (Bean 1989; Porzig 1990; Tsien and Tsien 1990; Spedding and Paoletti 1992). Nomenclature and structure–function relationships of voltage-gated calcium channels were reviewed by Catterall et al. (2005). Kochegarow (2003) reviewed the therapeutic application of modulators of voltage-gated calcium channels. Four main types of voltage dependent calcium channels are described: L type (for long lasting), T type (for transient), N type (for neuronal), and P type (for Purkinje cells). They differ not only by their function (Dolphin 1991) and localization in tissues and cells but also by their sensitivity to pharmacological agents (Ferrante and Triggle 1990; Dascal 1990; Kitamura et al. 1997) and by their specificity to radioligands. The widely distributed L-type channels exist in isoforms (L1, 2, 3, 4) and consist of several subunits, known as α 1, α 2, β, γ , δ. They are sensitive to dihydropyridines, phenylalkylamines or benzothiazepines, but insensitive to ω-conotoxin and ω-agatoxin. The segments required for antagonist binding have been analyzed (Peterson et al. (1996, Schuster et al. 1996; Mitterdorfer et al. 1996; Hockerman et al. 1997; Striessnig et al. 1998; Catterall 1998). Berjukow et al. (2000) discussed the molecular mechanism of calcium channel block by israpidine. Striessnig et al. (2004) described the role of L-type Ca2+ channels in Ca2+ channelopathies. The T-type channels are located mainly in the cardiac sinoatrial node and have different electrophysiological characteristics from L-type channels (Massie 1997; Perez-Reyes et al. 1998). Reviews of molecular physiology of low-voltage-activated T-type calcium channels were given by Perez-Reyes (2003, 2006). N- and P-type calcium channels blockers occur in neuronal cells and are involved in neurotransmitter release (Olivera et al. 1987; Bertolino and Llinás 1992; Mintz et al. 1992; Woppmann et al. 1994; Diversé-Pierluissi et al. 1995; Miljanich and Ramachandran 1995; Fisher and Bourque 1996; Ikeda 1996; Ertel et al. 1997; Sinnegger et al. 1997). A.4.1 In Vitro Methods A.4.1.1 3H-Nitrendipine Binding in Vitro ... PURPOSE AND RATIONALE Radiolabeled dihydropyridine calcium channel antagonists such as 3H-nitrendipine (Salter and Grover 1987; Campiani et al. 1996) are selective ligands for a drug receptor site associated with the voltage-dependent calcium channel. A constant concentration of the radioligand 3H-nitrendipine (0.3–0.4 nM) is incubated with increasing concentrations of a non-labeled test drug (0.1 nM–1 mM) in the presence of plasma membranes from bovine cerebral cortices. If the test drug exhibits any affinity to calcium channels, it is able to compete with the radioligand for channel binding sites. Thus, the lower the concentration range of the test drug, in which the competition reaction occurs, the more potent is the test drug. PROCEDURE Materials and solutions: Preparation buffer Tris-HCl pH7.4 50 mM Incubation buffer Tris-HCl Genapol 50 mM pH 7.4 0.001 % Radioligand 3H-nitrendipine Specific activity 2.59–3.22 TBq/mmol (70–87 Ci/mmol) (NEN) For inhibition of Nifedipine (Sigma) 3H-ni-trendipine binding in non-specific binding Experiments Two freshly slaughtered bovine brains are obtained from the slaughterhouse and placed in ice-cold preparation buffer. In the laboratory, approx. 5 g wet weight of the two frontal cerebral cortices are separated from the brains. Membrane Preparation The tissue is homogenized (glass Teflon potter) in ice-cold preparation buffer, corresponding to 1 g cerebral wet weight/50 ml buffer, and centrifuged at 48,000 g (4 °C) for 10 min. The resulting pellets are resuspended in approx. 270 ml preparation buffer, and the homogenate is centrifuged as before. The final pellets are dissolved in preparation buffer, corresponding to 1 g cerebral cortex wet weight/30 ml buffer. The membrane suspension is immediately stored in aliquots of 5–10 ml at –77 °C. Protein content of the membrane suspension is determined according to the method of Lowry et al. (1951) with bovine serum albumin as a standard. At the day of the experiment, the required volume of the membrane suspension is slowly thawed and centrifuged at 48,000 g (4 °C) for 10 min. The resulting pellets are resuspended in a volume of ice-cold incubation buffer, yielding a membrane suspension with a protein content of 0.6–0.8 mg/ml. After homogenization (glass Teflon potter), the membrane suspension is stirred under cooling for 20–30 min until the start of the experiment. Experimental Course As 1,4-dihydropyridines tend to bind to plastic material, all dilution steps are done in glass tubes. For each concentration samples are prepared in triplicate. The total volume of each incubation sample is 200 μl (microtiter plates). Saturation Experiments total binding: 50 μl 3H-nitrendipine (12 concentrations, 5 × 10−11–4 × 10–9 M) 50 μl incubation buffer non-specific binding: 50 μl 3H-nitrendipine (4 concentrations, 5 × 10−11–4 × 10–9 M) 50 μl nifedipine (5 × 10–7 M) Competition Experiments 50 μl 3H-nitrendipine (1 constant concentration, 3–4 × 10–10 M) 50 μl incubation buffer without or with non-labeled test drug (15 concentrations, 10−10–10−3 M) The binding reaction is started by adding 100 μl membrane suspension per incubation sample (0.6–0.8 mg protein/ml). The samples are incubated for 60 min in a bath shaker at 25 °C. The reaction is stopped by subjecting the total incubation volume to rapid vacuum filtration over glass fibre filters. Thereby the membrane-bound is separated from the free radioactivity. Filters are washed immediately with approx. 20 ml ice-cold rinse buffer per sample. The retained membrane-bound radioactivity on the filter is measured after addition of 2 ml liquid scintillation cocktail per sample in a Packard liquid scintillation counter. EVALUATION The following parameters are calculated: total binding non-specific binding specific binding = total binding - non-specific binding The dissociation constant (K i) of the test drug is determined from the competition experiment of 3Hnitrendipine versus non-labeled drug by a computer-supported analysis of the binding data. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ K_{\rm i} = \frac{{K_{\rm D} \;^3 {\rm H} \times {\rm IC}^{50} }}{{K_{\rm D} \;^3 {\rm H} + \left[ {^3 {\rm H}} \right]}} $$\end{document} IC50 = concentration of the test drug, which displaces 50 % of specifically bound 3H-nitrendipine in the competition experiment [3H] = concentration of 3H-nitrendipine in the competition experiment. K D 3H = dissociation constant of 3H-nitrendipine, determined from the saturation experiment. The K i-value of the test drug is the concentration, at which 50 % of the receptors are occupied by the test drug. The affinity constant K i [mol/l] is recorded and serves as a parameter to assess the efficacy of the test drug. Standard data: nifedipine K i = 2–4 × 10–9 mol/l MODIFICATIONS OF THE METHOD [3H](+)-PN200–100 (israpidine) has been used by many authors as the labeled ligand for binding experiments (Grassegger et al. 1989; Nokin et al. 1990; Striessnig et al. 1991; Yaney et al. 1991; Miwa et al. 1992; Ichida et al. 1993; Kalasz et al. 1993; Ikeda et al. 1994; Rutledge and Triggle 1995; Shimasue et al. 1996; He et al. 1997; Natale et al. 1999; Matthes et al. 2000; Peri et al. 2000). Yaney et al. (1991) performed binding experiments with [3H](+)-PN200–110 to membranes of RINm5F cells. The RINm5F pancreatic β-cells were grown on plastic culture flasks in medium RPMI 1640 supplemented with 10 % fetal bovine serum, 100 μg/ml of streptomycin and 100 U/ml penicillin. The cells were kept in humidified incubators at 37 °C in 5 % CO2-95 % air. Maintenance flasks were subcultured every 4–5 days at ∼ 80 % confluency. For binding experiments of [3H](+)-PN200–110 to membranes, cells were removed from the flasks by incubation for 15–20 min in 10 mM MOPS [3-(N-morpholino)propanesulfonic acid] and 1 mM EGTA (pH 7.4) at 4 °C. The osmotically ruptured cells were homogenized with a Brinkmann Polytron followed by centrifugation at 20,000 g for 15 min. The pellet was resuspended and washed twice. The final pellet was resuspended in 1 mM CaCl2 and 20 mM MOPS (pH 7.4) at a protein concentration of 0.2–0.4 mg/ml. Membranes were incubated at room temperature with (+)-[3H]PN200–110 in a final volume of 500 μl (Weiland and Oswald 1985). Bound and free radioligand were separated by vacuum filtration through a glass fiber filter (no. 32, Schleicher and Schüll) followed by three washes of the filter with 3 ml incubation buffer. Non-specific binding was determined in the presence of 1 μM nitrendipine. Radioactivity retained by the filters was determined by liquid scintillation counting. The concentration of free radioligand was calculated by scintillation counting of aliquots of incubation mixtures under nonspecific conditions before and after centrifugation. Several other calcium entry blockers, such as nimodipine, diltiazem, verapamil and desmethoxyverapamil, have been labeled and used for binding studies in order to elucidate the calcium channel recognition sites and may be used for further classification of calcium antagonists (Ferry and Glossmann 1982; Glossmann et al. 1983; Goll et al. 1984; Lee et al. 1984; Glossmann et al. 1985; Schoemaker and Langer 1985; Ruth et al. 1985; Reynolds et al. 1986). Vaghy et al. (1987) identified of a 1,4-dihydropyridine-and phenylalkylamine-binding polypeptide in calcium channel preparations. Naito et al. (1989) described photoaffinity labeling of the purified skeletal muscle calcium antagonist receptor by [3H]azidobutyryl diltiazem. Watanabe et al. (1993) reported that azidobutyryl clentiazem labels the benzothiazepine binding sites in the α 1 subunit of the skeletal muscle calcium channel. Tissue heterogeneity of calcium channel antagonist binding sites has been demonstrated by Gould et al. (1983). Photoaffinity labeling of the cardiac calcium channel with 1,4-dihydropyridine(–)-[3H]azidopine was described by Ferry at al (1987). Knaus et al. (1992) described a unique fluorescent phenylalkylamine probe for L-type Ca2+ channels. Binding sites for ω-conotoxin appear to be primarily associated with the N-type of voltage-dependent calcium channels (Feigenbaum et al. 1988; Wagner et al. 1988). Cohen et al. (1992) recommended the peptide ω-agatoxin IIIA as a valuable pharmacological tool being the only known ligand that blocks L-type calcium channels with high affinity at all voltages and causes, unlike the 1,4-dihydropyridines, no block of T-type calcium channels. A.4.2 Calcium Antagonism in Isolated Organs A.4.2.1 Calcium Antagonism on Action Potential of Isolated Guinea Pig Papillary Muscle ... PURPOSE AND RATIONALE Intracellular action potential in the guinea pig papillary muscle is recorded. Partial depolarization is achieved by potassium enriched Ringer solution and by addition of isoproterenol. Resting potential is increased to 40 mV resulting in inactivation of the fast sodium channel. Under these conditions, upstroke velocity is an indicator for calcium flux through the membrane, which is decreased by calcium blockers. PROCEDURE Guinea pigs of either sex (Pirbright White strain) weighing 300–400 g are sacrificed by stunning, the carotid arteries are severed, and the thoracic cage is opened immediately. The heart is removed, placed in a container of prewarmed, pre-oxygenated Ringer solution, and the pericardium and the atria are trimmed away. The left ventricle is opened and the two strongest papillary muscles removed. They are fixed between a suction electrode for electrical stimulation and a force transducer for registration of contractions. Initially, normal Ringer solution oxygenated with carbogen (95%O2/5%CO2) at a temperature of 36 °C is used. A standard micro electrode technique is applied to measure the action potential via a glass micro electrode containing 3 M KCl solution, which is inserted intracellularly. The papillary muscle is stimulated with rectangular pulses of 1 V and of 1 ms duration at intervals of 500 ms. The interval between two stimuli is variable in order to determine refractory periods. The intensity of the electrical current is just below the stimulation threshold. The intracellular action potential is amplified, differentiated for registration of upstroke velocity (Hugo Sachs micro electrode amplifier), together with the contraction force displayed on an oscilloscope (Gould digital storage oscilloscope OS 4000), and recorded (Gould 2400 recorder). After an incubation period of 30 min the Ringer solution is changed to the following composition containing 5 times more potassium and 10 % less sodium. NaCl 8,1 g/L KCl 1,0 g/L CaCl2 0,2 g/L NaHCO3 0,1 g/L glucose 5,0 g/L For further depolarization, isoproterenol (1.0 mg per 100 ml) is added. By this measure, resting potential is increased to about 40 mV, resulting in inactivation of the fast inward sodium channel. The resulting slow rising action potential is sensitive to calcium antagonistic drugs (Kohlhardt and Fleckenstein 1977). The test compound is added at a concentration of 1 μg/ml. Effective compounds are tested at lower concentrations and compared with the standard (nifedipin at concentrations of 0.01 and 0.1 μg/ml) EVALUATION The decrease of upstroke velocity is tested at various concentrations of the test compound and compared with the standard. A.4.2.2 Calcium Antagonism in the Isolated Guinea Pig Atrium ... PURPOSE AND RATIONALE k-Strophanthine (and other cardiac glycosides) inhibit the membrane-bound Na+/K+-activated ATP-ase which leads to an increase in intracellular Ca2+-concentration. Ca2+ ions activate the contractile apparatus, causing a distinctive enhancement of contractions. The procedure can be used to evaluate a compound’s calcium channel blocking activity by measuring its ability to decrease atrial contractions induced by k-strophanthine. PROCEDURE Apparatus HSE-stimulator 1 (Hugo Sachs Elektronik, D-79232 March-Hugstetten, Germany) Stimulation data: frequency 1.5Hz duration 3 ms voltage 3–8 V Experiment Guinea pigs of either sex weighing 200–500 g are sacrificed with a blow to the nape of the neck and exsanguinated. The left atrium is removed, placed in an organ bath and attached to an isotonic strain gauge, its base being wired to an electrode of the stimulator. The Ringer-solution is aerated with carbogen and kept at 36 °C. The atrium is continuously stimulated via stimulator 1, the voltage being slowly increased up to the threshold level. Contractions are recorded on a polygraph. Prior to drug administration, two prevalues are obtained by adding 2 μg/ml k-strophanthine-α (Cymarin) to the organ bath and measuring the increase in contractile force. Following a 15 min washout and recovery period, the test drug is added to the bath followed by administration of k-strophanthine-α 10 min later. The change in contractile force is always measured 10 min after the addition of k-strophanthine-α. Standard compounds: Verapamil hydrochloride Nifedipine EVALUATION The percent inhibition of k-strophanthine-α induced contraction is determined. MODIFICATIONS OF THE METHOD Calcium antagonists can also be evaluated in the LANGENDORFF heart preparation (Lindner and Ruppert 1982). Leboeuf et al. (1992) reported the protective effect of bepridil and flunarizine against veratrine-induced contracture in rat atria concluding from the results in this model that these agents may be more effective as L-type calcium ion-channel blockers in protecting against calcium overload during ischaemia and reperfusion injury. A.4.2.3 Calcium Antagonism in the Isolated Rabbit Aorta ... PURPOSE AND RATIONALE Contraction of aorta rings is induced by adding potassium chloride or norepinephrine to the organ bath containing slightly modified Krebs bicarbonate buffer. Test drugs with calcium channel blocking activity have a relaxing effect. PROCEDURE Rabbits of either sex weighing 3–4 kg are sacrificed with an overdose of pentobarbital sodium. The chest cavity is opened and the descending thoracic aorta (from the level of the aortic arch to the level of the diaphragm) is rapidly removed and placed in a beaker of oxygenated Krebs bicarbonate buffer at 37 °C. The content of magnesium and calcium is slightly diminished in the Krebs bicarbonate buffer resulting in the following composition: NaCl 118.4mMol KCl 4.7mMol KH2PO4 1.2mMol MgSO4 · 2H2O 1.2mMol CaCl2 · 2H2O 1.9mMol NaHCO3 25.0mMol dextrose 10.0mMol EDTA 0.013mMol The tissue is then transferred to a dish containing fresh oxygenated, warmed Krebs solution. Fat and loose connective tissue are carefully removed while keeping the tissue moist with the solution. Eight rings of 4–5 mm width are obtained and each is mounted in a 20 ml tissue bath which contains the oxygenated warmed Krebs solution. Initial tension is set at 1.0 g. The tissue is allowed to incubate over a period of 2 h, during which time the Krebs solution is changed every 15 min. Also during this time, tension is maintained at 1.0 g. Just prior to the end of the 2 h equilibration period, the Krebs solution is changed again and the tissue is allowed to stabilize at 1.0 g tension. A sustained contraction is then generated by addition of either 40 mM KCl or 2.9 × 10-3 mM norepinephrine. Twenty min after addition of the agonist, the test drug is added so that the final concentration in the bath is 1 × 10–5 M. The percent relaxation reading is taken 30 min after addition of the test drug. If at least 30%relaxation occurs, an accumulative concentration-relaxation curve is established. There is a 30 min period of time between the addition of each concentration of test compound. EVALUATION Active tension is calculated for the tissue at the time point just prior to the addition of the test compound and also at the point 30 min after the addition of each concentration of test compound. Active tension is defined as the difference between the generated tension and the baseline tension. The percent relaxation from the predrug, precontracted level is calculated for each concentration of test compound. A number of 5 experiments constitutes a dose range. An ID 50 is calculated by linear regression analysis. MODIFICATIONS OF THE METHOD Hof and Vuorela (1983) compared three methods for assessing calcium antagonism on rabbit aorta smooth muscle. Matsuo et al. (1989) reported a simple and specific screening method for Ca-entry blockers. In the presence of various Ca-channel blockers, 1 × 10−4MCa2+ causes relaxation of rat uterine smooth muscle that has been tonically contracted with oxytocin in calcium-free medium after prolonged preincubation with 3 mM EGTA. Micheli et al. (1990) used spirally cut preparations of rat aorta and rings of rabbit ear artery to test calcium entry blocker activity. Rüegg et al. (1985) described a smooth muscle cell line originating from fetal rat aorta to be suitable for the study of voltage sensitive calcium channels. Calcium channel antagonists inhibited both the basal and the potassium chloride stimulated 45Ca2+ uptake. A.4.2.4 Calcium Antagonism in the Isolated Guinea Pig Pulmonary Artery ... PURPOSE AND RATIONALE Contraction of the pulmonary artery is induced by changing the normal Tyrode solution in the organ bath against a potassium enriched solution. This contraction can be inhibited by calcium blockers. PROCEDURE The following solutions are used: Normal Tyrode solution [mMol] Potassium Enriched Tyrode solution [mMol] NaCl 135.0 89.0 KCl 3.7 50.0 MgSO4 0.81 0.81 NaH2PO4 0.41 0.41 NaHCO3 11.0 11.0 CaCl2 2.25 2.25 Glucose 5.6 5.6 Guinea pigs (Pirbright White strain) of either sex weighing 400–500 g are sacrificed by stunning. The pulmonary artery is removed and cut spirally at an angle of 45°. The resulting strip is cut to lengths of 2 cm and one piece is suspended in oxygenated normal Tyrode solution in an organ bath at 37 °C with a preload of 1 g. Contractions are registered with an isotonic strain transducer and recorded on a polygraph. After 1 h equilibrium time, normal solution is exchanged with potassium enriched Tyrode solution. The artery strip reacts with a contraction which achieves after 10 min 90–95 % of its maximum. After an additional 10 min, exchange to normal Tyrode solution is performed. Ten min later again a contraction is induced by potassium enriched solution. When the height of the contraction has reached a constant level, the test substance is added and again potassium induced contraction recorded. The height of the contraction is expressed as percent of initial potassium induced contraction. After lavage, the procedure is repeated with a higher dose or the standard. EVALUATION For calculation of a regression line, the decrease of contraction versus control after various doses is measured in mm. The percentage of inhibition after various doses is taken for calculation of an ED 50. A.4.3 In Vivo Methods A.4.3.1 Evaluation of Calcium Blockers in the Pithed Rat ... PURPOSE AND RATIONALE Using the cardioaccelerator response in pithed rats, calcium entry blockers can be distinguished from other agents which havemodes of action not involving direct blockade of calcium entry (Clapham 1988). PROCEDURE Male Sprague-Dawley rats (250–350 g) are anaesthetized with methohexitone sodium (50 mg/kg i.p.). Following cannulation of the trachea, the rats are pithed through one orbit with a stainless steel rod and immediately artificially respired with room air (78 strokes/min, 1 ml/100 g body weight) via a Palmer small animal respiration pump. A jugular vein is cannulated for administration of drugs. Arterial blood pressure is recorded from a carotid artery using a pressure transducer. Heart rate is derived from the phasic arterial pressure signal with a phase lock loop ratemeter (BRL Instrument Services). Both parameters are displayed on a recorder. The animals are kept warm by an incandescent lamp positioned about 25 cm above them. The pithing rod is withdrawn so that the tip lays in the thoracic portion of the spinal cord. All rats then receive (+)tubocurarine (1.5 mg/kg i.v.) and are bilaterally vagotomized. The cardioaccelerator response is obtained by continuous electrical stimulation of the thoracic spinal cord with square wave pulses of 0.5 ms duration, at supramaximal voltage at a frequency of 0.5Hz using the pithing rod as a stimulating electrode. An indifferent electrode is inserted subcutaneously in the femoral region. Only rats with a resulting tachycardia of more than 100 beats/min are included into the experiments. When the cardioaccelerator response has stabilized for about 3–5 min, cumulative intravenous doses of drug or corresponding vehicle are administered. Succeeding doses are given when the response to the previous dose has stabilized. Calcium antagonists and β-blockers inhibit dose-dependent the tachycardia elicited by electrical stimulation of the spinal cord, whereas lignocaine and nicorandil are not effective. Doses of β-blockers or calcium-antagonists, which reduce the tachycardia to 50 % are tested again. Three min after administration of the drug, calcium gluconate (1 mg/min) or water (0.1 ml/min) are infused using a Harvard apparatus compact infusion pump. The effects of calcium entry blockers, but not of β-adrenoreceptor blockers, are antagonized. EVALUATION The level of tachycardia immediately prior to drug administration is taken as 100 % and responses to drugs are expressed as a percentage of this predose tachycardia. If an inhibitory effect > 50 % is seen, then an ID 50 (with 95 % confidence limits) is interpolated from linear regression analysis. Significance of differences between the groups receiving calcium gluconate and their parallel vehicle controls is calculated by Student’s t-test. CRITICAL ASSESSMENT OF THE METHOD Differentiation between the effects of β-blockers and calcium-antagonists can be achieved in a relatively simple in vivo model. A.5 Anti-Arrhythmic Activity ... A.5.0.1 General Considerations Guidelines for the study of arrhythmias in man and animals regarding the experimental design as well as the classification, quantification, and analysis were given as the Lambeth Conventions by Walker et al. (1988). ... ... Classification Anti-arrhythmic drugs have been classified into various groups and subgroups (Vaughan Williams 1970, 1975, 1984, 1988, 1991, 1992; Borchard et al. 1989; Frumin et al. 1989; Harumi et al. 1989; Colatsky and Follmer 1990; Podrid 1990; Coromilas 1991; Nattel 1991; Rosen and Schwartz 1991; Scholz 1991; Woosley 1991; Ravens 1992; Sanguinetti 1992; Grant 1992; Nattel 1993; Scholz 1994). This classification is based on electrophysiological effects (e. g., action potential) and on interaction with membrane receptors and ion channels. The heterogeneity of classification criteria resulted in vivid discussions (The Sicilian Gambit 1991; Vaughan Williams 1991, 1992). In particular, a clinical study (CAST investigators 1990) challenged the therapeutic value of some anti-arrhythmic drugs. Weirich and Antoni (1990, 1991) proposed a subdivision of class-1-anti-arrhythmic drugs according to the saturation behavior of frequency-dependent block and its onset-kinetics. Class I anti-arrhythmic drugs directly alter membrane conductance of cations, particularly those of Na+ and K+. They reduce upstroke velocity, V max, of the cardiac action potential by blockade of the fast Na+ channel. This leads to a depression of conduction velocity, a prolongation of the voltage- and time-dependent refractory period and an increase in the threshold of excitability in cardiac muscle. Class I anti-arrhythmic drugs are subclassified according their effect on the action potential duration. Class IA anti-arrhythmic drugs (Quinidine-like substances, e. g., disopyramide, procainamide, ajmaline) lengthen the action potential duration which is reflected in the ECG as lengthening of the QT-interval. This effect is added to that on fast sodium channel resulting in delayed recovery from inactivation. Class IB anti-arrhythmic drugs (lidoacaine-like drugs, e. g., mexiletine, phenytoin, tocainide), in contrast, shorten the action potential duration. Class IC anti-arrhythmic drugs (e. g., encainide, flecainide, propafenone, indecainide) produce quinidine- and lidocaine-like effects and exert differential actions on the duration of action potential in Purkinje fibres (shortening) and ventricular muscle. Class II anti-arrhythmic drugs are β-adrenergic antagonists. They exert their anti-arrhythmic effects by antagonizing the electrophysiological effects of catecholamines which are mainly mediated by an increase in slow calcium inward current. Class III anti-arrhythmic drugs (e. g., amiodarone, bretylium, sotalol) prolong the action potential and lead to a corresponding increase in the effective refractory period. The action is mainly due to a block of outward repolarizing currents. However, activation of sodium and calcium inward currents that prolong the plateau of the action potential may also be involved. Class IV anti-arrhythmic drugs (e. g., verapamil, diltiazem) are slow calcium channel blockers suppressing the slow calcium inward current and calcium-dependent slow action potentials. Experimentally Induced Arrhythmias Winslow (1984) reviewed the methods for the detection and assessment of antiarrhythmic activity. Szekeres (1979) suggested a rational screening program for the selection of effective antiarrhythmic drugs. Arrhythmia models in the rat were reviewed by Cheung et al. (1993). Arrhythmogenic stimuli can be divided into three groups: chemical, electrical and mechanical (Szekeres and Papp 1975;Wilson 1984). Chemically Induced Arrhythmias A large number of chemical agents alone or in combination are capable of inducing arrhythmias. Administration of anesthetics like chloroform, ether, halothane (sensitizing agents) followed by a precipitating stimulus, such as intravenous adrenaline, or cardiac glycosides (usually ouabain), aconitine, and veratrum alkaloids cause arrhythmias. The sensitivity to these arrhythmogenic substances differs among various species. Electrically Induced Arrhythmias The possibilities to produce arrhythmias by electrical stimulation of the heart and the difficulties for evaluation of anti-arrhythmic drugs by this approach have been discussed by Szekeres (1971). Serial electrical stimulation result in flutter and fibrillation and it is possible to reproduce some of the main types of arrhythmias of clinical importance. The flutter threshold or the ventricular multiple response threshold may be determined in anesthetized dogs before or after the administration of the test drug. Mechanically Induced Arrhythmias Arrhythmias can be induced directly by ischemia or by reperfusion. After ischemia either by infarction or by coronary ligation several phases of arrhythmias are found. The two stage coronary artery ligation technique described by Harris (1950) focuses on late arrhythmias. Curtis and Walker (1988) examined seven scores in an attempt to validate the use of arrhythmia scores in an in vivo model of conscious rats. The influence on reperfusion arrhythmias can be tested in various species, e g., rat, pig, dog and cat (Bergey et al. 1982;Winslow 1984; Curtis et al. 1987; Brooks et al. 1989). A.5.0.2 Electrocardiography in Animals ... PURPOSE AND RATIONALE Recording of the electrocardiogram is an essential tool in the evaluation of anti-arrhythmic drugs (Johnston et al. 1983; Curtis and Walker 1986; Adaikan et al. 1992). Similar to the heart rate, the electrocardiogram is different between various species (Bazett 1920; Kisch 1953; Heise and Kimbel 1955; Beinfield and Lehr 1968; Budden et al. 1981; Driscoll 1981; Osborn 1981; Hayes et al. 1994). Many authors used the bipolar lead II between right foreleg and left hindleg, which is in line with the neutrally placed heart. Additionally, lead I (between right and left foreleg) stated to lie in the axis of the horizontal heart, and lead III (between left foreleg and left hindleg) in line with the vertical heart, may be used as well as unipolar leads (usually designed as V1 to V6) and the unipolar leads designed as aVL, aVR, and aVF. Out of several species being used the procedure for rats (Penz et al. 1992; Hayes et al. 1994) is described. PROCEDURE Male Sprague Dawley rats weighing 250–300 g are anesthetized by intraperitoneal injection of 60 mg/kg pentobarbitone. The right jugular vein is cannulated for injections, while the left coronary artery is cannulated for recording blood pressure on a polygraph. The ECG is recorded using a Lead type II of configuration along the anatomical axis of the heart as determined by palpation. ECGs are recorded at a standard chart speed of 100 mm/s on a polygraph and simultaneously on a storage oscilloscope. Measurements of intervals are made on the chart recorder and from the memory trace of the monitor. Since in the rat it is difficult to detect a T-wave that corresponds exactly with the T-wave seen in other species (Beinfeld and Lehr 1968; Driscoll 1981; Surawicz 1987) T-wave calculations are made on the basis of the repolarization wave that follows the QRS complex. The following variables are measured: σ T = time for the depolarization wave to cross the atria, P-R interval, QRS interval, Q-T interval, and RSh (the height between the peak of R and S wave). The RSh magnitude is taken as a measure of the extent of S-wave depression as exerted by class I sodium channel blocking antiarrhythmics. EVALUATION Statistical analyses are based on ANOVA followed by Duncan’s test for differences of means. In order to demonstrate the relationships between and drug effects, standard cumulative dose-response curves are constructed. MODIFICATIONS OF THE METHOD Osborne (1973, 1981) described a restraining device facilitating electrocardiogram recording in conscious rats. Curtis and Walker (1986), Johnston et al. (1983) studied the responses to ligation of a coronary artery and the actions of antiarrhythmics in conscious rats. Hayes et al. (1994) studied the ECG in guinea pigs, rabbits and primates. Stark et al. (1989) described an epicardic surface and stimulation technique (SST-ECG) in Langendorff perfused guinea pig hearts. Epicardial His bundle recordings in the guinea pig in vivo were described by Todt and Raberger (1992). Chronic recording from the His bundle in awake nonsedated dogs was reported by Karpawich et al. (1983) and by Atlee et al. (1984). Van de Water et al. (1989) reported a formula to correct the QT interval of the electrocardiogram in dogs for changes in heart rate. Wu et al. (1990) described a dual electrophysiologic test for atrial anti-reentry and ventricular antifibrillatory studies in anesthetized dogs. The reentry portion of the model was created surgically by a Y-shaped crushing around the tissue between the superior and inferior vena cava and tissue parallel to the AV groove. The pacing induced tachycardia that results from circus movements around the tricuspid ring was very persistent in duration and regular in cycle length. The antifibrillatory activities were assessed by determination of the ventricular fibrillation threshold using a trainstimuli method. Weissenburger et al. (1991) developed an experimental model of the long QT syndrome in conscious dogs for screening the bradycardia-dependent proarrhythmic effects of drugs and for studying the electrophysiology of “torsades de pointes.” Bauer et al. (2004) described pro- and antiarrhythmic effects of fast cardiac pacing in a canine model of acquired long QT syndrome. Holter monitoring in conscious dogs was described by Krumpl et al. (1989a, b). Coker (1989) recommended the anesthetized rabbit as a model for ischemia- and reperfusion-induced arrhythmias. Baboons and monkeys (Macaca sp.) were used by Adaikan et al. (1992). A.5.0.3 Aconitine Antagonism in Rats ... PURPOSE AND RATIONALE The plant alkaloid aconitine persistently activates sodium channels. Infusion of aconitine in the anesthetized rat causes ventricular arrhythmias. Drugs considered to have anti-arrhythmic properties can be tested in aconitine-intoxicated rats. PROCEDURE Male Ivanovas rats weighing 300–400 g are used. The animals are anesthetized by intraperitoneal injection of 1.25 g/kg urethane. Five μg/kg aconitine dissolved in 0.1 N HNO3 is administered by continuous infusion into the saphenous vein of 0.1 ml/min and the ECG in lead II is recorded every 30 seconds. The test compound is injected orally or intravenously at a screening dose of 3 mg/kg 5 min before the start of the aconitine infusion. Eight–ten animals are used per compound. EVALUATION The anti-arrhythmic effect of a test compound is measured by the amount of aconitine/100 g animal (duration of infusion) which induces ventricular extrasystoles ventricular tachycardia ventricular fibrillation and death. Higher doses of aconitine in the treated group as compared to an untreated control group are an indication of anti-arrhythmic activity. Statistical significance between the groups is assessed by the Student’s t-test. The scores are allotted for the intensity and the duration of the effect relative to the efficacy of standard compounds. Standard data: Procainamid, 5 mg/kg i.v. and lidocaine, 5 mg/kg, i.v. lead to an increase in LD 100 by 65 % (corresponds to LD 100 of approximately 9 μg/100 g). CRITICAL ASSESSMENT OF THE METHOD Aconitine – antagonism in vivo has been proven as a valuable screening method for anti-arrhythmic activity. MODIFICATIONS OF THE METHOD Scherf (1947) studied the auricular tachycardia caused by aconitine administration in dogs. Scherf et al. (1960) provoked atrial flutter and fibrillation in anesthetized dogs by application of a few crystals of aconitine or delphinine to the surface of the right atrium in the appendix area near the head of the sinus node. Mc Leod and Reynold (1962) induced arrhythmia by aconitine in the isolated rabbit atrium. Nwangwu et al. (1977) used aconitine as arrhythmogenic agent for screening of anti-arrhythmic agents in mice. Yamamoto et al. (1993) used urethane-anesthetized rats under artificial respiration with tubocurarine pretreatment. After thoracotomy and incision of the pericardium, a piece of filter paper soaked with aconitine solution was applied to the right atrium. Test drugs were applied by continuous i.v. infusion. In addition to ECG lead II, intra-atrial ECG was monitored. Aconitine-antagonism in conscious mice as screening procedure has been recommended by Dadkar and Bhattacharya (1974) and in anesthetized mice by Winslow (1980). Nakayama et al. (1971) described the topical application of aconitine in a small cup placed on the right atrium of dogs to induce supraventricular arrhythmias. A method using the cat has been developed by Winslow (1981). Other Arrhythmogenic Agents In addition to the aconitine model Vaille et al. (1992) demonstrated the selectivity of a CaCl2 continuous infusion screening method in rats for the evaluation of antiarrhythmic calcium antagonists. A mouse chloroform model was recommended by Lawson (1968). Vargaftig et al. (1969) induced ventricular fibrillation in mice by inhalation of chloroform. Papp et al. (1967) proposed the experimental BaCl2-arrhythmia as a quantitative assay of anti-arrhythmic drugs. Al-Obaid et al. (1998) used calcium chloride-induced arrhythmias for anti-arrhythmic activity evaluation in anesthetized male rats. Cardiac arrhythmias were induced by a single intravenous injection of 10 % CaCl2 (50 mg/kg). The induced arrhythmias were then analyzed for magnitude of initial bradycardia, onset, incidence and duration of the induced fibrillations. After the induction of the arrhythmia, the animal was allowed to recover completely (15–20 min) and the test compound was injected in different doses intravenously. The effect of the test compound on the basal heart rate was then examined and the percentage change in the heart rate was calculated. Seven min later, the arrhythmogenic dose of CaCl2 was readministered and the effect of the treatment on the induced arrhythmia parameters was evaluated as percentage change in the measured parameters or as protection or non-protections against the induced fibrillations. Tripathi and Thomas (1986) described a method for the production of ventricular tachycardia in the rat and guinea pig by exposing the animals to benzene vapors for 2 min followed by an intravenous adrenaline injection. Arrhythmias could be induced by changing the medium of cultured rat heart muscle cells (Wenzel and Kloeppel 1978). In isolated rat hearts ventricular fibrillation was induced by isoprenaline and a catechol-O-methyl transferase inhibitor at high perfusion temperature (Sono et al. 1985). Takei (1994) described experimental arrhythmia in guinea pigs induced by grayanotoxin-I, a biologically active diterpenoid from the plant family of Ericaceae. A.5.0.4 Digoxin-Induced Ventricular Arrhythmias in Anesthetized Guinea Pigs ... PURPOSE AND RATIONALE Overdose of cardiac glycosides, such as digoxin, induces ventricular extrasystoles, ventricular fibrillation, and finally death. The occurrence of these symptoms can be delayed by anti-arrhythmic drugs. PROCEDURE Male guinea pigs (Marioth strain) weighing 350–500 g are anesthetized with 35 mg/kg pentobarbital sodium intraperitoneally. Trachea, one jugular vein and one carotid artery are catheterized. Positive pressure ventilation is applied with a respiratory pump (Rhema GmbH, Germany) at 45 breaths/min. The carotid artery is used for monitoring systemic blood pressure via a pressure transducer. Digoxin is infused into the jugular vein with a perfusion pump (ASID BONZ PP 50) at a rate of 85 μg/kg in 0.266 ml/min until cardiac arrest. The electrocardiogram (lead III) is recorded with subcutaneous steel-needle electrodes (Hellige 19). Treated groups (n = 5–10 animals) receive the test drug either orally 1 h or intravenously 1 min prior to the infusion. The control group (n = at least 5 animals) receives the digoxin infusion only. The period until the onset of ventricular extrasystoles, ventricular fibrillation, and cardiac arrest is recorded. The total amount of infused digoxin (μg/kg) to induce ventricular fibrillation is calculated. Standard drugs are lidocaine (3 mg/kg i.v.) or ramipril (1 mg/kg p.o.). EVALUATION Using Student’s t-test the doses of digoxin needed to induce ventricular extrasystoles, or ventricular fibrillation, or cardiac arrest, respectively, after treatment with anti-arrhythmic drugs are compared statistically with controls receiving digoxin only. ... A.5.0.5 Strophanthin or Ouabain Induced Arrhythmia ... PURPOSE AND RATIONALE Acute intoxication with the cardiac glycoside strophanthin K induces ventricular tachycardia and multifocal ventricular arrhythmias in dogs. This can be used as a test model to evaluate the effect of potential antiarrhythmic drugs on ventricular arrhythmias. PROCEDURE Male or female dogs of either sex weighing approximately 20 kg are used. The animals are anesthetized by intravenous injection of 30–40 mg/kg pentobarbital sodium. Two peripheral veins are cannulated for the administration of the arrhythmia-inducing substance (V. brachialis) and the test compound (V. cephalica antebrachii). For intraduodenal administration of the test drug, the duodenum is cannulated. Electrocardiogram is registered with needle electrodes from lead II. Heart frequency is derived from R-peaks of ECG. Two–three animals are used for one compound. Strophanthin K is administered by continuous i.v.-infusion at a rate of 3 μg/kg/min. Thirty–fourty min later, signs of cardiac glycoside intoxication appear leading to ventricular tachycardia or to multifocal ventricular arrhythmias. When this state is achieved, the strophanthin infusion is terminated. When the arrhythmias are stable for 10 min, the test substance is administered intravenously in doses between 1.0 and 5.0 mg/kg or intraduodenally in doses between 10 and 30 mg/kg. ECG II recordings are obtained at times: -0.5, 1, 2, 5 and 10 min following administration of test drug. For i.v. administration: A test compound is considered to have an anti-arrhythmic effect if the extrasystoles immediately disappear. If the test compound does not show a positive effect, increasing doses are administered at 15 min-intervals. If the test substance does reverse arrhythmias, the next dose is administered after the reappearance of stable arrhythmias. For i.d. administration: A test compound is considered to have a definite anti-arrhythmic effect if the extrasystoles disappear within 15 min. The test drug is considered to have “no effect” if it does not improve strophanthin intoxication within 60 min following drug administration. EVALUATION Evaluation of the therapeutic effect of a drug is difficult and somewhat arbitrary since there is no clear-cut correlation between effectiveness of a test compound and duration of its effect, i. e. return to normal ECGs. The standard drugs ajmaline, quinidine and lidocaine re-establish normal sinus rhythm at doses of 1 and 3 mg/kg (i.v.) and 10 mg/kg (i.d.). Arrhythmias are eliminated for 20 min (i.v.) and for > 60 min (i.d.) following drug administration. MODIFICATIONS OF THE METHOD Ettinger et al. (1969) used arrhythmias in dogs induced by ouabain to study the effects of phentolamine in arrhythmia. Garrett et al. (1964) studied the antiarrhythmic activity of N,N-diisopropyl-N’-diethylaminoethylurea hydrochloride in anesthetized dogs with arrhythmias induced by ouabain, aconitine or acetylcholine. Furthermore, ultra-low frequency ballistocardiograms with ECG registration were performed in dogs. Raper and Wale (1968) studied the effects on ouabain- and adrenaline-induced arrhythmias in cats. Kerr et al. (1985) studied the effects of a vasodilator drug on ouabain-induced arrhythmias in anesthetized dogs. A modified method for the production of cardiac arrhythmias by ouabain in anesthetized cats was published by Rao et al. (1988). Brooks et al. (1989) infused ouabain intravenously to guinea pigs and determined the onset of ventricular extrasystoles and of fibrillation. Thomas and Tripathi (1986) studied the effects of α-adrenoreceptor agonists and antagonists with different affinity for α 1- and α 2-receptors on ouabain-induced arrhythmias and cardiac arrest in guinea pigs. Krzeminski (1991) and Wascher et al. (1991) used of ouabain-induced arrhythmia in guinea pigs for the evaluation of potential antidysrhythmic agents. Al-Obaid et al. (1998) used ouabain-induced arrhythmias in anesthetized Wistar rats for evaluation of cyclopenteno[b]thiophene derivatives as antiarrhythmic agents. A.5.0.6 Ventricular Fibrillation Electrical Threshold ... PURPOSE AND RATIONALE The use of anti-arrhythmic drugs in the treatment of ventricular arrhythmias aims to prevent the development of ventricular fibrillation. Several electrical stimulation techniques have been used to measure ventricular fibrillation threshold such as single pulse stimulation, train of pulses stimulation, continuous 50-Hz stimulation and sequential pulse stimulation. PROCEDURE Adult dogs weighing 8–12 kg are anesthetized with sodium pentobarbital (35 mg/kg) and ventilated with air using a Harvard respiratory pump. Systolic arterial pressure is monitored and body temperature maintained by a thermal blanket. The chest is opened by a midline sternotomy and the heart suspended in a pericardial cradle. The sinus node is crushed and a 2.0 mm diameter Ag-AgCl stimulating electrode is embedded in a Teflon disc sutured to the anterior surface of the left ventricle. The heart is then driven by 3-ms square anodal constant current pulses for 400 ms of the basic cycle and is prematurely stimulated by one 3-ms test stimulus through the driving electrode. Electrical stimulation is programmed by a digital stimulator. A recording electrode is placed on the surface of each ventricle. A silver plate is implanted under the skin in the right femoral region as indifferent electrode. Lead II of the body surface electrocardiogram is monitored. To determine ventricular fibrillation threshold (VFT), a 0.2- to 1.8-second train of 50-Hz pulses is delivered 100 ms after every eighteenth basic driving stimulus. The current intensity is increased from the diastolic threshold in increments of 10 μA to 1.0 mA or until ventricular fibrillation occurs. The minimal current intensity of the pulse train required to induce sustained ventricular fibrillation is defined as the VFT. When ventricular fibrillation occurs, the heart is immediately defibrillated and allowed to recover to control conditions for 15 to 20 min. Anti-arrhythmic drugs are administered through the femoral vein. EVALUATION Ventricular fibrillation threshold (VFT) is determined before and after administration of test drugs at given time intervals. The mean values of 10 experiments are compared using Student’s t-test. MODIFICATIONS OF THE METHOD Marshall et al. (1981) and Winslow (1984) suggested to determine VFT in the pentobarbitone anesthetized rat. Wu et al. (1989) recommended a conscious dog model for re-entrant atrial tachycardia. Wu et al. (1990) described a dual electrophysiologic test for atrial anti-re-entry and ventricular antifibrillatory studies in dogs. The re-entry portion of the model was created surgically by a Y-shaped crushing around the tissue between the superior and inferior vena cava and tissue parallel to the AV groove. The antifibrillatory activities were assessed by determination of the ventricular fibrillation threshold using a train-stimuli method. A chronically prepared rat model of electrically induced arrhythmias was described by Walker and Beatch (1988). A.5.0.7 Coronary Artery Ligation, Reperfusion Arrhythmia and Infarct Size in Rats ... PURPOSE AND RATIONALE Coronary artery ligation in anesthetized rats results in arrhythmias and myocardial infarction. Following occlusion of the left main coronary artery, very marked ventricular dysrhythmias occur. Electrocardiogram is recorded during ligation and subsequent reperfusion. The amount of infarcted tissue is measured by means of p-nitro-blue tetrazolium chloride-staining in myocardial sections. The model is used to test drugs with potential anti-arrhythmic activities. PROCEDURE Groups of 8–10 male Sprague–Dawley rats weighing 350–400 g are used. The animals are anesthetized by intraperitoneal injection of 60 mg/kg pentobarbital sodium. The trachea is intubated to allow artificial ventilation (Starling pump). A catheter is placed in an external jugular vein for administration of test compounds. Peripheral blood pressure is recorded from the common carotid artery using a pressure transducer and a polygraph. The chest is opened by left thoracotomy at the forth intercostal space. After opening the pericard, the heart is exteriorized by gentle pressure on the chest walls and a thin silk thread (Ethicon 1.5 metric, 4–0) attached to an atraumatic needle is placed around the left coronary artery about 2–3 mm distal of the origin of the left coronary artery for later ligation. From that point on, the animal is ventilated with room air using a stroke volume of 1 ml/100 g body weight at a rate of 54 strokes/min. The heart is then placed back in the chest cavity. Any animal in which this procedure itself produces dysrhythmias or a sustained fall in mean arterial blood pressure to less than 70 mm Hg has to be discarded from the study. After an equilibration time of approx. 45 min, the test substance or the vehicle (control) is administered by intravenous injection. Five min later, the ligature at the left coronary artery is closed either for 15 or 90 min (in case infarct-size is assessed) and subsequently reperfused for 30 min. For oral application, the test compounds are dissolved or suspended in the vehicle 30 min before occlusion. Peripheral blood pressure and ECG lead II are recorded continuously during the whole experiment. Rectal temperature is maintained at 38 °C. The numbers of ventricular premature beats (VPB), ventricular tachycardia (VT) and ventricular fibrillation (VF) are counted in the occlusion and reperfusion periods and evaluated according to the guidelines of the Lambeth Convention (Walker et al. 1988). Preparation to Determine Infarct Size At the end of the reperfusion period, the animal is sacrificed with an overdose of pentobarbital sodium, the heart is dissected and cut into transversal sections (approx. 1 mm thick) from the apex to the base. The slices are stained with p-nitro-blue tetrazolium chloride solution (0.25 g/L p-nitro-blue tetrazolium chloride in Sorensen phosphate buffer, containing 100 mM D, L-maleate) in order to visualize the infarct tissue (blue/violet-stained healthy tissue, unstained necrotic tissue). The slices are photographed on color transparency film for the determination of infarct area. Left ventricle and infarct area are measured by planimetry from projections of all slices with the exclusion of the apex and the slice containing the ligature. EVALUATION The following parameters are evaluated: mortality hemodynamics – peripheral blood pressure [mm Hg] – heart rate [beats/min] – pressure rate index (PRI) (BPs × HR) [mm Hg × beats/1000] arrhythmias – ventricular extrasystoles (= premature ventricular contractions) (PVC) – percent animals with PVC – number of PVC/5 or 30 min – ventricular tachycardia (VT) (VT defined as any run of seven or more consecutive ventricular extrasystoles) – percent animals with VT – duration [s] of VT/5 or 30 min – ventricular fibrillation (VF) – percent animals with VF – duration [s] of VF/5 or 30 min infarct size (area) The different characteristics are evaluated separately and compared with a positive control (5 mg/kg nicainoprol i.v.). Changes of parameters in drug-treated animals are compared to vehicle control values. Statistical significance is assessed by the Student’s t-test. MODIFICATIONS OF THE METHOD Leprán et al. (1983) placed a loose silk loop around the left coronary artery and passed the thread through a cylinder shaped polyethylene tube outside the thorax. The rats were allowed to recover from primary surgery. The loose ligature was tightened 7–10 days thereafter and arrhythmias recorded by ECG tracings. Johnston et al. (1983) described the responses to ligation of a coronary artery in conscious rats and the actions of anti-arrhythmics. As reported in Sect. A.3.1.2 and A.3.1.3, the isolated heart according to LANGENDORFF and the isolated working rat heart preparation can be used for ligation experiments inducing arrhythmias. Lubbe et al. (1978) reported ventricular arrhythmias associated with coronary artery occlusion and reperfusion in the isolated perfused rat heart as a model for assessment of anti-fibrillatory action of anti-arrhythmic agents. Bernier et al. (1986) described reperfusion-induced arrhythmias in the isolated perfused rat heart. The isolated rat heart was perfused according the LANGEN- DORFF-technique. A ligature was placed around the left anterior descending coronary artery close to its origin. The arterial occlusion was maintained for 10 min followed by reperfusion. Test compounds were included in the perfusion medium. With epicardial ECG- electrodes the number of premature ventricular complexes, the incidence and duration of ventricular fibrillation, and the incidence of ventricular tachycardia were recorded. Abraham et al. (1989) tested antiarrhythmic properties of tetrodotoxin against occlusion-induced arrhythmias produced by ligation of the left anterior descending coronary artery in the rat. MacLeod et al. (1989) tested a long acting analogue of verapamil for its actions against arrhythmias induced by ischemia and reperfusion in conscious and anesthetized rats, as well as for effects on epicardial intracellular action potentials. Harper et al. (1993) found that the inhibition of Na+/H+ exchange preserves viability, restores mechanical function, and prevents the pH paradox in reperfusion injury to rat neonatal myocytes. Scholz et al. (1993, 1995) reported protective effects of HOE642, a selective sodium-hydrogen exchange subtype 1 inhibitor, on cardiac ischaemia and reperfusion in rats. Likewise, Yasutake et al. (1994) found protection against reperfusion-induced arrhythmias in rats by intracoronary infusion of a Na+/H+ exchange inhibitor. Aye et al. (1997) tested the effects of a Na+/H+ exchange inhibitor on reperfusion ventricular arrhythmias in rat hearts. Ferrara et al. (1990) studied the effect of flecainide acetate on reperfusion- and barium-induced ventricular tachyarrhythmias in the isolated perfused rat heart by monitoring heart rate, coronary flow rate, left ventricular systolic pressure, dp/dt max, and the voltage of the epicardial electrogram. Heterogeneity of ventricular remodeling after acute myocardial infarction in rats has been reported by Capasso et al. (1992). Bellemin-Baurreau et al. (1994) described an in vitro method for evaluation of antiarrhythmic and antiischemic agents by using programmed electrical stimulation of the isolated rabbit heart after ligation of the left ventricular branch of the coronary artery and a reperfusion period of 15 min. The use of the rat in models for the study of arrhythmias in myocardial ischemia and infarction has been reviewed by Curtis et al. (1987). Black and Rodger (1996), Black (2000) reviewed the methods used to study experimental myocardial ischemic and reperfusion injury in various animal species. Linz et al. (1997) reported that in isolated rat hearts with ischemia-reperfusion injuries, perfusion with bradykinin reduces the duration and incidence of ventricular fibrillations, improves cardiodynamics, reduces release of cytosolic enzyme, end preserves energy-rich phosphate and glycogen stores. Mulder et al. (1998) studied the effects of chronic treatment with calcium antagonists in rats with chronic heart failure induced by coronary artery ligation. The effect of antihypertensive agents on cardiac and vascular remodelling was discussed by Mallion et al. (1999). A.5.0.8 Ventricular Arrhythmia After Coronary Occlusion A.5.0.8.1 Ventricular Fibrillation After Coronary Occlusion and Reperfusion in Anesthetized Dogs PURPOSE AND RATIONALE Coronary artery occlusion in anesthetized dogs is accompanied by an increase in heart rate, heart contractility, left ventricular end-diastolic pressure, and blood pressure as well as by ventricular arrhythmias. During a subsequent reperfusion period, a high percentage of control animals die from ventricular fibrillation. Drugs with potential protective effects are tested which reduce both hemodynamic and electrical changes. PROCEDURE Dogs of either sex weighing 20–25 kg are used. Anesthesia is induced by intravenous injection of 30 mg/kg thiobutobarbital sodium and maintained by i.v. administration of 20 mg/kg chloralose and 250 mg/kg urethane followed by subcutaneous administration of 2 mg/kg morphine. The animals are placed in the right lateral position. Respiration is maintained through a tracheal tube using a positive pressure respirator (Bird Mark 7). A peripheral vein (saphenous vein) is cannulated for the administration of test compound. The ECG is recorded continuously in lead II (Einthoven). Preparation for Hemodynamic Measurements For recording of peripheral systolic and diastolic blood pressure, the cannula of a femoral artery is connected to a pressure transducer (Statham P 23 DB). For determination of left ventricular pressure (LVP), a Millar microtip catheter (PC 350) is inserted via the left carotid artery. Left ventricular end-diastolic pressure (LVEDP) is measured on a high-sensitivity scale; heart rate (HR) is determined from the LVP wave form. Myocardial contractility is measured as the rate of rise of LVP(dp/dt max). The sum of ST-segment elevations is calculated from five values of the peripheral limbs in ECG lead II. The pressure-rate index (PRI = BPs × HR) serves as a measure of oxygen consumption. Experimental Course The heart is exposed through a left thoracotomy between the fourth and fifth intercostal space, the pericard is opened and the left anterior descending coronary artery (LAD) is prepared. A silk suture is placed around the LAD, just below the first diagonal branch. After an equilibration period of approx. 45 min., the test substance or the vehicle (controls) is administered as an intravenous bolus. Twenty min later, the ligature at the coronary artery is closed for 90 min. During the occlusion period, the test compound or the vehicle (controls) are given by continuous infusion. After release of the coronary obstruction, the animal is monitored for a 30 min reperfusion period. All parameters are recorded during the whole experiment. At the end of the test, surviving animals are sacrificed by an overdose of pentobarbital sodium. EVALUATION The following parameters are evaluated: mortality hemodynamics arrhythmias – ventricular extrasystoles ( = premature ventricular contractions) (PVC) – percent animals with PVC – number of PVC/5 or 30 min – ventricular tachycardia (VT) (VT defined as any sequence of seven or more consecutive ventricular extrasystoles) – duration [s] of VT/5 or 30 min – ventricular fibrillation (VF) – percent animals with VF The different characteristics are evaluated separately. Changes of parameters in drug-treated animals are compared to vehicle controls. Statistical significance of the differences is calculated by means of the Student’s t-test. Standard data: Mortality: In an representative experiment, 10 out of 12 of control animals died from ventricular fibrillation during the 30 min reperfusion period. One out of 8 molsidomine-treated animals died and the death was also from ventricular fibrillation during the reperfusion phase. (Molsidomine was given as a continuous infusion of 0.5 mg/kg/ml/min during the occlusion period; controls received saline). MODIFICATIONS OF THE METHOD Varma and Melville (1963) described ventricular fibrillation induced by coronary occlusion during hypothermia in dogs. Wilkerson and Downey (1978) described a technique for producing ventricular arrhythmias in dogs through coronary occlusion by an embolus (glass beads) being introduced into the coronary circulation via a rigid cannula which is inserted through the carotid artery. Weissenburger et al. (1991) described a model in dogs suitable for screening the bradycardia-dependent proarrhythmic effects of drugs and for studying the electrophysiology of “torsades de pointes”. Coker (1989) recommended the anesthetized rabbit as a model for ischemia- and reperfusion-induced arrhythmias. Thiemermann et al. (1989) described a rabbit model of experimental myocardial ischemia and reperfusion. Drugs were administered by intravenous infusion 5 min after the occlusion of the left anterior-lateral coronary artery and continued during the 60 min occlusion and subsequent 3 h reperfusion periods. Hendrikx et al. (1994) reported that the Na+-H+ exchange inhibitor HOE 694 improves post-ischemic function and high-energy phosphate resynthesis and reduced Ca2+ overload in the isolated perfused rabbit heart. Barrett et al. (1997) described a method of recording epicardial monophasic action potentials and is chemia-induced arrhythmias following coronary artery ligation in intact rabbits. Naslund et al. (1992) described a closed chest model in pigs. Occlusion was induced in pentobarbitone anesthetized, mechanically ventilated pigs by injection of a 2 mm ball into a preselected coronary artery. Reperfusion was achieved by retraction of the ball via an attached filament. D’Alonzo et al. (1994) evaluated the effects of potassium channel openers on pacing- and ischemia- induced ventricular fibrillation in anesthetized pigs. Sack et al. (1994) described the effects of a Na+/H+ antiporter inhibitor on post-ischemic reperfusion in pig heart. Premaratne et al. (1995) used a baboon open chest model of myocardial ischemia and reperfusion. Baboons underwent occlusion of the left anterior descending coronary artery for 2 h. Fifteen min after occlusion, the treated group received hyaluronidase i.v. over a 10-min period. The ischemic period was followed by 22 h of reperfusion. At the end of the reperfusion period, the hearts were excised and the perfusion bed at risk for infarction was determined by infusion of a microvascular dye. A.5.0.8.2 Harris Dog Model of Ventricular Tachycardia PURPOSE AND RATIONALE In 1950, Harris found that the mortality in dogs after coronary occlusion with a 2-stage ligation procedure was lower than with 1-stage ligation. The left descending coronary artery is partially occluded for 30 min after which time total ligation is performed. Under these conditions arrhythmias develop within 4–7 h, reach a peak between 24 and 48 h and abate within 3–5 days. PROCEDURE Surgical Procedure Dogs of either sex are anesthetized by intravenous injection of methohexitone sodium (10 mg/kg), an endotracheal tube is inserted, and anesthesia maintained with halothane. The heart is exposed through an incision in the fourth or fifth intercostal space. The anterior descending branch of the left coronary artery is dissected free below its second branch and ligated in two stages. Two ligatures are placed around the artery and a 21 gauge needle. The first ligature is tied round the artery and the needle, which is then removed. Thirty min later, the second ligature is tied tightly round the artery. The chest is closed in layers 30 min after the second ligature has been tied, and the dog is allowed to recover. Test Procedure Further observations are made when the dogs are conscious, e. g., 22–24 h after ligation of the coronary artery. The dogs are positioned to lie on their side and remain in this position throughout the experiment. Mean blood pressure is recorded from a catheter placed in the femoral artery. Lead II and aVL of the electrocardiogram and blood pressure are continuously recorded for a control period of 30 min before and during drug administration. Drugs are administered either by injection or by continuous infusion via a hind leg vein. EVALUATION The number of sinus and ectopic beats are counted for each successive 5-min period. Beats with a distinct P wave preceding a mean frontal QRS vector of normal duration are counted as sinus in origin; all others are denoted as ectopic. MODIFICATIONS OF THE METHOD The model which resembles late arrhythmias occurring in postinfarction patients has been used with modifications by many authors (e. g., Kerr et al. 1985; Reynolds and Brown 1986;Gomoll 1987;Garthwaiteetal. 1989; Krumpl et al. 1989a, b; Trolese-Mongheal et al. 1985, 1991; Spinelli et al. 1991). Methods for producing experimental complete atrioventricular block in dogs were described and reviewed by Dubray et al. (1983) and by Boucher and Duchene-Marullaz (1985). A.5.0.8.3 Protection against Sudden Coronary Death PURPOSE AND RATIONALE The group of Lucchesi described an experimental dog model to test protection against sudden coronary death (Patterson et al. 1982; Uprichard et al. 1989a, b; Chi et al. 1990a, b, 1991; Kitzen et al. 1990; Black et al. 1991, 1993). Surgical Preparation Purpose-bred male mongrel dogs weighing 14–22 kg are anesthetized with 30 mg/kg pentobarbital i.v. The dogs are ventilated with room air through a cuffed endotracheal tube and a Harvard respirator. A cannula is inserted in the left external jugular vein. A left thoracotomy is performed between the fourth and fifth ribs, and the heart is exposed and suspended in a pericardial cradle. The left anterior descending coronary artery (LAD) is isolated at the tip of the left atrial appendage, and the left circumflex coronary artery (LCX) is isolated ~1 cm from its origin. After a 20-gauge hypodermic needle has been placed on the LAD, a ligature is tied around the artery and the needle. The needle is then removed, resulting in critical stenosis of the vessel. The LAD is perfused for 5 min in the presence of the critical stenosis. Ischemic injury of the anterior ventricular myocardium is achieved by 2-h occlusion of the LAD by a silicon rubber snare. The vessel is reperfused after 2 h in the presence of the critical stenosis. During the period of LAD reperfusion, an epicardial bipolar electrode (1-mm silver posts, 3- mm interelectrode separation) is sutured on the left atrial appendage for subsequent atrial pacing. A bipolar plunge electrode (25-gauge stainless steel, 5 mm long, 3 mm separation) is sutured on the interventricular septum, adjacent to the occlusion site and overlying the right ventricular outflow tract (RVOT). Two similar stainless steel bipolar plunge electrodes are sutured to the left ventricular (LV) wall: one at the distribution of the LAD distal to the occlusion (infarct zone, IZ), and the second in the distribution of the LCX (non-infarct zone, NZ). A 30-gauge silver-coated copper wire electrode is passed through the wall and into the lumen of the LCX and sutured to the adjacent surface of the heart. Silver disc electrodes are implanted subcutaneously for ECG monitoring. The surgical incision is closed and the animals are allowed to recover. Drug Treatment The animals are treated after the recovery period during the 3 days of programmed electrical stimulation either with the test drug or with the solvent. Electrophysiologic Studies and Programmed Electrical Stimulation Programmed electrical stimulation (PES) is performed between days 3 and 5 after induction of anterior myocardial infarction by occlusion/perfusion of the LAD. Animals are studied while conscious and unsedated. Heart rate, ECG intervals and other electrophysiologic parameters (for details see original publications) are determined before PES is started. Premature ventricular stimuli are introduced in the region of the right ventricular outflow tract. The extra stimuli are triggered from the R-wave of the ECG, and the R-S2 coupling interval is decreased from 350 ms until ventricular refractoriness occurs. At this time, double and triple ventricular extra stimuli are introduced during sinus rhythm. Ventricular tachyarrhythmias are defined as ‘non- sustained’, if five or more repetitive ventricular responses are initiated reproducibly, but terminated spontaneously. Ventricular tachyarrhythmias are defined as ‘sustained’, if they persist for at least 30 s or, in the event of hemodynamic compromise, require ventricular burst pacing for their termination. Sudden Cardiac Death A direct anodal 15 μA current from a 9-V nickel-cadmium battery is passed through a 250 Ohm resistor and applied to the electrode in the lumen of the left circumflex coronary artery. The cathode of the battery is connected to a s.c. implanted disc electrode. Lead II ECG is recorded for 30 s every 15 min on a cardiocassette recorder. After 24 h of constant anodal current or development of ventricular fibrillation, the animals are sacrificed, the hearts are excised and the thrombus mass in the LCX is removed and weighed. The heart is sectioned transversely and incubated for 15 min at 37 °C in a 0.4 % solution of tetrazolium triphenyl chloride for identification of infarcted areas. Time of onset of ventricular ectopy and of lethal arrhythmia is provided from recordings of the cardiocassette. EVALUATION Non-sustained and sustained tachyarrhythmias are evaluated. CRITICAL ASSESSMENT OF THE METHOD Sudden coronary death is one of the leading causes of death in developed countries. These facts warrant the use of complicated models in higher animals for search of active drugs. MODIFICATIONS OF THE METHOD Schwartz et al. (1984) described an experimental preparation for sudden cardiac death in dogs. The animals were chronically instrumented and studied 1 month after an anterior myocardial infarction. A balloon catheter around the circumflex coronary artery was inflated to produce acute myocardial ischemia and the occlusion was maintained for 2 min. Several days later, the animals were subjected to a submaximal stress on a motor-driven treadmill for 12–18 min. During the last minute of exercise the left coronary artery was occluded, the treadmill stopped, and the occlusion was maintained for a second minute. Schwartz et al. (1988) analyzed the baroreceptor reflexes in conscious dogs with and without a myocardial infarction to get insights in the mechanisms of sudden death. Cahn and Cervoni (1990) reviewed of the use of animal models of sudden cardiac death for drug development. Pak et al. (1997) found that canine tachycardia-induced cardiomyopathy is a useful model for studying mechanisms and therapy of sudden cardiac death in heart failure. Adamson et al. (1994) performed a longitudinal study in dogs at high and low risk for sudden death and found an unexpected interaction between β- adrenergic blockade and heart rate variability before and after myocardial infarction. Basso et al. (2004) recommended arrhythmogenic right ventriculopathy causing sudden death in boxer dogs as an animal model of human disease. A.5.0.8.4 Ventricular Fibrillation Inducedby Cardial Ischemia During Exercise PURPOSE AND RATIONALE Billman and his group developed methods to evaluate antiarrhythmic drugs for their activity in cardiovascular parameters in an exercise-plus-ischemia test. PROCEDURE Surgical Preparation Mongrel dogs, weighing 15.4 to 19.1 kg, are anesthetized and instrumented to measure left circumflex CBF, left ventricular pressure and ventricular electrogram (Billman and Hamlin 1996; Billman et al. 1993, 1997; Schwartz et al. 1984). The animals are given Innovar Vet (0.02 mg/kg fentanyl citrate and 1 mg/kg hydroperidol i.v.) as a preanesthetic, whereas a surgical plane of anesthesia is induced with sodium pentobarbital (10 mg/kg i.v.). A left thoracotomy is made in the fourth intercostal space, and the heart is exposed and supported by a pericardial cradle. A 20- MHz pulsed Doppler flow transducer and a hydraulicoccluder are placed around the left circumflex artery. A pair of insulated silver-coated wires are sutured to the epicardial surface of both the left and right ventricles. These electrodes are used for ventricular pacing or to record a ventricular electrogram from which HR is determined using a Gould Biotachometer (Gould Instruments, Cleveland, OH). A precalibratedsolid-state pressure transducer (Konigsberg Instruments, Pasadena, CA) is inserted into the left ventricle via a stab wound in the apical dimple. Finally, a two-stage occlusion of the left anterior descending coronary artery is performed approximately one third the distance from the origin to induce an anterior wall myocardial infarction. This vessel is partially occluded for 20 min and then tied off. All leads from the cardiovascular instrumentation are tunneled under the skinto exit on the back of the animal’s neck. A transdermal fentanyl patch that delivers 75 μg/h for 72 h is placed on the back of the neck (secured with adhesive tape) to decrease postoperative discomfort. In addition, bupivacaine HCl, a long-acting local anesthetic, is injected to block the intercostal nerves (i. e., pain fibers) in the area of the incision. Each animal is placed on prophylactic antibiotic therapy (amoxicillin 500 mg p.o.) three times daily for 7 days. The animals are placed in an “intensive care” setting for the first 24 h and placed on antiarrhythmic therapy (Billman and Hamlin 1996; Billman et al. 1993, 1997; Schwartz et al. 1984). Exercise-Plus-Ischemia Test The studies begin 3 to 4 weeks after the production of the myocardial infarction. The animals are walked on a motor-driven treadmill and trained to lie quietly without restraint on a laboratory table during this recovery period. Susceptibility to VF is then tested. The animals run on a motor-driven treadmill while workload is increased every 3 min for a total of 18 min. The protocol begins with a 3-min warm-up period, during which the animals run at 4.8 km/h at 0 % grade. The speed is in- creased to 6.4 km/h, and the grade is increased every 3 min as follows: 0 %, 4 %, 8 %, 12 % and 16 %. During the last minute of exercise, the left circumflex coronary artery is occluded, the treadmill is stopped and the occlusion is maintained for 1 additional min (total occlusion time, 2 min). Large metal plates (diameter, 11 cm) are placed across the animal’s chest so that electrical defibrillation can be achieved with minimal delay but only after the animal is unconscious (10–20 s after VF begin). The occlusion is immediately released if VF occur. The animals then receive one or more of the following treatments: the exercise-plus-ischemia test is repeated after pretreatment with the standard drug glibenclamide (1.0 mg/kg i.v.). The drug is injected in a cephalic vein; 3 min before exercise begins. The exercise-plus-ischemia test is repeated after pretreatment with the test drug Finally, a second control (saline) exercise plus ischemia test is performed 1 week after the last drug test. At least 5 days are intermitted between drug treatments. Drugs are given in a random order. Refractory Period Determination On a subsequent day, the effective refractory period is determined using a Medtronic model 5325 programmable stimulator, both at rest and during myocardial ischemia. The heart is paced for 8 beats (S1; intrastimulus interval, 300 ms; puise duration, 1.8 ms at twice-diastolic threshold of mA). The intrastimulus interval is progressively shortened between the last paced beat and a single extrastimulus (S2). The refractory period represents the shortest interval capable of generating a cardiac response and is measured using either the left or right ventricular electrodes. This procedure is completed within 30 s. Once the control values are determined, refractory period measurements are repeated after the standard drug glibenclamide (1.0 mg/kg i.v.), or the test drug. After the completion of these studies, refractory period is determined during myocardial ischemia (2-min occlusion of the left circumflex coronary artery) ~60 s after the onset of the coronary occlusion. Reactive Hyperemia Studies The K ATP has been implicated in vascular regulation, particularly CBF (Aversano et al. 1991; Belloni and Hintze 1991; Daut et al. 1990). Therefore, the effects of standard and test drug on the response to brief interruptions in CBF are also evaluated. Animals are placed on a laboratory table, and the left circumflex coronary is occluded three or four times for 15 s. At least 2 min (or until CBF had returned to preocclusion base line) elapse between occlusions. The occlusions are then repeated 5 min after standard and test drug. On the subsequent day, the studies are repeated with the drug that had not been given the previous day. EVALUATION All hemodynamic data are recorded on a Gould model 2800S eight-channel recorder (Cleveland, OH) and a Teac model MR-30FM tape recorder (Tokyo, Japan). Coronary blood flow is measured with a University of Iowa Bioengineering flowmeter model 545 C-4 (Iowa City, IA). The rate of change of left ventricular pressure[d(LVP)/dt] is obtained by passing the left ventricular pressure through a Gould differentiator that has a frequency response linear to >300 Hz. The data are averaged over the past 5 s of each exercise level. The coronary occlusion data are averaged over the last 5 s before and at the 60-s line point (or VF onset) after occlusion onset. The total area between the peak CBF and return to base line is measured for each 15-s occlusion, and the percent repayment is calculated. The reactive hyperemia response to each occlusion is then averaged to obtain one value for each animal. The data are then analyzed using analysis of variance for repeated measures. When the F ratio is found to exceed a critical value (P < 0.05), Scheffe’s test is used to compare the mean values. The effects of the drug intervention on arrhythmia formation are determined using a x2 test with Yates’ correction for continuity. All data are reported as mean ± SEM. Cardiac arrhythmias, PR interval and QT interval are evaluated at a paper speed of 100 mm/s. QT interval is corrected for HR using Bazett’s method. CRITICAL ASSESSMENT OF THE METHOD Tests combining coronary constriction with physical exercise may resemble most closely the situation in coronary patients. A.5.0.9 Experimental Atrial Fibrillation A.5.0.9.1 Atrial Fibrillation by Atrial Pacing in Dogs PURPOSE AND RATIONALE Morillo et al. (1995) published a model of sustained atrial fibrillation by chronic rapid atrial pacing in dogs. Halothane-anesthetized mongrel dogs underwent insertion of a transvenous lead at the right atrial appendage that was continuously paced at 400 beats/min for 6 weeks. Two-dimensional echocardiography was performed to assess the effects of rapid atrial pacing on atrial size. Atrial vulnerability was defined as the ability to induce sustained repetitive atrial responses during programmed electrical stimulation. Effective refractory period (ERP) was measured at two endocardial sites of the right atrium. Sustained atrial fibrillation (AV) was defined as AF ≥15 min. In animals with sustained AF, 10 quadripolar epicardial electrodes were surgically attached to the left and right atria. The local atrial fibrillatory cycle length (AFCL) was measured in a 20-s window. Marked biatrial enlargement was documented after 6 weeks of continuous rapid atrial pacing. An increase in atrial area of at least 40 % was necessary to induce sustained AF. More studies using this method were performed by Gaspo et al. (1997a, 1997b), Yue et al. (1997), Sun et al. (1998), and Nattel and Li (2000). Shiroshita-Takeshita et al. (2004) studied the effect of drugs on atrial fibrillation promotion by atrialtachycardia remodeling on dogs. PROCEDURE Mongrel dogs were anesthetized with ketamine (5.3 mg/kg i.v.), diazepam (0.25 mg/kg i.v.) and halothane (1.5 %). Unipolar leads were inserted through jugular veins into the right ventricular apex and the right atrial appendage and connected to pacemakers (Medtronic) in subcutaneous pockets in the neck. A bipolar electrode was inserted into the right atrium for stimulation and recording during serial electrophysiological study. AV block was created by radiofrequency ablation of control ventricular response during atrial tachypacing. The right ventricular pacemaker was programmed to 80 beats/min. After 24 h for recovery, a baseline closed-chest serial electrophysiological study was performed under ketamine/diazepam/isoflurane anesthesia, and then atrial tachypacing (400 beats/min) was initiated. The closed-chest electrophysiological study was repeated at 2, 4, and 7 days of atrial tachypacing, and a final open-chest electrophysiological study was performed on day 8 under morphine-chloralose anesthesia. Results of atrial tachypacing in drug-treated dogs were compared with results of dogs without treatment (controls). Study Protocol Dogs were anesthetized and ventilated mechanically. The atrial pacemaker was deactivated and a right atrium appendage effective refractory period was measured at basic lengths of 150, 200, 250, 300, and 360 ms with 10 basic stimuli (S1) followed by a premature extra-stimulus (S2) with 5-ms decrements. The longest S1-S2 failing to capture defined the effective refractory period. AF was induced by atrial burst pacing at 10 Hz and 4 times threshold current. To estimate mean AF duration in each dog, AF was induced 10 times if AF duration was < 20 min and 5 times if AF lasted 20–30 min and then averaged. If AF lasted longer than 30 min, it was considered sustained and was terminated by DC cardioversion. A 20-min rest period was then allowed before continuing measurements. For open-chest electrophysiological studies, dogs were anesthetized and ventilated mechanically. A femoral artery and both femoral veins were cannulated for pressure monitoring and drug administration. A median sternotomy was performed, and bipolar electrodes were hooked to the right atrial and left atrial appendages for recording and stimulation. A programmable stimulator (Digital Cardiovascular Instruments) was used to deliver twice-threshold currents. Five silicon sheets containing 240 bipolar electrodes were sutured onto the atrial surface (Fareh et al. 2001). Atrial effective refractory periods were measured as multiple basic cycle lengths in the right and left atrial appendages and at basic cycle length 300 ms in six additional sites: right and left atrium posterior wall, right and left atrium inferior wall, and right and left atrium Bachmann’s bundle. Atrial fibrillation vulnerability was determined as the percentage of atrial sites at which AF could be induced by single extra-stimuli. EVALUATION Data are presented as mean ± SEM. Multiple-group comparisons were obtained by ANOVA. AF duration data were analyzed after logarithmic transformation. Bonferroni-corrected t tests were used to evaluate individual-mean differences. MODIFICATIONS OF THE METHOD Verheule et al. (2004) described a canine model of atrial fibrillation due to chronic atrial dilatation. Courtemanche et al. (1999) and Ramirez et al. (2000) published mathematical models of fibrillationinduced electrical remodeling and of canine atrial action potentials. Pinto and Boyden (1999) reviewed electrical remodeling in ischemia and infarction. Cabo and Boyden (2003) performed a computational analysis of electrical remodeling of the epicardial border zone in the canine infarcted heart. Sakabe et al. (2004) reported that enalapril prevents perpetuation of atrial fibrillation by suppressing atrial fibrosis and over-expression of connexin43 in a canine model of atrial pacing-induced left ventricular dysfunction. Baartscheer et al. (2005) induced combined volume and pressure overload in New Zealand white rabbits. In a first surgical procedure, volume overload was produced by rupture of the aortic valve until pulse pressure increased by about 100 %, and after 3 weeks, pressure overload was created by suprarenal abdominal aortic constriction of 50 %. In these animals, chronic inhibition of the Na+/H+ exchanger attenuated cardiac hypertrophy and prevented cellular remodeling in heart failure. Using cultured atrial myocytes (HL-1 cells), Yang et al. (2005) found that rapid field stimulation (300 beats/min) causes electrical remodeling. A.5.0.9.2 Atrial Fibrillation in Chronically Instrumented Goats PURPOSE AND RATIONALE Atrial fibrillation is the most common tachyarrhythmia in humans. It causes palpitations, decreased cardiac output, heart failure and systemic thromboembolism, and is associated with significant mortality. Wijffels et al. (1995) demonstrated in a chronically instrumented conscious goat model, that episodes of atrial fibrillation may be self-perpetuating (“Atrial fibrillation begets atrial fibrillation”) and have suggested that there may be a purely electrophysiological explanation (termed atrial electrical remodeling) for the increase of atrial fibrillation with time. This model has been extensively used to study pathophysiological mechanism and the influence of drugs (Wijffels et al. 1997, 1999, 2000; Allessie et al. 1998; Tieleman et al. 1999; Duytschaever et al. 2000, 2005; Garratt and Fynn 2000; Van der Velden 2000a, 2000b; Veloso 2001; Brendel and Peukert 2003; Shan et al. 2004; Blaauw et al. 2004a). Blaauw et al. (2004b) studied the efficacy and atrial selectivity of a blocker of the early ultrarapid component of the delayed rectifier (I kur) in remodeled atria of the goat. PROCEDURE Female goats weighing 52 ± 2 kg were used. According to the method of Duytschaever et al. (2001), Teflon-felt plaques with multiple electrodes were sutured onto the free wall of each atrium, Bachmann’s bundle, and the left ventricle. All leads were tunnelled subcutaneously to the neck and exteriorized by four 30-pole connectors. Experiments were started 3–4 weeks after surgery. Atrial fibrillation was induced by a fibrillation pacemaker (Wijffels et al. 1995). The atria were paced with biphasic stimuli of 2 ms duration and 4 × threshold. The atrial effective refractory period was measured at the free wall of the right and left atria during regular pacing (interval, 400–200 ms). Single interpolated stimuli were applied after eight basic stimuli, starting within the refractory period. The longest interval that failed to capture the atria (2-ms increments) was taken as the atrial effective refractory period. Atrial conduction velocity was measured along Bachmann’s bundle during right atrial pacing. The distance over which conduction velocity was measured ranged from 3.5 to 5 cm. The length of the fibrillation waves was determined at the right atrial free wall by measuring the refractory period and conduction velocity during AF. The refractory period was measured by slow, fixed-rate pacing (1 Hz), resulting in a series of single, randomly coupled, premature stimuli. Local capture of AF was evidenced by radial spread of activation from the pacing site and a short delay between stimulus and response. For each coupling interval, the percentage of capture was determined. The shortest interval capturing the atrium ≥50 % was taken as the refractory period. Conduction velocity was determined with a mapping electrode containing 5 × 6 electrodes (interelectrode distance, 4 mm) from the local conduction vectors within areas of 3 × 3 electrodes. At least 50 AF cycles were used to determine conduction velocity. Inducibility of AF was measured at the right and left atria by single premature stimuli applied during regular pacing (400 ms). In case a premature beat induced a rapid irregular rhythm lasting > 1 s, AF was considered inducible. The AF cycle length was measured automatically by an algorithm detecting the negative intrinsic deflection of the fibrillation electrogram. A median value of 300 consecutive intervals was calculated. QT duration was measured during atrial pacing and persistent AF from either an epicardial electrogram or a precordial ECG. Because Bazett’s formula cannot be applied during AF, another approach was used to correct QT duration. In each goat, the relationship between the RR interval and QT duration was determined during 20 s of AF. The RR-QT relationship after drug administration was compared with the normal RR-QT relation. The electrophysiological effects of the test drug and a conventional class III drug were measured before and after 48 h (1–4 days) of AF. The drugs were infused intravenously over 1 h, during which time AF cycle length was monitored. After 30 min of infusion, refractory period, conduction velocity, median RR interval, and QT duration were measured. Successful cardioversion was defined as termination of AF within ≤ 1 h of drug administration. EVALUATION Differences between groups were evaluated by paired Student’s t-test or by two-way repeated ANOVA with post hoc Bonferroni’s t-test. McNemar’s test was used to compare AF inducibility. Changes in corrected QT duration were calculated by the one-sample t-test. Differences were considered significant at P < 0.05. Results are presented as mean ± SEM. A.5.0.9.3 Influence on Ultrarapid Delayed Rectifier Potassium Current in Pigs PURPOSE AND RATIONALE Blockade of cardiac potassium channels and the resulting prolongation of repolarization and refractoriness is the mode of action of class III antiarrhythmic drugs. In the human heart, the ultrarapid delayed rectifier potassium current (I Kur) was identified in atrial, but not in ventricular tissue. It appears to contribute to action potential repolarization (Wang et al. 1993; Li et al. 1996) in the atrium but not the ventricle. The molecular correlate of the human cardiac ultrarapid delayed rectifier potassium current seems to be the Kv1.5 protein (Fedida et al. 1993; Wang et al. 1993; Feng et al. 1997, 1998). Since prolongation of ventricular repolarization seems to be invariably associated with proarrhythmia (early afterdepolarizations leading to torsades de pointes arrhythmia) as shown with available potassium channel blockers (class III drugs) such as the highly selective and potent I Kr-channel blocker dofetilide (Torp- Pedersen et al. 1999), blockade of a cardiac current that is exclusively present in the atria is highly desirable as it is expected to be devoid of ventricular proarrhythmic effects. Therefore, the atrial Kv1.5 channel is a highly attractive target in the search for new and safer atrial antiarrhythmic drugs (Nattel and Singh 1999). In a series of studies, Wirth and Knobloch (2001), Knobloch et al. (2002, 2004), and Wirth et al. (2003) investigated electrophysiological and antiarrhythmic effects of I Kur channel blockers on left versus right pig atrium in vivo in comparison with I Kr blockers in pigs. PROCEDURE Surgery Castrated male pigs (24–30 kg) of the German Landrace were premedicated with 3 ml Rompun 2 % i.m. (xylacine HCL, 23.3 mg/ml = 3 mg/kg i.m.) and 6 ml Hostaket (ketamine HCl, 115 mg/ml = 20 mg/kg i.m.) and anesthetized with an i.v. bolus of 5 ml Narcoren (pentobarbital, 160 mg/ml = 25–30 mg/kg i.v.) followed by a continuous intravenous infusion of 12–17 mg/kg per h pentobarbital. Animals were ventilated with room air and oxygen by a respirator (ABV- Intensiv; Stephan, Gackenbach, Germany). After a left thoracotomy the lung was retracted, the pericardium incised and the heart suspended in a pericardial cradle. Bipolar body surface ECG was recorded using subcutaneous needle electrodes in the classical lead II or lead III arrangement. Atrial Effective Refractory Period Measurements Atrial effective refractory period (ERP) measurements at different basic cycle lengths (BCL 240/300/400 ms) were performed (Wirth and Knobloch 2001). Atrial responses to the pacing procedure were visualized via monophasic action potential (MAP) from the left and right atrium as will be described below. A conditioning train of ten basic stimuli (S1) at twice-diastolic pacing threshold was followed by a diastolic extrastimulus (S2, pulse duration 1 ms) starting about 30 ms above the expected ERP with a 5-ms decrement (UHS 20, universal heart stimulator; Biotronik, Berlin, Germany). The longest coupling interval unable to elicit a propagated atrial response was taken as the atrial ERP. MAP Recording Sites and Atrial Pacing Electrodes Left atrial ERP was measured via a MAP pacing catheter (EP Technologies, Model 1675; Boston Scientific, La Garenne-Colombes, France), which was fixed in each pig in the middle of the left atrial free wall in an approximately perpendicular position by a holding device (Yuan et al. 1994). The tip of the MAP pacing catheter was covered by a sponge. Programmed stimulation was performed by the MAP pacing catheter. Right atrial MAP for ERP measurement was taken from the endocardium of the right atrium also via a steerable MAP pacing catheter. The catheter, inserted via the V. femoralis, was used for atrial stimulation too. Its position in the right atrium was checked by palpitation and by the typical atrial MAP morphology and duration and, additionally, by short rapid atrial pacing at a BCL of 240 ms, which the ventricle was not able to follow 1:1 as indicated by frequent p-waves dissociated from the QRS complex. There were no significant differences between endocardial and epicardial ERP measurements in the free walls of either atrium at baseline and after drug. Left Atrial Vulnerability During the ERP measurement procedure the mere S2-extrastimulus, which followed the ten conditioning S1 stimuli during the ERP-measurement procedure, frequently triggered runs of atrial tachycardia in the left, not the right, atrium. The occurrence of tachycardias was primarily unintended, but then exploited as a parameter for the judgement of the antiarrhythmic efficacy of compounds (referred to as left atrial vulnerability). Whether or not a run of S2-triggered atrial tachyarrhythmia occurred during the ERP-measurement procedure at a given BCL was noted. The occurrences of triggered tachyarrhythmias were summed up for the three BCLs tested over three time points (during a 30- min period before or after a drug). Thus, the maximal occurrence of S2-tachyarrhythmias during the control or drug period in an individual animal was nine. Drugs Drugs were dissolved in polyethyleneglycol (PEG) 400 (Riedel-de Haen, Seelze, Germany) and administered i.v. over 5 min in a volume of 3 ml. Vehicle was injected at least 30 min before each drug. For each drug a separate group of pigs was used. EVALUATION All data were presented as means ± SEM. Two-way ANOVA for repeated measures followed by Student’s t-test was used for the calculation of statistically significant differences between left and right atrial ERP prolongations at the three basic cycle lengths and the inhibition of left atrial vulnerability. A value of P < 0.05 was accepted as significant. The longest ERP at each pacing rate after drug administration was taken and expressed as absolute or percent increase from vehicle control. Interatrial difference in refractoriness was calculated as the difference between the left and right atrial ERP. A.5.0.10 Characterization of Anti-Arrhythmic Activity in the Isolated Right Ventricular Guinea Pig Papillary Muscle ... PURPOSE AND RATIONALE According to Vaughan-Williams (1970) anti-arrhythmic drugs are divided into 4 different classes depending on their mode of action. Class I anti-arrhythmic agents decrease the upstroke velocity of the action potential through blockade of Na+ channels. Class II drugs block β-receptors. Class III anti-arrhythmic agents prolong action potential duration, presumably through blockade of K+ channels. Class IV anti-arrhythmic agents inhibit the slow calcium influx during the plateau of the action potential through Ca2+ channel blockade. These electrophysiological actions also have functional manifestations, e. g., Na+ channel blockade decreases excitability, K+ channel blockade lengthens refractory period, and Ca2+ channel blockade decreases tension of cardiac muscle. A simple and accurate non-microelectrode method is necessary to identify and classify potential anti-arrhythmic drugs into the classes I, III, and IV. In right ventricular guinea pig papillary muscle developed tension(DT), excitability (EX), and effective refractory period (ERP) are measured. PROCEDURE Guinea pigs of either sex weighing 200–400 g are stunned, the carotid arteries are severed, and the thoracic cage is opened immediately. The heart is removed, placed into a container of prewarmed, preoxygenated physiologic solution and the pericardium, atria, and other tissues are removed. The heart is then pinned to a dissection dish, and the right ventricle is opened. The tendinous end of the papillary muscle is ligated with a silk thread, and the chordae tendinae are freed from the ventricle. The opposite end of the papillary muscle is then cut free close to the ventricular wall. The non-ligated end of the papillary muscle is clamped into a tissue holder, the end of which is a leucite block containing platinum wire field electrodes. The preparation is transferred to a tissue bath containing 75 ml of a physiological salt solution that is gassed continuously with 95 % O2/5 % CO2 and maintained at a temperature of 35 °C and a pH of 7.4. The silk thread is used to connect the muscle to a Grass FT03C force transducer. An initial resting tension of 1 g is established. Muscles are field stimulated to contract isometrically. The stimulus duration is 1 ms, the frequency 1 Hz, and the voltage twice threshold. Pulses are delivered with the use of a Grass S88 constant voltage stimulator, and developed tension is recorded with the use of a polygraph recorder. The preparation is equilibrated in this manner for 90 min with bath solution changes every 15 min. Control measurements of the force-frequency curve, stimulus strength-duration curve and the effective refractory period are made following the 75 min bath exchange, i. e., during the last 15 min of equilibration. The force-frequency curve is obtained by measuring developed tension over a range of stimulation frequencies (0.3, 0.5, 0.8, 1.0, and 1.2 Hz). The tissue is contracted for 90 s at each of these frequencies with a brief period of stimulation at 1.5 Hz inserted between increments. The purpose of the 1.5 Hz insert is to keep “pacing history” constant as well as to minimize progressive, nonspecific depression during the lower frequency stimulation series. Both pre- and postdrug developed tension (at each frequency) are expressed as a percentage of the predrug developed tension at 1 Hz. The percent change in post treatment (versus pretreatment) developed tension at 1 Hz is used to quantitate an agent’s inotropic effect. The stimulus strength-duration curves are determined by varying the stimulus duration (0.1, 0.4, 0.8, 1.0,1.5,3.0, and 3.4 ms) and finding the threshold voltage that produced a 1:1 correspondence between stimulus and response at each duration. The degree of shift in the strength-duration curve is measured by computing the area between the pre- and post-treatment curves. The boundaries for the area are determined by the first (x-axis parallel) and the last (x-axis perpendicular) durations and by lines from the origin to the second and fourth durations. Effective refractory period (ERP) is measured at 1 Hz using twin pulse stimuli. After every 8–10 pulses, a second delayed stimulus(S 2) identical to the basic drive pulse (S 1) is introduced. This procedure is repeated, shortening the delay(S 1–S 2) by 5 ms increments. The value of the ERP is taken as the longest delay (S 1–S 2) for which there is a single response to twin pulses. The change in ERP is computed as the difference (ms) between the pre- and post-treatment ERP values. At the conclusion of the 90 min predrug equilibration period, an aliquot of the test drug designed to achieve the desired final concentration is added to the bath. The tissue must equilibrate for 1 h in the drug solution before postdrug measurements of the force- frequency curve, stimulus strength-duration curve, and effective refractory period are obtained. EVALUATION The changes in effective refractory period (ERP) (post treatment minus pretreatment), the degree of shift in the strength-duration curve (geometrical area between pre- and post-treatment curves), and the percent changes in post treatment developed tension at 1 Hz are calculated. The results of these calculations are used to classify the compound as a class I, III, or IV anti-arrhythmic agent on the basis of its effect on developed tension, excitability, and effective refractory period. An upward and right shift of the strength-duration curve (decrease in excitability) is characteristic for a class I anti-arrhythmic agent, such disopyramide. Selective prolongation of effective refractory period is characteristic for class III anti-arrhythmic agents, such as sotalol. Depression of developed tension, and/or flattening or reversal of the force-frequency curve is characteristic for a class IV anti-arrhythmic agent, such as verapamil. CRITICAL ASSESSMENT OF THE METHOD The model of the electrically stimulated isolated guinea pig papillary muscle is a simple method to classify anti-arrhythmic agents. Some drugs have multiple actions and, therefore, belong in more than one class. For further characterization analysis of the action potential is necessary. MODIFICATIONS OF THE METHOD O’Donoghue and Platia (1991) recommended the use of monophasic action potential recordings for the evaluation of anti-arrhythmic drugs. Shibuya et al. (1993) studied the effects of the local anesthetic bupivacaine on contraction and membrane potential in isolated canine right ventricular papillary muscles. From analysis of action potential it is concluded that at low concentrations contraction is depressed mainly due to a Na+ channel block, whereas at high concentrations also Ca2+ channels may be blocked. Kodama et al. (1992), Maryuama et al. (1995) studied the effects of potential antiarrhythmics on maximum upstroke velocity and duration of action potential in isolated right papillary muscles of guinea pigs as well as the influence of these agents on single ventricular myocytes. Borchard et al. (1982) described a method for inducing arrhythmias or asystolia by the application of 50 Hz alternating current (ac) to electrically driven isolated left atria and right papillary muscles of the guinea pig. An increase in driving frequency from 1 to 3 Hz effected a significant reduction of the threshold of ac-arrhythmia in guinea pig papillary muscle, but no change in atria. A decrease in temperature from 31 °C to 25 °C and an increase in Ca2+ from 1.25 to 5 mmol/l elevated the threshold for ac-arrhythmia and asystolia. Fast sodium channel inhibitors increased threshold of acarrhythmia in left atria and papillary muscles, whereas the slow channel inhibitor verapamil was ineffective in concentrations up to 6 μmol/l. A.5.0.11 Action Potential and Refractory Period in Isolated Left Ventricular Guinea Pig Papillary Muscle ... PURPOSE AND RATIONALE Intracellular action potential in the left ventricular guinea pig papillary muscle is recorded after electrical stimulation. The stimulation frequency is varied in order to determine the refractory period. Resting potential, upstroke velocity, duration of action potential, threshold, refractory period and contractile force can be measured in vitro. Compounds which affect the duration of the effective refractory period may have antiarrhythmic or pro-arrhythmic effects. In addition, the inotropic effect (positive or negative) of the test compound is determined. PROCEDURE Guinea pigs of either sex (Marioth strain) weighing 250–300 g are sacrificed by stunning, the carotid arteries are severed, and the thoracic cage is opened immediately. The heart is removed, placed in a container of prewarmed, pre-oxygenated Ringer solution, and the pericardium and the atria are trimmed away. The left ventricle is opened and the two strongest papillary muscles removed. They are fixed between a suction electrode for electrical stimulation and a force transducer for registration of contractions. Ringer solution oxygenated with carbogen (95 % O2/5 % CO2) at a temperature of 36 °C is used. A standard micro electrode technique is applied to measure the action potential via a glass micro electrode containing 3 M KCl solution, which is inserted intracellularly. The papillary muscle is stimulated with rectangular pulses of 1 V and of 1 ms duration at an interval of 500 ms. The interval between two stimuli is variable in order to determine refractory periods. The intensity of the electrical current is just below the stimulation threshold. The intracellular action potential is amplified, differentiated for registration of upstroke velocity (dV/dt) (Hugo Sachs micro electrode amplifier), together with the contraction force displayed on an oscilloscope (Gould digital storage oscilloscope OS 4000), and recorded (Gould2400 recorder). The effects on fast sodium channels as well as on calcium channels can be studied. The former requires measurement of the normal action potential and the latter the slow action potential obtained at 30 mM K+. To estimate the relative refractory periods, the second stimuli are set in decremental intervals until contraction ceases. Relative refractory period is defined as the minimum time interval of two stimuli at which each of the stimuli is answered by a contraction. The stimulation threshold is also measured. After an equilibrium time of 30 min the test compound is added. After 15 and 30 min the following parameters are compared with the predrug values: Resting potential mV upstroke velocity V/s duration of action potential ms stimulation threshold V refractory period ms contraction force mg The organ bath is flushed thoroughly between two consecutive applications of increasing test drug doses. EVALUATION Contractile force [mm] and relative refractory period [ms] are determined before and after drug administration. ED 25ms- and ED 50ms-values are determined. ED 25ms or ED 50ms is defined as the concentration of test drug in the organ bath at which the relative refractory period is reduced or prolonged by 25 ms or 50 ms. Since many anti-arrhythmic agents possess additionally negative inotropic effects, changes in the force of contraction are also determined. ED 50 values are calculated from log-probit analyses. Scores are allotted relative to the efficacy of standard compounds (lidocaine, propranolol, quinidine). The following changes are indicators for anti-arrhythmic activity: increase of stimulation threshold decrease of upstroke velocity prolongation of action potential increase of refractory period. Upstroke velocity and duration of action potentialare used for classification purposes. MODIFICATIONS OF THE METHOD Tande et al. (1990) studied the electromechanical effects of a class III anti-arrhythmic drug on guinea pig and rat papillary muscles and atria using conventional microelectrode technique. Shirayama et al. (1991) studied with a similar technique the electrophysiological effects of sodium channel blockers in isolated guinea pig left atria. Dawes (1946) described a method of examining substances acting on the refractory period of cardiac muscle using isolated rabbit auricles. The same method was recommended as first step of a screening program for quinidine-like activity by Schallek (1956). Wellens et al. (1971) studied the decrease of maximum driving frequency of isolated guinea pig auricles after antiarrhythmic drugs and beta-blockers. Salako et al. (1976) recorded electropotentials along the conducting system after stimulation of the proximal part of the His bundle in rabbits. Brown (1989), Wu et al. (1989), Gwilt et al. (1991a, b) measured in vitro transmembrane action potential in Purkinje fibers and endocardial ventricular muscles from dogs. Voltage clamp techniques in isolated cardiac myocytes from guinea pigs have been used by Wettwer et al. (1991). Nygren et al. (2004) described heterogeneity of action potential durations in isolated mouse left and right atria recorded using voltage-sensitive dye mapping. A.6 Methods to Induce Cardiac Hypertrophy and Insufficiency Animal models of cardiac hypertrophy and insufficiency have been reviewed by Hasenfuss (1988), Muders and Elsner (2000), and Vanoli et al. (2004). ... A.6.0.1 Cardiac Hypertrophy and Insufficiency in Rats A.6.0.1.1 Aortic Banding in Rats PURPOSE AND RATIONALE Blood flow restriction of the aorta in rats induces not only hypertension but also cardiac hypertrophy within several weeks. Angiotensin converting enzyme inhibitors, even at subantihypertensive doses, but not other antihypertensive drugs, inhibit cardiac hypertrophy (Linz et al. 1991; Schölkens et al. 1991; Gohlke et al. 1992; Linz 1992a; Linz et al. 1996; Bruckschlegel et al. 1995; Ogawa et al. 1998). PROCEDURE Male Sprague Dawley rats weighing 270–280 g are fasted 12 h before surgery. Anesthesia is induced by i.p. injection of 200 mg/kg hexobarbital. The abdomen is shaved, moistened with a disinfectant and opened by a cut parallel to the linea alba. The intestine is moistened with saline and placed in a plastic cover to prevent desiccation. The aorta is prepared free from connective tissue above the left renal artery and underlaid with a silk thread. Then, a cannula no. 1 (0.9 × 40 mm) is placed longitudinally to the aorta and both aorta and cannula are tied. The cannula is removed, leaving the aortic lumen determined by the diameter of the cannula. The intestine is placed back into the abdominal cavity with the application of 5.0 mg rolitetracycline (Reverin). In sham-operated controls no banding is performed. The skin is closed by clipping. The animals are treated once daily over a period of 6 weeks with doses of the ACE-inhibitor or other antihypertensive drugs found previously effective to lower blood pressure in rats. At the end of the experiment blood pressure is measured under hexobarbital anesthesia (200 mg/kg i.p.) via indwelling catheters in the left carotid artery. Blood pressure measurement in conscious rats with the convential tail-cuff method is not possible due to the large pressure difference across the ligature. Therefore, only one measurement at the end of the study is possible. The hearts are removed, rinsed in saline until free of blood and gently blotted to dryness. Total cardiac mass is determined by weighing on an electronic balance to the nearest 0.1 mg. The atria and all adjacent tissues are trimmed off and the weight of the left ventricle including the septum as well as the remaining cardiac tissue representing the right ventricle are determined separately. Weights are calculated per 100 g body weight. EVALUATION Total cardiac mass, weight of left and right ventricle of treated rats are compared with operated controls and sham-operated controls. MODIFICATIONS OF THE METHOD Uetmasu et al. (1989) described a simple method for producing graded aortic insufficiencies in rats and subsequent development of cardiac hypertrophy. Selective perforation of the right cup of the aortic valve or in combination with that of the left valve cup was performed using a plastic rod inserted from the right common carotid artery. Hypertrophy of the heart, but no hypertension or cardiac insufficiency, was observed. Similar methods were used by Yamazaki et al. (1989) to study the alterations of cardiac adrenoceptors and calcium channels subsequent to aortic insufficiency, by Umemura et al. (1992) to study baroreflex and β -adrenoceptor function and by Ishiye et al. (1995) to study the effects of an angiotensin II antagonist on the development of cardiac hypertrophy due to volume overload. Hyperplastic growth response of vascular smooth muscle cells in the thoracic aorta was found following induction of acute hypertension in rats by aortic coarctation by Owens and Reidy (1985). Changes in cardiac gene expression during compensated hypertrophy and the transition to cardiac decompensation in rats with aortic banding were studied by Feldman et al. (1993). Muders et al. (1995) produced aortic stenosis in rats by placing a silver clip (inner diameter 0.6 mm) on the ascending aorta. Schunkert et al. (1995) studied alteration of growth responses in established cardiac pressure overload hypertrophy in rats with aortic banding. Prevention of cardiac hypertrophy after aortic banding by ACE inhibitors probably mediated by bradykinin could be shown (Linz et al. 1989,1992a, b, 1993, 1994; Linz and Schölkens 1992; Schölkens et al. 1991; Weinberg et al. 1994). Weinberg et al. (1997) studied the effect of angiotensin AT1 receptor inhibition on hypertrophic remodelling and ACE expression in rats with pressure overload hypertrophy due to ascending aortic stenosis. A.6.0.1.2 Chronic Heart Failure in Rats PURPOSE AND RATIONALE Rat models of heart failure were reviewed by Muders and Elsner (2000). Chronic heart failure can be induced in rats by occlusion of coronary arteries. One of the first reports was by Selye et al. (1960). More recent reports are by Pfeffer et al. (1979), Hodsman et al. (1988), Van Veldhuisen et al. (1994, 1995), Kajstura et al. (1994), Gomez et al. (1997), Liu et al. (1997a, 1997b), and Jadavo et al. (2005). Itter et al. (2004) described a model of chronic heart failure (CHF) in spontaneously hypertensive rats. PROCEDURE Study Design Adult male 4-month-old SHR/NHsd and WKY/NHsd rats (Harlan Sprague Dawley, Winkelmann, Germany) weighing 250–300 g were used. Cardiovascular failure was induced by permanent (8 weeks) occlusion of the left coronary artery 2 mm distal to the origin from the aorta resulting in a large infarction of the free left ventricular wall. Eight weeks after surgery, parameters indicating CHF were measured. Cardiac hypertrophy, function, and geometric properties were determined by the “working heart” mode and in vivo determinations by MRI and heart weight. Hydroxyproline/proline ratio was measured as an indicator of heart fibrosis. Surgery The rats were anesthetized with a mixture of ketamine/xylazine (35/2 mg/kg) i.p. The left ventrolateral thorax was shaved and prepared to create a disinfected surgical access area. When a stable anesthesia was achieved the animals were placed on a small animal operation table, intubated and ventilated with room air using a small animal ventilator (KTR-4, Hugo Sachs Elektronik, March-Hugstedten, Germany). The level of anesthesia was deemed as adequate following loss of the pedal withdrawal reflex and absence of the palpebral reflex. The tidal volume was adjusted at 3–5 ml and the ventilation rate was 40 breaths/min. Left thoracotomy was performed via the third intercostal space. The heart was exposed and the pericardium opened. The left main coronary artery was ligated with Perma-Hand silk 4–0 USP (Ethicon, Norderstedt, Germany) near its origin at the aorta (2 mm distal to the edge of the left atrium). Ligation resulted in infarction of the free left ventricular wall. Ligation was deemed successful when the anterior wall of the left ventricle turned pale. At this point the lungs were hyperinflated by increasing the positive endexpiratory pressure, and the chest was closed. The rats were placed on a heating pad. They were continuously monitored until they start moving in their cages. To avoid ventricular arrhythmias, lidocaine (2 mg/kg i.m.) was given before surgery. The sham procedure consisted of opening the pericardium and placing a superficial suture in the epicardium of the LV. To prevent acute lung edema, the rats received furosemide 2 mg/kg twice daily for 3 days via the drinking water. Measurements at the End of the Study Before killing the animals 8 weeks after MI, non-invasive sequential nuclear magnetic resonance (NMR) measurements of heart geometric properties were done. Thereafter the animals were anesthetized with pentobarbitone (180 mg/kg i.p.) and subsequently heparinized (Heparin sodium 500 IU/100 g body weight i.p.). Once stable anesthesia was achieved (stage III 3, reflexes absent), the animals were connected to an artificial respirator via a PE tube inserted into the trachea and ventilated with room air. The right carotid artery was cannulated with a polyethylene catheter to monitor mean blood pressure, systolic blood pressure, diastolic blood pressure and heart rate over a stable time course of 10 min. A transverse laparotomy and a right anterolateral thoracotomy were performed, and the heart was rapidly removed for the evaluation of its function in the working heart mode. Thereafter the heart weight, and the left and right ventricular weights were determined. For infarct size determination the left ventricle was sectioned transversely into four slices from the apex to the base. The infarct size was determined by planimetry and expressed as a percentage of LV mass. Lung weight and further lung histology sections were evaluated. Hydroxyproline/proline ratio was determined in paraffin-embedded slices of the left ventricle. Magnetic Resonance Imaging The animals were monitored by MRI at day 7 and day 42 post-MI. The rats were anesthetized with a mixture of 1 % halothane and 30/70 N2O/oxygen with a specially manufactured rat mask. The fully anesthetized rats (phase III 3) were placed on a cradle made of Plexiglas in a supine position. Respiration and ECG were monitored continuously. MRI experiments were performed according to Rudin et al. (1991). The images were acquired by a spinecho sequence SE (500/20), the field of view was 50 mm, the image resolution was 256 × 256 pixels with a dimension of 0.2 × 0.2 mm. Four adjacent transverse slices were recorded; slice thickness was 1.5 mm. Before the acquisition of data, a coronary pilot scan was measured for adequate positioning of the transverse slices. MRI data acquisition was gated to the cardiac cycle by a Physiograd SM 785 MR monitoring system (Bruker, Karlsruhe, Germany). Two sets of transverse images were acquired, one at end-systole and another at enddiastole. End-diastole was defined as the image obtained 8 ms after the onset of the R wave of the ECG, corresponding to the largest cavity area. End-systole was defined as the image with the smallest LV cavity area. The image analysis was done using Bruker software (Karlsruhe, Germany). The parameters of left ventricular end-diastolic volume (LVEDV), left ventricular end-systolic volume (LVESV), septum size, infarct size, ejection fraction (EF), left ventricular chamber diameter (r) and circumference were measured. EF was estimated in percentage terms by the subtraction LVEDV-LVESV. After the procedure the rats were ventilated with oxygen, the mask was replaced, and they were brought back into their cages. They were monitored until they started moving in the cage. Blood Pressure/Heart Rate The animals were anesthetized with pentobarbitone (180 mg/kg i.p.) and subsequently heparinized (Heparin sodium 500 IU/100 g body weight i.p.). Once stable anesthesia was achieved, the animals were connected to an artificial respirator via a PE tube inserted into the trachea and ventilated with room air. The right carotid artery was cannulated with a polyethylene catheter. The catheter was connected to a PLUGSYS measuring system (Hugo Sachs Elektronik, March Hugstedten, Germany) to monitor mean blood pressure, systolic blood pressure, diastolic blood pressure and heart rate over a stable time course of 10 min. Working Heart For the final investigations, the heart of the anesthetized rat was rapidly removed and immersed in physiological buffer chilled to 4 °C. The aorta was dissected free and mounted onto a cannula (internal diameter: 1.4 mm) attached to a perfusion apparatus. The hearts were perfused according to the method of Langendorff with an oxygenated (95 % O2/5 % CO2) noncirculating Krebs-Henseleit solution of the following compositions (mM): NaCl, 118; KCl, 4.7; CaCl2,2.52; MgSO4, 1.64; NaHCO3, 24.88; KH2PO4, 1.18; glucose, 5.55; and Na-pyruvate, 2.0 at a perfusion pressure of 60 mmHg. Any connective tissue, thymus or lung was carefully removed. A catheter placed into the pulmonary artery drained the coronary effluent perfusate that was collected for the determination of coronary flow and venous pO2 measurements. The left atrium was cannulated via an incision of the left auricle. All pulmonary veins were ligated close to the surface of the atria. When a tight seal with no leaks had been established and after a 15-min equilibration period, the hearts were switched into the working mode, using a filling pressure (preload) of 12 mmHg in WKY/NHsd and 18 mmHg in SH rats. The afterload pressure was 60 mmHg in WKY/NHsd and 80 mmHg in SH rats. After validation of the basis parameters the afterload pressure was enhanced in a cumulative manner from an additional 20 mmHg to 140 mmHg. Thereafter the isovolumetric maxima were determined by enhancing the preload pressure in steps of 5 mmHg to 30 mmHg. Flow and pressure signals for computation were obtained from the PLUGSYS-measuring system. Computation of data was performed with a sampling rate of 500 Hz, averaged every 2 s, using the software Aquire Plus V1.21f (PO-NE-MAH, Hugo Sachs Elektronik, March-Hugstedten, Germany). Determination of Infarct Size After the evaluation of the external heart work, the total heart weight, the left and right ventricular weights were determined. The left ventricle was then sectioned transversely into four slices from the apex to the base. Eight pictures were taken of each rat heart, two from each slice. Total infarct size was determined by planimetry of the projected and magnified slices. The area of infarcted tissue as well as the intact myocardium of each slice were added together and averaged. The infarcted fraction of the left ventricle was calculated from these measurements and expressed as a percentage of the LV mass. The left ventricular perimeter, diameter, infarct scar length, as well as wall thickness and infarct wall thinning were determined as well. According to Pfeffer et al. (1985) and Pfeffer and Pfeffer ( 1987), rats with infarct sizes < 20 % and > 40 % were excluded from the study. Lung Histological Determination After lung weight determination, the organ was immersed in 4 % formalin (pH 7.0–7.5; 0.1 M). The lung was cut into small pieces, dehydrated and embedded in paraffin. Hematoxylin and eosin (HE) sections were evaluated by light microscopy. Hydroxyproline/Proline Ratio After embedding, the rest of the fixed left ventricular tissue was freeze-dried. Proline and hydroxyproline was then analyzed according to the method of Lόpez de Leόn and Rojkind (1985) and the ratio of both were calculated. MODIFICATIONS OF THE METHOD Jain et al. (2000) studied the effects of angiotensin II receptor blockade after coronary ligation and exercise training on treadmill in rats. Medvedev and Gorodetskaya (1993) induced heart failure in rats by microembolization of coronary vessels with 15-μm plastic microspheres. Katona et al. (2004) found that selective sensory denervation by capsaicin aggravates adriamycin-induced cardiomyopathy in rats. A simple and rapid method of developing high output heart failure and cardiac hypertrophy in rats by producing aortacaval shunts was described by Garcia and Diebold (1990). Rats weighing 180–200 g were anesthetized with 30 mg/kg i.p. pentobarbitone. The vena cava and the abdominal aorta were exposed by opening the abdominal cavity via a midline incision. The aorta was punctured at the union of the segment two-thirds caudal to the renal artery and one-third cephalic to the aortic bifurcation with an 18-gauge disposable needle. The needle was advanced into the aorta, perforating its adjacent wall and penetrating in the vena cava. A bulldog vascular clamp was placed across the aorta caudal to the left renal artery. Once the aorta was clamped, the needle was fully withdrawn and a drop of cyanoacrylate glue was used to seal the aorta-punctured point. The clamp was removed 30 s later. The patency of the shunt was verified visually by swelling vena cava and the mixing of arterial and venous blood. The peritoneal cavity was closed with silk thread stitches and the skin with metallic clips. Rats with aorta-caval shunts developed cardiac hypertrophy with significantly higher absolute and relative heart weights. Other studies with aortocaval shunts in rats were published by Flaim et al. (1979) and Liu et al. (1991). Isoyama et al. (1988) studied myocardial hypertrophy after creating aortic insufficiency in rats. Terlink et al. (1998) studied ventricular dysfunction in rats with diffuse isoproterenol-induced myocardial necrosis. Sabbah et al. (1991) described a model of chronic heart failure produced by multiple sequential coronary microembolizations in dogs. A.6.0.2 Cardiac Hypertrophy and Insufficiency in Mice A.6.0.2.1 Cardiac Hypertrophy in Mice PURPOSE AND RATIONALE Rockman et al. (1991, 1993) developed a model of ventricular hypertrophy in the intact mouse by use of microsurgical techniques. PROCEDURE Eight-week-old adult mice weighing 18–22 g are anesthetized by intraperitoneal injection of a mixture of 100 mg/kg ketamine, 5 mg/kg xylazine, and 2.5 mg/kg morphine. Animals are placed under a dissecting microscope in the supine position and a midline cervical incision is made to expose the trachea and carotid arteries. After endotracheal intubation, the cannula is connected to a volume cycled rodent ventilator on supplemental oxygen with a tidal volume of 0.2 ml and a respiratory rate of 110 per min. Both left and right carotid arteries are cannulated with flame stretched PE50 tubing. Catheters are connected to modified P50 Statham transducers. The chest cavity is entered in the second intercostal space at the left upper sternal border through a small incision and the thymus is gently deflected out of the field of view to expose the aortic arch. After the transverse aorta is isolated between the carotid arteries, it is constricted by a 7.0 nylon suture ligature against a 27-gauge needle, the latter being promptly removed to yield a constriction of 0.4 mm diameter and provide a reproducible transverse aortic constriction of 65–75 %. The hemodynamic effects of acute and chronic constriction are followed by monitoring the pressure gradient between the two carotid arteries in anesthetized animals. Systolic and mean arterial pressure at baseline, during total occlusion when the ligature is tied, and early (15 min) and late (7 days) after transverse aortic constriction are recorded. The increase in systolic pressure provides an adequate mechanical stimulus for the development of cardial hypertrophy. To confirm myocardial hypertrophy, both shamoperated and aortic-constricted hearts are examined 7 days after operation. Hearts examined for cell size are perfused with 4 % paraformaldehyde/1 % glutaraldehyde through the apex, immersed in osmium tetroxide, dehydrated in graded alcohols, and embedded in araldite. Tissue blocks are sectioned at a thick- ness of 1 μm, mounted on slides, and stained with toluidine blue. Cell areas are measured by manually tracing the cell outline on an imaging system connected to a computer. At the end of the experiment, mice were sacrificed in anesthesia, heart excised and weighed, the atria and ventricles separately frozen in liquid nitrogen for Northern blot analysis. Total RNA is extracted by a single step extraction with guanidinium thiocyanate. The RNA is size fractionated by agarose gel electrophoresis, transferred to nylon membranes by vacuum blotting, and hybridized with the appropriate complementary DNA probes labeled with 32P by random priming to a specific activity of 0.95 – 1.2 × 106 cpm/ng. EVALUATION Variables measured are expressed as mean ± SD. Statistical significance of differences between shamoperated and thoracic aortic-constricted animals is assessed by Student’s t-test. MODIFICATIONS OF THE METHOD Dom et al. (1994) studied myosin heavy chain regulation and myocytes’ contractile depression after LV hypertrophy in aortic-banded mice. Okada et al. (2004) subjected mice to transverse aortic constriction. Echocardiographic analysis demonstrated cardiac hypertrophy and failure 1 and 4 weeks after surgery. Cardiac expression of endoplasmatic reticulum chaperones was significantly increased indicating that pressure overload by transverse aortic constriction induced prolonged endoplasmatic reticulum stress. A.6.0.2.2 Chronic Heart Failure in Mice PURPOSE AND RATIONALE Several authors reported the development of murine models of cardiac failure (Kaplan et al. 1994; Rockmanet al. 1994; Balasubramaniam et al. 2004; Suzuki et al. 2004;Walther et al. 2004;Wang et al. 2004; Liaoet al. 2005). Xu et al. (2004) studied cardioprotection in mice with heart failure by dual inhibition of angiotensinconverting enzyme (ACE) and neutral endopeptidase (NEP). PROCEDURE Mice with a targeted deletion of the B2kinin receptor gene or C57BL/6 J mice at an age of 10–12 weeks were anesthetized with 50 mg/kg sodium pentobarbital i.p., intubated and ventilated with room air using a positive-pressure respirator. A left thoracotomy was performed via the fourth intercostal space; the lungs were retracted to expose the heart, and the pericardium was opened. The left anterior descending coronary artery was ligated with an 8–0 nylon suture near its origin between the pulmonary outflow tract and the edge of the left atrium. Acute myocardial ischemia was considered successful when the anterior wall of the left ventricle turned pale and an obvious ST segment elevation was observed. The lungs were inflated by increasing positive end-expiratory pressure and the thoracotomy site was closed. Sham-operatedmice weresubjected to the same procedure except that the suture around the left anterior coronary artery was not tied.Systolic blood pressure was measured in conscious mice using a non-invasive computerized tail-cuff system. Cardiac geometry and function were evaluated with a Doppler echocardiographic system. LV diastolic dimensionwas measured and ejection fraction was calculated from [(LVAd – LVAs)/LVAd] × 100, where LVAd is LV diastolic area and LVAs is LV systolic area. Four weeks after surgery, each strain was separated into one group treated with an ACE inhibitor, one group treated with a NEP inhibitor, one group treated with both inhibitors and one control group. All drugs were administered in drinking water for 20 weeks. At the end of the study, all mice were anesthetized with pentobarbital and the heart stopped at diastoleby intraventricular injection of 15 % KCl. The heart, lungs, and liver were weighed to assess hypertrophy and congestion. Infarct size was determined by Gomori trichrome staining and expressed as the ration of the infarcted portion to total LV circumference. Sections (6 μm) from each slice were doublestained with fluorescein-labeled peanut agglutinin to delineate the myocyte cross-sectional area and interstitial space and rhodamine-labeled Griffonia simplicifolia lectin I to show the capillaries. To calculate interstitial collagen fraction, the total surface area (microscopic field), interstitial space (collagen plus capillaries), and area occupied by capillaries alone were measured by computer-assisted videodensometry. After 20 weeks of treatment, plasma renin was measured. by intraventricular injection of 15 % KCl. The heart, lungs, and liver were weighed to assess hypertrophy and congestion. Infarct size was determined by Gomori trichrome staining and expressed as the ration of the infarcted portion to total LV circumference. Sections (6 μm) from each slice were doublestained with fluorescein-labeled peanut agglutinin to delineate the myocyte cross-sectional area and interstitial space and rhodamine-labeled Griffonia simplicifolia lectin I to show the capillaries. To calculate interstitial collagen fraction, the total surface area (microscopic field), interstitial space (collagen plus capillaries), and area occupied by capillaries alone were measured by computer-assisted videodensometry. After 20 weeks of treatment, plasma renin was measured. EVALUATION Data were expressed as mean ± SE. Mortality rates were compared using χ2 tests. For the echo, blood pressure, heart weight, lung weight, infarct size, plasma renin concentration, and histology data, paired or two-sample tests using non-parametric methods were used to perform all comparisons of interest. A.6.0.2.3 Transgenic Mice and Heart Failure PURPOSE AND RATIONALE Several hundreds of papers on transgenic mice and heart failure are published. Only a few can be mentioned here. Chien (1995) described cardiac muscle diseases in genetically engineered mice. Edwards et al. (1996) described severe cardiomyopathy in transgenic mice overexpressing the skeletal muscle myogenic regulator myf5. Arber et al. (1997) found that MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Graham et al. (1997) described a mouse model for mitochondrial myopathy and cardiomyopathy resulting from a deficiency in the heart/muscle isoforms of the adenine nucleotide translocator. Iwase et al. (1997) studied cardiomyopathy in transgenic mice induced by overexpression of the cardiac stimulatory G protein α subunit. Knollmannn et al. (2000) reported remodeling of ionic currents in hypertrophied and failing hearts of transgenic mice overexpressing calsequestrin. Beggah et al. (2002) described reversible cardiac fibrosis and heart failure induced by conditional expression of an antisense mRNA of the mineralocorticoid receptor in cardiomyocytes. Verheule et al. (2004) found increased vulnerability to atrial fibrillation in transgenic mice with selective atrial fibrosis caused by overexpression of TGF-β1. Duncan et al. (2005) found that chronic xanthine oxidase inhibition prevents myofibrillar protein oxidation and preserves cardiac function in a transgenic mouse model of cardiomyopathy. Hartil and Charron (2005) reviewed mouse models where transgenic technology has been utilized to alter expression of genes involved in cardiac uptake and metabolism of either lipid or carbohydrate. Hilfiker-Kleiner et al. (2005) reported that STAT3- knockout mice harboring a cardiomyocyte-restricted deletion of STAT3 showed enhanced susceptibility to cardiac injury caused by myocardial ischemia, systemic inflammation, or drug toxicity. Sanbe et al. (2005) studied reversal of amyloid-induced heart disease in desmin-related cardiomyopathy. A.6.0.3 Cardiac Insufficiency in Guinea Pigs ... PURPOSE AND RATIONALE Congestive heart failure in man is characterized by cardiac hypertrophy, peripheral edema, lung and liver congestion, dyspnea, hydrothorax and ascites. Effective treatment is achieved by cardiac glycosides. Based on techniques reported by Selye et al. (1960) a method was developed to induce congestive heart failure in guinea pigs with symptoms very close to human pathology (Vogel and Marx 1964; Vogel et al. 1965). PROCEDURE Male guinea pigs weighing 250–400 g are used. The fur at the ventral thorax is shaved and the skin disinfected. The animal is anesthetized with ether. The skin is cut with scissors on the left side at a length of 4 cm. The left musculus pectoralis is cut at the costal insertion and elevated. The forth intercostal space is opened with two blunted forceps. The heart is pressed against the opening with the left hand. The pericardium is opened with a fine forceps and pulled back to the basis of the heart. The beating heart is extruded from the thorax wound by pressure with the left hand on the right thorax wall. A ring-shaped clamp covered with a thin rubber tube is placed around the basis of the heart keeping the heart outside of the thorax without closing off the blood circulation. A thread soaked with diluted disinfectant solution is placed as a loop around the apex of the heart and tightened so that the apical third of both ventricles is tied off. The degree of tightening of the loop is essential. Complete interruption of blood supply to the apical third resulting in necrosis has to be avoided as well as the loop’s slipping off. Technical skill is necessary to place the loop around the beating heart into the correct position. After removal of the clamp the heart is placed back, the incision between the forth and fifth costal rib closed and the musculus pectoralis placed over the wound. Intrathoracal air forming a pneumothorax is removed by pressure on both sides of the thorax. After application of an antibiotic emulsion the skin wound is closed. The surgical procedure has to be finished within a short period of time. The animals develop symptoms of severe congestive heart failure with a death rate of 80 % within 14 days. Lung weight and relative heart weight are significantly increased. Exudate in the thorax cavity and ascites amount between 3.5 and 7.5 ml with extreme values of 17.5 ml. Lung edema and liver congestion are found histologically. Peripheral edema and preterminal dyspnea and tachypnea are observed.When treated with various doses (0.1 to 100 μg/kg) of cardiac glycosides s.c. or i.m. over a period of 14 days the symptoms of cardiac insufficiency, e. g., volumes of transudate as well as death rate, are dose-dependent diminished. EVALUATION From survival rate, ED 50 values of cardiac glycosides can be calculated which are in the same dosage range as therapeutic doses in man. CRITICAL ASSESSMENT OF THE METHOD The experimental model in guinea pigs reflects very closely the symptoms of cardiac insufficiency in man, e. g., lung congestion, hydrothorax, liver congestion, ascites, peripheral edema and cardiac hypertrophy.The therapeutic potency of cardiac glycosides can be evaluated with this method. Additional factors being known to enhance the symptoms of congestive heart failure in man, like salt load and diphtheria toxin, further increase mortality and hydropic symptoms. The method can be used for special purposes, however, it needs considerable training and technical skill. MODIFICATIONS OF THE METHOD Siri et al. (1989, 1991) produced left ventricular hypertrophy in the guinea pig by gradually increasing ventricular afterload. A mildly constricting band was placed around the ascending aorta of very young guinea pigs (225–275 g). With growth to 500–1000 g, left ventricular systolic pressure increased and ventricular hypertrophy developed. Only some of the animals developed dyspnea and severe ventricular dysfunction. Kiss et al. (1995) studied the effects on Ca2+ transport and mechanics in compensated pressure-overload hypertrophy and congestive heart failure in guinea pigs. The descending aorta was banded for 4 and 8 weeks in adult guinea pigs. Tweedle et al. (1995) assessed subrenal banding of the abdominal aorta as a method of inducing cardiac hypertrophy in the guinea pig. Pfeffer et al. (1987) induced myocardial infarction in rats by ligation of the left coronary artery and found hemodynamic benefits and prolonged survival with long-term captopril therapy. Acute ischemic left ventricular failure can be induced in anesthetized dogs by repeated injections of plastic microspheres into the left coronary artery (see A.3.2.4). Huang et al. (1997) created congestive heart failure in sheep by selective sequential intracoronary injection of 90 μm microspheres under 1.5 % isofluorane injection. A.6.0.4 Cardiomyopathic Syrian Hamster ... PURPOSE AND RATIONALE Cardiomyopathy in Syrian hamsters has been described by Bajusz et al. (1966), Bajusz and Lossnitzer (1968), Bajusz (1969), Bajusz et al. (1969a, b), Homburger and Bajusz (1970), Gertz (1972). The disease originates from an autosomal, recessively transmissible disorder, which leads to degenerative lesions in all striated muscles and in particular in the myocardium. Histopathological changes consist of myocytolytic necrosis followed by fibrosis and calcification. The evolution of the cardiomyopathic disease can be characterized by five distinct phases: A prenecrotic stage, in which no pathology is evident, a time of active myocytolysis and cellular necrosis, a phase of fibrosis and calcium deposition, an overlapping period of reactive hypertrophy of the remaining viable myocytes, and a final stage of depressed myocardial performance and failure. PROCEDURE The model of cardiomyopathy in Syrian hamsters has been used by several authors. One has to note, that several strains of cardiomyopathic hamsters have been used: strain Bio 53:58 by Capasso et al. (1989, 1990) and by Chemla et al. (1992, 1993), strain BIO 14.6 by Tapp et al. (1989) and by Sen et al. (1990), strain CHF 146CM by van Meel et al. (1989) and by Haleen et al. (1991), strain BIO82.62 by ver Donck et al. (1991), strain J-2-N by Kato et al. (1992), strain CHF 147 by Desjardins et al. (1989), Hanton et al. (1993). Various experimental protocols have been described. Most authors use survival rate and heart weight as end point (e. g., van Meel et al. 1989; ver Donck et al. 1991; Hanton et al. 1993). Generally, the experiments are started with animals at an age of 120 to 200 days. Capasso et al. (1989, 1990) studied the mechanical and electrical properties of cardiomyopathic hearts of Syrian hamsters using isolated left ventricular posterior papillary muscles. Tapp et al. (1989) tested stress-induced mortality in cardiomyopathic hamsters by five consecutive daily 2- h periods supine immobilizations at 4 °C. Sen et al. (1990) tested the inotropic and calcium kinetic effects of calcium channel agonists and antagonists in primary cultures of isolated cardiac myocytes. Haleen et al. (1991) tested the effects of an angiotensin converting enzyme inhibitor not only on survival, but also on left ventricular failure in the isolated Langendorff heart by measurement of left ventricular end-diastolic pressure, dP/dt max andmean coronary flow. Dixon et al. (1997) tested the effect of an AT1 receptor antagonist on cardiac collagen remodelling in the cardiomyopathic Syrian hamster. In addition to the effects on left ventricular papillary muscles strips, Chemla et al. (1992) tested the effects on diaphragm contractility in the cardiomyopathic Syrian hamster. Whitmer et al. (1988) and Kuo et al. (1992) tested sarcolemmal and sarcoplasmatic reticulum calcium transport in the cardiomyopathic Syrian hamster. Nigro et al. (1997) identified the Syrian hamster cardiomyopathy gene. Tanguay et al. (1997) tested the coronary and cardiac sensitivity to a vasoselective benzothiazepine-like calcium antagonist in isolated, perfused failing hearts of Syrian hamsters. Bilate et al. (2003) recommended the Syrian hamster as a model for the dilated cardiomyopathy of Chagas’ disease. Female hamsters were infected via the intraperitoneal route with Trypanosoma cruzi Y strain blood trypomastigotes. Survival was monitored, echocardiography was performed after 4 and 12 months, and histopathological examinations were carried out at the end of the study period. CRITICAL ASSESSMENT OF THE METHOD Positive effects of various drugs have been found in the cardiomyopathic hamster, such as cardiac glycosides, inotropic compounds, beta-blockers, calcium antagonists, and ACE-inhibitors. The specificity of the effects has to be challenged. MODIFICATIONS OF THE METHOD The tight-skin (TSK) mouse is a genetic model of pulmonary emphysema connected with right ventricular hypertrophy (Martorana et al. 1990; Gardi et al. 1994). A.6.0.5 Cardiac Failure in Rabbits ... PURPOSE AND RATIONALE Rabbit models of heart failure were reviewed by Muders and Elsner (2000). Rapid pacing was used by Masaki et al. (1994), Porsa et al. (1994), Eble et al. (1998), Li et al. (2003), and Rose et al. (2005); coronary artery ligation by Pennock et al. (1997), Currie and Smith (1999), Romanic et al. (2001), and Miller et al. (2004); combined pressure and volume overload by Ezzaher et al. (1991), Mohammadi et al. (1997), Dekker et al. (1998), and Baartscheer et al. (2003a, 2003b); aortic insufficiency and aortic constriction by Bouanani et al. (1991) and Pogwizd et al. (1999); regurgitation after damage of the mitral valve by Gunawardena et al. (1999); regurgitation after aortic valve destruction by Magid et al. (1988, 1994), Yoshikawa et al. (1993), King et al. (1997), and Liu et al. (1998); Luchner et al. (2001) used a rabbit model of progressive left ventricular dysfunction to investigate differential expression of cardiac atrial natriuretic peptide and brain natriuretic peptide. Ventricular pacing-induced heart failure could be induced with a transvenously implanted pacemaker system. PROCEDURE Male rabbits (chinchilla bastard) underwent implantation of a programmable cardiac pacemaker (Medtronic Minix 8340, Minneapolis, Mn., USA). Under anesthesia (ketamine 60 mg/kg xylazine 5 mg/kg i.m.), the right internal jugular vein was dissected and cannulated with a single-lumen central venous catheter (Braun, Germany). The catheter was then advanced into the right ventricle under pressure guidance. A transvenous screw-in pacemaker lead (Medtronic) was advanced through the catheter into the ventricular apex and implanted endocardially. The pacemaker was implanted subcutaneously into the right abdominal wall and the pacemaker lead was connected subcutaneously with the pacemaker. Rapid ventricular pacinginduced heart failure could be induced with a transvenously implanted pacemaker system. All rabbits were allowed to recover for at least 10 days after surgery before the pacemaker was started for the induction of heart failure. Proper pacemaker function was checked intraoperatively, at the time of programming, and subsequently all 10 days. Rabbits (CHF group) underwent pacing with a stepwise increase of stimulation frequencies over 30 days. During the first 10 days, animals were paced at 330 beats/min (bpm). This protocol results in ELVD, as defined by significant LV systolic dysfunction with cardiac enlargement and decreased perfusion pressure but no clinical signs failure The pacing rate was then increased to 360 bpm for 10 days and 380 bpm for another 10 days and ELVD evolved to CHF with further cardiac enlargement and further decreased perfusion pressure together with clinical signs of fluid retention (ascites). At baseline (control), after being paced at 330 bpm for 10 days (ELVD) and at the end of the protocol (CHF), conscious arterial pressure was measured invasively via the medial ear artery and a 2-D guided M-mode echocardiogram was obtained. At the end of the pacing protocol, rabbits were killed by i.v. euthanasia and tissue was rapidly harvested. Hearts were trimmed on ice, snap frozen in liquid nitrogen and stored at –80oC until further processing. Echocardiography A long and short-axis echocardiogram (HP Sonos 5500, 12 MHz probe) was performed under light sedation (5 mg midazolam i.m.) in a supine position from the left parasternal window. LV end-diastolic (LVEDd) and end-systolic (LVESd) dimensions and diastolic and systolic thickness of the left ventricular anterior wall (AEDth and AESth) and posterior wall (PEDth and PESth) as well as left atrial diameter (LAd) were determined from three repeated 2-D guided M-mode tracings using the ASE convention. From those measurements, fractional shortening (FS) was calculated as: FS = (LVEDd– LVESd) /LVEDd. Analytical methods For analysis of cardiac natriuretic peptide expression, mRNA was extracted from all atrial and left ventricular samples utilizing a commercial kit (Fasttrack, Invitrogen). As a probe for brain natriuretic peptide (BNP), a 750-bp EcoR1/HindIII DNA restriction fragment containing the gene for rabbit BNP was used. EVALUATION Results of the quantitative studies were expressed as mean ±SEM. Comparisons between the control, ELVD and CHF groups were performed by analysis of variance (ANOVA) followed by Fisher’s least significant difference test. Comparison between the atrial and LV tissues as well as between atrial natriuretic peptide (ANP) and BNP were performed by paired Student’s t-test. Statistical significance was defined as P < 0.05. MODIFICATIONS OF THE METHOD Arnolda et al. (1985) studied adriamycin cardiomyopathy in the rabbit. Klimtova et al. (2002) performed a comparative study of chronic toxic effects of daunorubicin and doxorubicin in rabbits. Alexander et al. (1993) studied electrographic changes following corona-virus-induced myocarditis and dilated cardiomyopathy in rabbits. Sanbe et al. (2005) described a transgenic model for human troponin I-based hypertrophic cardiomyopathy in the rabbit. A.6.0.6 Congestive Heart Failure in Dogs ... PURPOSE AND RATIONALE Several methods are described, to induce congestive heart failure in dogs, such as rapid ventricular pacing (Armstrong et al. 1986; Freeman et al. 1987; Wilson et al. 1987; Komamura et al. 1992, 1993; Perreault et al. 1992; Travill et al. 1992; Cheng et al. 1993; Redfield et al. 1993; Cory et al. 1994; Kiuchi et al. 1994; Ohno et al. 1994; Vatner et al. 1994;Wang et al. 1994; Williams et al. 1994; Eaton et al. 1995; Spinale et al. 1995; Wolff et al. 1995; Zile et al. 1995; Ravens et al. 1996; Shinbane et al. 1997; O’Rourke et al. 1999; Winslow et al. 1999). Luchner et al. (1996) assessed circulating, renal, cardiac, and vascular angiotensin II in a canine model of rapid ventricular pacing-induced heart failure that evolves from early left ventricular dysfunction to overt congestive heart failure. PROCEDURE Male mongrel dogs underwent implantation of a programmable cardiac pacemaker (Medtronic). Under pentobarbital sodium anesthesia and artificial respiration, the heart was exposed via a small left lateral thoracotomy and pericardiotomy, and a screw-in epicardial pacemaker lead was implanted into the right ventricle. The pacemaker was implanted subcutaneously into the left chest wall and connected to the pacemaker lead. The dogs were allowed to recover for at least 10 days after surgery before the pacemaker was started. During the first 10 days dogs were paced at 180 beats/min (bpm), resulting in early left ventricular dysfunction as defined by significant systolic dysfunction with decreased cardiac output, cardiac enlargement, and increased filling pressures but maintained systemic perfusion pressure and renal sodium excretion and no clinical signs of heart failure. The pacing rate was then increased weekly to 200, 210, 220 and 240 bpm, and early left ventricular dysfunction evolved to overt congestive heart failure with avid sodium retention and clinical signs of congestion. At baseline (control), after dogs had been paced at 180 bpm for 10 days and at the end of the protocol (overt CHF), urine was collected for measurement of sodium excretion; conscious mean arterial pressure was measured via a port catheter; a 2-D guided Mmode echogram was obtained; and arterial blood was drawn. Cardiac filling pressures and cardiac output were measured by the thermodilution method at baseline and at the end of the protocol. Arterial blood was collected in EDTA tubes for measurement of ANP, BNP, cGMP, PRA, aldosterone, and Ang II. After euthanasia, hearts were rapidly trimmed and left ventricles weighted for calculation of the index LV weight to body weight. EVALUATION Results were expressed as mean ±SE. Comparison between the control, early LV dysfunction, and overt CHF were performed by ANOVA followed by Fisher’s least significant difference test. MODIFICATIONS OF THE METHOD Kleaveland et al. (1988) and Nagatsu et al. (1994) used the technique of experimental mitral regurgitation in dogs to induce left ventricular dysfunction. A 30-cm, 7 F sheath was introduced across the aortic valve through the carotid artery. A urologic calculus retrieval forceps was advanced through the sheath to the mitral valve apparatus and was used to sever chordae tendineae. When pulmonary capillary wedge pressure rose to 20 mmHg and forward stroke volume was reduced to 50 % of its baseline, a ventriculogram was performed to confirm angiographically that severe mitral regurgitation had been created. Dell’Italia et al. (1995) and Su et al. (1999) induced mitral regurgitation by percutaneous chordal rupture in dogs. Kinney et al. (1991) published a method to induce acute, reversible tricuspid insufficiency in anesthetized dogs. A wire spiral is advanced through the atrioventricular canal from the right atrium. The spiral causes regurgitation by preventing complete apposition of the valve leaflets while permitting retrograde flow to occur through the spiral lumen. The degree of regurgitation can be controlled by the use of spirals of different size. Creation of tricuspid insufficiency was demonstrated by onset of right atrial pressure V waves, a ballooning of the right atrium during ventricular systole, palpation of an atrial thrill, or by color Doppler echocardiography. The model is reversible and allows repeated trials of various grades of regurgitation. Carlyle and Cohn (1983) described a non-chirurgical model of chronic left ventricular dysfunction. The method is accomplished by repetitive DC shock with a guidewire introduced percutaneously and positioned in the left ventricle along the intraventricular septum and an external paddle at the left ventricular apex. McDonald et al. (1992) produced localized left ventricular necrosis without obstruction of the coronary blood flow in dogs by transmyocardial direct-current shock. Sabbah et al. (1991, 1993, 1994) and Gengo et al. (1992) produced chronic heart failure in dogs by multiple sequential intracoronary embolizations with microspheres. The dogs underwent three to nine intracoronary embolizations with polystyrene latex microspheres (70–102 μm in diameter) performed 1–3weeks apart. Embolizations were discontinued when left ventricular ejection fraction was less than 35 %. Vanoli et al. (2004) used multiple coronary microembolizations in dogs, whereby three to nine embolizations were performed 1 week apart. The first three embolizations consisted of 2 ml of microsphere suspension injected subselectively into either the left anterior descending or left circumflex coronary artery in an alternating fashion. Subsequent embolizations consisted of 3–6 ml of microspheres divided equally between the left anterior descending or left circumflex coronary artery until LV ejection fraction was < 35 %. Magovern et al. (1992) described a canine model of left ventricular dysfunction caused by five weekly intracoronary infusions of adriamycin. Koide (1997) described premorbid determinants of left ventricular dysfunction in a model of gradually induced pressure overload in dogs. Mongrel dogs were studied through 8 weeks of gradually imposed ascending aortic constriction with the use of a novel banding technique. During banding, an initial gradient of 30 mmHg was created. Before banding, at 2, 4, and 6 weeks after banding, hemodynamics and left ventricular mechanics were examined at cardiac catheterization; then the pressure overload was increased by tightening the band. Valentine et al. (1988) and Devaux et al. (1993) described X-linked muscular dystrophy in dogs with cardiac insufficiency similar to Duchenne muscular dystrophy in men and recommended this as an animal model for cardiac insufficiency. A.6.0.7 Cardiac Failure in Pigs ... PURPOSE AND RATIONALE Cardiac failure was studied in pigs using several experimental procedures. Chow et al. (1990) recommended rapid ventricular pacing in pigs as an experimental model of congestive heart failure. Farrar et al. (1993) studied pacing-induced dilated cardiomyopathy in pigs. Congestive heart failure was produced by rapid ventricular pacing at 230 bpm for 1 week. Spinale et al. (1990a, 1990b, 1991, 1992) examined the consequences of chronic supraventricular tachycardia on various parameters of ventricular dysfunction and subendocardial changes in pigs. Carroll et al. (1995) investigated gene expression in a swine model of ventricular hypertrophy during pressure overload. Multani et al. (2001) studied long-term angiotensin converting enzyme and angiotensin I-receptor inhibition in pacing-induced heart failure in pigs. Heart failure was induced by rapid atrial pacing (240 bpm for 3 weeks). Kassab et al. (1993, 2000) investigated remodeling of right ventricular branches after hypertrophy in pigs. Krombach et al. (1999) studied the effects of amlodipine in congestive heart failure in pigs at rest and after treadmill exercise. PROCEDURE Left thoracotomy was performed in Yorkshire pigs in anesthesia. Catheters connected to a vascular access port were placed in the thoracic aorta, the pulmonary artery, and the left atrium. The access ports were then placed in a subcutaneous pocket. A 20-mm flow probe was placed around the pulmonary artery immediately distal to the pulmonary catheter and the electrical connection exteriorized through the thoracolumbar fascia. A shielded stimulating electrode was sutured onto the left atrium, connected to a programmable pacemaker and buried in a subcutaneous pocket. The thoracotomy was closed in layers and the pleural space evacuated of air. After a 14- to 21-day recovery, measurements were performed under normal resting conditions and after exercise. The pacemakers were activated to 240 bpm for a period of 21 days. During the last 3 days, one group was treated with drug, the other served as control. At the day of the study, electrocardiograms were performed, and the pacemakers deactivated. After a 30-min stabilization period, 2-D and M-mode echocardiographic studies were used to image the left ventricle from the parasternal approach. Left ventricular fractional shortening was calculated as (end-diastolic dimension – end-systolic dimension)/diastolic dimension, and was expressed as a percentage. The access ports were entered and pressures obtained using externally calibrated transducers. The flow probe was connected to a digital flowmeter. From the digitized flow signal, stroke volume was computed on a beat-to-beat basis and averaged for a minimum of 25 ejections. Pulmonary and systemic vascular resistances were computed as the mean pressure divided by cardiac output multiplied by the constant 80 to convert to resistance units of dyne· s·cm−5. Samples were drawn from the pulmonary artery and atrial catheters for measurement of oxygen saturation and hemoglobin content. The plasma samples were assayed for renin activity, endothelin concentration, and catecholamine levels. EVALUATION Results were presented as mean ±SEM. Pairwise tests of individual group means were compared using Bonferroni probabilities. MODIFICATIONS OF THE METHOD Zhang et al. (1996) studied functional and bioenergetic consequences of post-infarction left remodeling in a porcine model. Proximal left coronary artery occlusion was used to generate a myocardial infarction in young pigs. The animals were then followed over several months while remodeling of the left ventricle developed. Left ventricular wall thickness, ejection fraction, and wall stress were measured by MRI. Myocardial ATP, creatine phosphate, and inorganic phosphate levels were measured by spatially localized 31P-NMR spectroscopy, and regional myocardial blood flow was measured with radioactive microspheres. PROCEDURE MRI Protocols All MRI studies were performed on the standard Siemens Medical System VISION operating at 1.5 T. The animals were anesthetized with sodium pentobarbital. A catheter was placed into the femoral artery and advanced into the LV chamber for LV pressure recording. Animals then were placed on their left side in a Helmholtz coil with a diameter of 18 cm, which was used to improve signal to noise. To compute LV wall stress, the image acquisition was triggered by the LV pressure through the fluid-filled LV catheter. All of the imaging sequences were synchronized to the LV pressure trace. The electronic LV pressure signal was recorded and fed to a comparator set to a threshold level of 10 % of the upslope of the LV pressure curve at the beginning of systole. The signal from the comparator was sent to a pulse former and then fed to the ECG port of the magnetic resonance system, where it was treated like the standard electrographic input to run the pulse sequences. Scout images were taken in the axial plane with a single-shot, ultrafast gradient echo sequence (McDonald et al. 1992; Wilke et al. 1993; Geiger et al. 1995). From the axial image, both horizontal and vertical long-axis images were obtained. By alternating back and forth several times, a true vertical long axis of the left ventricle was obtained. From the long-axis scout image, short-axis segmented cine turboflash slices were prescribed to cover the myocardium from apex to base. The doubleoblique, short-axis turboflash images cover the heart from apex to base with a slice thickness of 10 mm, with no interslice gap. MRI Cine Technique The parameters of the segmented cine sequence were TR/TE/flip angle = 33 ms/6.1 ms/25 degrees with an FOV= 17.5 cm and a matrix of 87 × 128 (pixel size, 2 mm× 1.4 mm) and slice thickness of 7–10 mm (Atkinson et al. 1991). The sequence used segmented k-space acquisition such that three phase-encoded lines were gathered per cardiac phase per heartbeat. Total image acquisition required approximately 52 heartbeats for each slice location. The temporal image resolution (data acquisition window) of this sequence was 33 ms per cardiac image. Each myocardial level took < 1.5 min to acquire, since two acquisitions were used and the average heart rate of the animals was 120 bpm. The average number of short-axis slices needed to image the entire myocardium from apex to base was six to eight. This 10-min protocol provided high signal-to-noise cine sequences covering the entire heart. Spin-Echo Images To obtain high-resolution anatomic heart images, multislice, single-phase spin-echo images trigged in the systolic phase were acquired to cover the entire heart. These images permitted the precise delineation of the extent of the scar region of the heart. Images were taken with a slice thickness of 5 mm and a FOV of 17.5 cm, resulting in a true spatial resolution of 2 mm× 1.4 mm pixel size. The TR for this sequence equals the RR interval (500 ms) and the echo time TE was set to 30 ms. Total measurement time for an average of 10–14 slices was 5 min. Image Analysis of the MRI Cine Studies The imaging data were archived to optical disk and copied to a SUN SPARC 10 workstation for evaluation with the use of an automatic segmentation program (ImageView, Siemens Cooperate Research). The program is based on robust deformable models of endocardial and epicardial border segmentation of ventricular boundaries in cardiac magnetic resonance images. This segmentation technique has been combined with a user interface that allows one to load, sort, visualize, and analyze a cardiac study in < 20 min. The segmentation algorithm is based on the steepest descent as well as dynamic programming strategies integrated via multiscale analysis for minimizing the energy function of the resulting contour. The ventricular boundaries are used to construct a three-dimensional model for visualization and to compute hemodynamic parameters. Automatic segmentation of endocardial and epicardial boundaries was performed for calculation of ventricular volumes, EF, LV diastolic and systolic volumes, and absolute myocardial mass from multislice, multiphase magnetic resonance cine images. Starting with a user-specified approximate boundary or an interior point of the ventricle for one starting image in one slice, the algorithm generated automatic contours corresponding to the epicardium and the endocardium and automatically propagated them to other slices in the cardiac phase (spatial propagation) and to other phases for a given slice location (temporal propagation) of the cardiac study. The observer then could make some manual corrections to the six or seven pairs of contours in the first column of the temporal-spatialmatrix. Manualmodifications generally were made on the apex and base levels. EVALUATION Mean LV wall thickness for each short-axis ring was averaged from three measurements of the remote zone (anterior wall and septum wall). The thickness of the scar was averaged from three measurements of the scar area. LVSA measurement in each slice was computed by subtracting the total area enclosed by the endocardium from that enclosed by the subepicardium; the resultant area was multiplied by the slice thickness to obtain the volume of each slice; the total LV mass volume was calculated by adding up the volumes of all the short-axis slices. The total LVSA was obtained by dividing the total LV wall mass volume by the mean of LV wall thickness of each slice. Similarly, the LVSSA was obtained by dividing the total scar volume, which was the sum of the scar volume of each short axis, by the mean of the scar thickness of each short axis. LV mass was computed by the total LV wall mass volume multiplied by 1.05 (specific gravity of myocardium) to calculate the LVmass. The LV enddiastolic volume (V d) and end-systolic volume (V s) of each slice were represented by the area enclosed by the endocardium. The total LV volume was computed by adding the volumes of all slices. LVEF was calculated by 100 × (V–Vs)/Vd%. Interobserver and intraobserver errors for the calculations of LV mass and LV volumes have been shown to be < 3 mg and 3 ml, respectively (McDonald et al. 1994). Meridional wall stress was computed from the LV pressure and simultaneously obtained short-axis view of LV MRI (LV cavity diameter and average thickness the remote LV wall) as described by Grossman et al. (1975). Spatially Localized31P-NMR Spectroscopic Technique Measurements were performed in a 40-cm-bore, 4.7-T magnet interfaced with a SISCO (Spectroscopy Imaging Systems Corporation) console. The LV pressure signal was used to gate NMR data acquisition to the cardiac cycle, while respiratory gating was achieved by triggering the ventilator to the cardiac cycle between data acquisitions (Robitaille et al. 1990). 31Pand 1H-NMR frequencies were 81 and 200.1 MHz, respectively. Spectra were recorded in late diastole with a pulse repetition time of 6–7 s. This repetition time allowed full relaxation for ATP and Pi resonances and ≈90 % relaxation for the CP resonance (Zhang and McDonald 1995). CP resonance intensities were corrected for this minor saturation; the correction factor was determined for each heart from two spectra recorded consecutively without transmural differentiation, one with 15-s repetition time to allow full relaxation and the other with the 6- to 7-s repetition time used in all the other measurements. Radiofrequency transmission and signal detection were performed with a 25-mm-diameter surface coil. The coil was cemented to a sheet of silicone rubber 0.7 mm in thickness and ≈50 % larger in diameter than the coil itself. A capillary containing 15 μl of 3Mphosphonoacetic acid was placed at the coil center to serve as a reference. The proton signal from water detected with the surface coil was used to homogenize the magnetic field and to adjust the position of the animal in the magnet so that the coil was at or near the magnet and gradient isocenters. This was accomplished with a spin-echo experiment and a readout gradient. The information gathered in this step also was used to determine the spatial coordinates for spectroscopic localization. Chemical shifts were measured relative to CP, which was assigned a chemical shift of –2.55 ppm relative to 85 % phosphoric acid at 0 ppm. Spatial localization across the LV wall was performed with the RAPP-ISIS/FSW method (Hendrich et al. 1991). Signal origin was restricted with the use of B0 gradients and adiabatic inversion pulses to a column coaxial with the surface coil perpendicular to the LV wall. The column dimensions were 17 × 17 mm. Within this column, the signal was further localized using the B1 gradient to five voxels centered about 45°, 60°, 90°, 120°, and 135° spin rotation increments. FSW localization used a nine-term Fourier series expansion. The Fourier coefficients, the number of free induction decays acquired for each term in the Fourier expansion, and the multiplication factors used to construct the voxels have been reported previously. The position of the voxels relative to the coil was set using the B1 magnitude at the coil center, which was experimentally determined in each case by measurement of the 90° pulse length for the phosphonoacetic acid reference located in the coil center. Each set of spatially localized transmural spectra were acquired in 10 min. A total of 96 scans was accumulated within each 10-min block. EVALUATION Resonance intensities were quantified with the use of integration routines provided by the SISCO software. ATPγ resonance was used for ATP determination. Since data were acquired with the transmitter frequency being positioned between the ATPγ and CP resonance, the off-resonance effects on these peaks were negligible. The numeric values for CP and ATP in each voxel were expressed as ratios of CP/ATP. Pi levels were measured as changes from baseline values (ΔPi) with the use of integrals obtained in the region covering the Pi resonance. A.6.0.8 Cardiac Failure in Sheep ... PURPOSE AND RATIONALE Various methods have been used to induce cardiac failure in sheep: pressure overload after aortic banding (Aoyagi et al. 1993; Charles et al. 1996), volume loading after myocardial infarction (Charles et al. 2003), rapid ventricular pacing (Rademaker 1997, 2002b, 2005; Byrne et al. 2002; Moreno et al. 2005), coronary microembolization (Huang et al. 2004; Monreal et al. 2004). Rademaker et al. (2002a) studied combined angiotensin converting enzyme inhibition and adrenomedullin in an ovine model of heart failure induced by rapid ventricular pacing. PROCEDURE Surgical Preparation Coopworth ewes (38±47 kg) were instrumented via a left lateral thoracotomy. Under general anesthesia (induced by 17 mg/kg thiopentone; maintained with halothane/nitrous oxide), two polyvinyl chloride catheters were inserted in the left atrium for blood sampling and left atrial pressure (LAP) determination; a Konigsberg pressure-tip transducer was inserted in the aorta to record mean arterial pressure (MAP); an electromagnetic flow probe was placed around the ascending aorta to measure cardiac output (CO); a 7 French Swan-Ganz catheter was inserted in the pulmonary artery for infusions; and a 7 French Hisbundle electrode was stitched subepicardially to the wall of the left ventricle for left ventricular pacing. All leads were externalized through incisions in the back. A bladder catheter was inserted per urethra for urine collections. The animals were allowed to recover for 14 days before commencing the study protocol. During the experiments, the animals were held in metabolic cages, had free access to water and ate a diet of chaff and sheep pellets (containing 40 mmol/day sodium and 200 mmol/day potassium). A further 40 mmol of sodium was administered orally daily as NaCl tablets using an applicator. Study Protocol Heart failure was induced by 7 days of rapid left ventricular pacing (225 bpm) [15] and maintained by continuous pacing for the duration of the study. On four separate days with a rest day between each, the sheep received, in random order, a vehicle control (Haemaccel), human adrenomedullin alone (50 ng/min per kg infusion for 3 h), an ACE inhibitor alone (captopril: 25 mg bolus + 2 mg/h infusion for 3 h), and both agents combined. Infusions were administered in a total volume of 60 ml via the pulmonary artery catheter, commencing at 10:00 hours. Mean arterial pressure, left atrial pressure, cardiac output and calculated total peripheral resistance (CTPR = mean arterial pressure/cardiac output) were recorded at 15-min intervals in the 1-h prior to infusion (baseline), and at 15, 30, 45, 60, 90, 120 and 180 min during both the 3-h infusion and postinfusion periods. Hemodynamic measurements were determined by on-line computer-assisted analysis. Blood samples were drawn from the left atrium at 30 min and immediately pre-infusion (baseline), and at 30, 60, 120 and 180 min during the 3-h infusion and post-infusion periods. Samples were taken into tubes on ice, centrifuged at 3939 g for 10 min at 4 °C and stored at either –20 °C or –80 °C before assay for immunoreactive (ir-) adrenomedullin, cAMP, plasma renin activity, angiotensin II, aldosterone, atrial natriuretic peptide, brain natriuretic peptide, endothelin-1, catecholamines and cortisol. All samples from individual animals were measured in the same assay to avoid inter-assay variability. Plasma electrolytes and hematocrit were measured in every sample taken. Urine volume and samples for the measurement of urine cAMP, sodium, potassium and creatinine excretion were collected every 1 h. Creatinine clearance was calculated as urine creatinine/plasma creatinine. EVALUATION Results are expressed asmean±SEM. Baseline hemodynamic and hormone values represent the means of the four and two measurements respectively made in the 1 h immediately pre-infusion. Statistical analysis was performed by repeated-measures ANOVA. Baseline data from all treatments were compared. Treatment- and time-related differences between all four study limbs were determined using a twoway ANOVA (treatment–time interactions are quoted in the text). Statistical significance was assumed when P<0.05 A.6.0.9 Cardiac Failure in Monkeys ... PURPOSE AND RATIONALE Several authors used monkeys for studies of cardiac failure. Hollander et al. (1977) investigated the role of hypertension in ischemic heart disease in the cynomolgus monkey with coarctation of the aorta. Sieber et al. (1980) studied cardiotoxic effects of adriamycin in macaques. Various studies were performed by the group of Hoit and Walsh in baboons (Hoit et al. 1955a, 1955b, 1997a, 1997b; Khoury et al. 1996). Hoit et al. (1997a) studied the effects of thyroid hormone on cardiac β-adrenergic responsiveness in conscious baboons. PROCEDURE Animal Instrumentation Adult male baboons (Papio anubis) weighing 21–30 kg were pre-instrumented for physiological monitoring in a lightly anesthetized, sedated state. Animals were pre-instrumented with a Konigsburg micromanometer and a polyvinyl catheter in the LV apex, miniaturized sonomicrometer pairs (3 MHz, 6 mm) across the LV anteroposterior minor axis, a polyvinyl catheter in the right atrium for central venous access, and pacing wires on the right atrial appendage. Wires and tubes were tunneled subcutaneously into the interscapular area for later use. Postoperative pain was reduced by the use of Buprenex (0.01 mg/kg i.m., q 6 h), and postoperative antibiotic (Monocid 25 mg/kg) was administered for 5 days to reduce the risk of infection. Baseline hemodynamic studies were performed after a minimum of 1 week for postoperative recovery. Hemodynamic data acquisition and analysis The micromanometers and fluid-filled catheters were calibrated with a mercury manometer. Zero drift of the micromanometer was corrected by matching the LV enddiastolic pressure measured simultaneously through the LV catheter. The fluid-filled LV catheter was connected to a pre-calibrated Statham 23 dB transducer with zero pressure at the level of the mid right atrium. The transit time of ultrasound between the ultrasonic dimension crystals was measured with a multichannel sonomicrometer (Triton Technology) and converted to distance assuming a constant velocity of sound in blood of 1.55 mm/ms. The analog LV dP/dI signal was obtained online by electronic differentiation of the high-fidelity LV pressure signal. τ was derived from the highfidelity LV pressure tracing by the method of Weiss et al. (1976), which assumes a monoexponential decay of LV pressure to a zero asymptote and has been shown to be directionally equivalent to other mathematical approaches for quantification of isovolumic pressure decay. τ is equal to the time in milliseconds for LV pressure to decay to 1/e; thus, decreases in τ reflect improved isovolumic ventricular relaxation. Fractional shortening of the LV minor axis was calculated as (EDD–ESD)/EDD, where EDD is LV enddiastolic dimension and ESD is LV end-systolic dimension. LV end-diastole was defined as the time in which LV dP/dtmax increased by ≥ 150 mmHg/s for 50 ms, and LV end-systole was defined as the time of the maximum ratio of LV pressure to LV minor-axis dimension. LV volumes were derived from minor-axis diameter (D) measurements: LV volume = π/6(D)3. V cf was calculated as LV fractional shortening divided by LV ejection time; LV ejection time was defined as the time from peak positive to peak negative dP/dt. Analog signals for high-fidelity and fluid-filled LV pressures, LV short-axis dimension, LV dP/dt, and the ECG were recorded on-line on a Gould multichannel recorder at 25 and 100 mm/s paper speed and digitized through an analog-to-digital board (Dual Control Systems) interfaced to an IBM AT computer at 500 Hz and stored on a floppy disk. Data were analyzed using an algorithm and software developed in our laboratory. Steady-state data were acquired over 5–10 s during spontaneous respiration and averaged. Experimental Protocols Hemodynamic studies were performed a minimum of 1 week after instrumentation and were repeated after 22–30 (26.8±2.7) days of thyroid T4 administration. Animals were tranquilized with Valium (1–5 mg) and ketamine (100 mg), and cholinergic blockade was achieved with atropine (0.4–0.8 mg i.v.); additional ketamine was administered as necessary, to a maximum cumulative dose of 40 mg/kg. Animals were atrially paced at a rate 40 % to 50 % greater than the control heart rate in order to obtain data at matched heart rates after thyrotoxicosis was produced. Dobutamine Group After hemodynamic stability was ensured and baseline data were recorded, intravenous dobutamine was infused at 5-min intervals at upwardly titrated rates of 2.5, 5.0, 7.5, and 10.0 μg·kg−1·.min−1 to examine the effects of β 1-adrenergic stimulation. The dose range of catecholamine for these studies was chosen to alter inotropic and lusitropic states without causing an untoward increase in heart rate. Steady-state hemodynamic measurements were made during minutes 4 and 5 of each infusion period. At each level, the pacemaker was briefly turned off to determine the effect of dobutamine on the heart rate. Four of the animals in this group were studied with incremental pacing both before and after β-adrenergic blockade with esmolol (0.3 mg·kg−1·min−1 i.v.V). The pacing protocol and the results from a larger group of animals studied before β-adrenergic blockade were detailed in a previous report. Briefly, atrial pacing was instituted at a rate above the intrinsic heart rate to avoid competing rhythms and was increased at 0.2-Hz increments until the critical heart rate was achieved. The critical heart rate was defined as the rate at which dP/dt max and τ reached a maximum and minimum, respectively, during progressive increases in heart rate.We showed previously that hyperthyroidism significantly increases the critical heart rates for both dP/dt max and τ . The EC50 of dobutamine for LV dP/dt max was determined by fitting log(dose)-transformed data to a sigmoidal relation with software from Graph Pad. Terbutaline Group Additional animals were chronically instrumented so that we could examine the effects of β 2-adrenergic stimulation. One animal died suddenly after receiving thyroid hormone for 20 days. In the remaining three animals, the β 2-adrenergic agonist terbutaline was infused both before and after production of the hyperthyroid state. Incremental doses of terbutaline (15 min/dose) were infused over a dosing range of 25 to 300 ng·kg−1·min−1. Thyroid Function Tests Thyroid function tests were performed before the baseline experiment in the euthyroid state and before the terminal experiment (within 24 h of the last dose of T4) in the hyperthyroid state. T3 radioimmunoassay, T4, and free T4 levels were measured at each state. EVALUATION Paired mean data were compared by Student’s t-test. The effects of thyroid status, catecholamine dose, and β-blockade on hemodynamic and dimension variables were examined with repeated-measures ANOVA (SuperAnova, Abacus Concepts).When significant differences were found, group means were compared with contrasts. A value of P < 0.05 was considered significant. Unless specified, data are expressed as mean ±SD. A.6.0.10 Cardiac Failure in Other Species ... PURPOSE AND RATIONALE Various species have been used to study experimental cardiac failure. Breisch et al. (1984) studied the effects of pressureoverload hypertrophy in the left myocardium of young adult cats. Hypertrophy was induced by a 90 % constriction of the ascending aorta. Genao et al. (1996) recommended dilated cardiomyopathy in turkeys as an animal model for the study of human heart failure. Do et al. (1997) studied energy metabolism in normal and hypertrophied right ventricle of the ferret heart. Wang et al. (1994) studied Ca2+ handling and myofibrillar Ca2+ sensitivity in ferret cardiac myocytes with pressure-overload hypertrophy. Bovine hereditary cardiomyopathy was recommended as an animal model of human dilated cardiomyopathy by Eschenhagen et al. (1995). A.6.0.11 Hypertrophy of Cultured Cardiac Cells ... PURPOSE AND RATIONALE Kojima et al. (1994), Komuro et al. (1990, 1991, 1993), Yamazaki et al. (1993, 1994, 1996) described a method to induce hypertrophy of cardiomyocytes by mechanical stress in vitro. PROCEDURE Primary cultures from cardiomyocytes are prepared from ventricles of 1-day-old neonatal Wistar Kyoto rats. According to the method of Simpson and Savion (1982), the cultures are treated for 3 days with 0.1 mM bromodeoxyuridine to suppress proliferation of nonmyocardial cells. Elastic culture dishes (2 × 4 × 1 cm) are made by vulcanizing liquid silicone rubber consisting of methylvinyl polysiloxane and dimethyl hydrogen silicone resin using platinumas a catalyst. The bottom of the disc is 1-mm thick, and it is highly transparent because of no inorganic filler in either component. Cells are plated in a field density of 1 × 105 cells/cm2 in culture medium consisting of Dulbecco’s modified Eagle’s medium with 10 % fetal bovine serum. Mechanical stress on cardiac cells is applied by gently pulling and hanging the dish on pegs. A 10%change in length of the dish results in an almost identical change in the length of the cell along a single axis (Kimuro et al. 1990). Cardiocytes are stretched by 5 %, 10 %, or 20 %. Drugs, e. g., an angiotensin-II receptor antagonist, are added 30 min before stretch. For protein analysis, the silicone dishes are stretched for 24 h after 2 days of serum starvation and [3H]phenylalanine (1 μCi/ml) is added for 60 min. At the end of each stress, the cells are rapidly rinsed four times with ice-cold phosphate-buffered saline and incubated for 20 min on ice with 1 ml of 5%trichloroacetic acid. The total trichloroacetic acidinsoluble radioactivity in each dish is determined by liquid scintillation counting. For determination of mitogen-activated protein kinase, cardiomyocytes are lysed on ice and centrifuged. Aliquots of the supernatants of myocyte extracts are incubated in kinase buffer (25 mM/l Tris-HCl, pH 7.4, 10 mM/l MgCl2, 1 mM/l dithiothreitol, 40 μM/l APT, 2 μCi [γ -32P]ATP, 2 μM/l protein kinase inhibitor peptide, and 0.5 mM/l EGTA) and substrates (25 μg myelin basic protein). The reaction is stopped by adding stopping solution containing 0.6%HCl, 1 mM/l ATP, and 1 % bovine serum albumin. Aliquots of the supernatant are spotted on P81 paper (Whatman), washed in 0.5 % phosphoric acid, dried and counted. For determination ofc-fos mRNA, Northern blot analysis is performed. EVALUATION Values are expressed as mean ±SEM. Comparisons between groups are made by one-way ANOVA followed by Dunnett’s modified t-test. CRITICAL ASSESSMENT OF THE METHOD The interesting approach to induce hypertrophy of cardiac cells in vitro has been used predominantly by one research group. Confirmation by other research groups including modifications of the mechanical procedures seems to be necessary. A.7 Positive Inotropic Activity (Cardiac Glycosides) ... A.7.0.1 General Considerations Biological standardization of cardiac glycosides was necessary as long as the drugs used in therapy were plant extracts or mixtures of various glycosides. They were standardized in units of an international standard. Some of the pharmacological methods used for these purposes and adopted by many pharmacopoeias have nowadays historical interest only. This holds true for the frog method and the pigeon method (Burn et al. 1950). Particularly, the frog method was used for standardization. The method adopted by the U.S Pharmacopoeia X was the 1 h test. Healthy frogs (Rana pipiens) weighing 20–30 g were selected from the cold storage room. One hour before assay, their weight was recorded and they were placed in wire cages with a water depth of 1 cm. The doses of digitalis were calculated so that they approximated 0.015 ml/g body weight. Injections were made into the ventral lymph sac. One hour later, the animals were pithed and the heart removed and examined. Systolic arrest of the ventricle and widely dilated atrium indicated the typical result. Calculations of activity in terms of International Units were made from the percentage of dead animals in the test group versus those in the group receiving the international standard. The pigeon method introduced by Hanzlik (1929) and adopted by USP XVII depends on the observation that intravenously injected cardiac glycosides have an emetic action in pigeons. In the original test, adult pigeons weighing 300–400 g are injected with a solution of the cardiac glycoside into a suitable wing vein in the axillary region. Vomiting occurring within 15 min is regarded as positive result. Two doses of test solution and standard are injected and percentage of vomiting pigeons registered. This 4 point assay allows calculation of ED 50 values and of the potency ratio compared with the standard. Modifications of other methods, such as the cat method introduced by Hatcher and Brody (1910) and described in detail by Lind vanWijngarden (1926), the guinea pig method described by Knaffl-Lenz (1926) and the isolated cat papillary muscle method introduced by Catell and Gold (1938) still being used for evaluation of synthetic cardioglycosides and other positive inotropic compounds are referenced in detail below. Surveys on the evaluation of cardiac glycosides have been given by Bahrmann and Greef (1981), for the use of the isolated papillary muscle by Reiter (1981) and for other isolated heart preparations by Greef and Hafner (1981). Moreover, the influence on Na+/K+-ATPase, an in vitro model specific for cardiac glycosides (Gundert-Remy and Weber 1981), is described. The mechanisms of action have been reviewed by Scholz (1984) and Grupp (1987). Analogous to antiarrhythmic agents, Feldmann (1993) proposed a classification system that categorizes inotropic agents according to their supposed mode of action: Class I: Inotropic agents that increase intracellular cyloAMP, including β-adrenergic agonists and phosphodiesterase inhibitors, Class II: Inotropic agents affecting sarcolemmal ion pumps and channels, in particular cardiac glycosides inhibiting Na+/K+-ATPase, Class III: Agents that modulate intracellular calcium mechanisms (no therapeutic inotropic agents in this kind yet available), Class IV: Inotropic agents having multiple mechanisms of action A.7.1 In Vitro Tests A.7.1.1 Ouabain Binding ... PURPOSE AND RATIONALE Cardiac glycosides can be characterized by their binding kinetics (association process, equilibrium binding, and dissociation process) on the ouabain receptor. PROCEDURE Heart sarcolemma preparations are obtained from rat or dog heart. From a canine heart or from rat hearts submitted to coronary perfusion myocytes are isolated by collagenase digestion. The isolated membrane fractions consist mainly of myocyte sarcolemma. [3H]ouabain with a specific radioactivity of about 20 Ci/mmol is incubated with ligands to be tested in 10 ml of binding medium consisting of 1 mM MgCl2, 1 mM inorganic phosphate, and 50 mM Tris-HCl, pH 7.4 at 37 °C for 10 min. Association process: After temperature equilibration in the presence of either 10 or 100nM [3H]ouabain, 200 μg of membrane preparation are added to initiate the reaction. At various times, 4.5 ml are removed and rapidly filtered. Equilibrium binding: At the end of the temperature equilibration carried out in the presence of increasing concentrations of [3H]ouabain ranging from 10 nM to 3 μ M, 40 μg of membranes are added. After 30 min, duplicate aliquots of 4.5 ml are removed and filtered. Dissociation process: Once equilibrium has been achieved under the experimental conditions used to study association, 10 ml of prewarmed Mg2+ plus Pi Tris-HCl solution supplemented with 0.2 mM unlabeled ouabain are added to initiate dissociation of [3H]ouabain. At various times, aliquots of 0.9 ml are removed and rapidly filtered. All aliquots are filtered under vacuum on HAWP Millipore filters (0.45 μm) and rinsed three times with 4 ml of ice-cold buffer. The radioactivity bound to the filters and the specific binding measurements are determined. EVALUATION Kinetic parameters for the association and the dissociation process are calculated. The results of equilibrium binding are analyzed by Scatchard plots. A.7.1.2 Influence on Na+/K+ ATPase ... PURPOSE AND RATIONALE The enzyme Na+/K+ ATPase is the transport system for Na+ and K+ in the cell membranes. The membrane bound enzyme couples ATP hydrolysis to the translocation of Na+ and K+ ions across the plasma membrane through a series of conformational transitions between the E1 and E2 states of the enzyme. The enzyme is a heterodimer consisting of a catalytic subunit (110 kDa) associated with a glycosylated β subunit (55 kDa). Three alpha (α 1, α 2, α 3) subunits have been identified by cDNA cloning. In the heart, enzyme Na+/K+ ATPase is the target of the positive inotropic glycosides. Therefore, it is of interest for the characterization of positive inotropic compounds. The test is based on the determination of phosphate generated from ATP under special conditions. Inhibition of bovine cerebral Na+/K+ ATPase prepared according to Schoner et al. (1967) is measured after addition of various concentrations of the test compound compared with those of the standard (Erdmann et al. 1980). PROCEDURE Solutions 1.00 ml 133 mM imidazole pH 7.3 0.04 ml 160 mM MgCl2 0.02 ml DPNH (10 mg/ml) 0.04 ml 310 mM NH4Cl 0.04 ml 100 mM ATP 0.02 ml 40 mM phosphoenol-pyruvate 0.05 ml pyruvate-kinase (1 mg/ml = 150U/ml) 0.04 ml lactate-dehydrogenase (0.5 mg/ml = 180 U/ml) 0.20 ml 1 M NaCl 0.01–0.02 ml bovine cerebral ATPase (depending on activity of the enzyme) up to 2.0 ml distilled water Test The enzyme activity is started by addition of the ATP solution at 37 °C. After 4 min the inhibitor (various concentrations of the cardiac glycoside) is added. Na+/K+ ATPase activity is measured by a coupled optical assay. The reaction is continuously recorded and corrected for Mg2+-activated ATPase by inhibition of Na+/K+ ATPase with 10−3 M ouabain. EVALUATION Inhibition of ATPase is measured after addition of various concentrations of the test compound. Doseresponse curves are established and compared with the standard (k-strophanthin). Potency ratios can be calculated. MODIFICATIONS OF THE METHOD Brooker and Jelliffe (1972) and Marcus et al. (1975) described an in vitro assay based on displacement of radiolabeled ouabain bound to ATPase by various glycosides. Another method is based on the inhibition of rubidium uptake into erythrocytes (Lowenstein 1965; Belz 1981). Erdmann et al. (1980) prepared (Na++K+)-ATPasecontaining cardiac cell membranes from rat hearts. Maixent et al. (1987, 1991) described two Na,KATPase isoenzymes in canine cardiac myocytes as the molecular basis of inotropic and toxic effects of digitalis. The effect of ouabain on Na+/K+ATPase activity in cells of the human rhabdomyosarcoma cell line TE671 was studied by Miller et al. (1993) with a special equipment, the microphysiometer (McConnell et al. 1992). CRITICAL ASSESSMENT OF THE METHOD The in vitro methods being used for determinations of plasma levels of glycosides (Maixent et al. 1995) have been largely substituted by radioimmunoassays specific for individual glycosides. Nevertheless, the inhibition of Na+/K+ ATPase can be used as an indicator of activity of new semisynthetic cardiac glycosides. A.7.2 Tests in Isolated Tissues and Organs A.7.2.1 Isolated Cat Papillary Muscle ... PURPOSE AND RATIONALE Isolated cardiac tissue has been chosen to study the decrease of performance after prolonged electrical stimulation and during restoration of force under the influence of cardiac glycosides. Cattell and Gold (1938) described a method using cat papillary muscle. PROCEDURE Cats of either sex weighing 2.5–3 kg are used. The animal is anesthetized with ether and the thorax is opened rapidly. The heart is removed and a papillary muscle from the right ventricle is isolated and fixed in an organ bath containing oxygenated Ringer’s solution at 36 °C. One end of the muscle is tied to an tissue holder and the other one to a strain gauge. The muscle is stimulated electrically with 4–6 V, 2 ms duration and a rate of 30/min. The contractions are recorded on a polygraph. After 1 h, the muscle begins to fail and the force of contraction diminishes to a fraction of control. At this point, the cardiac glycoside is added to the bath, restoring the contractile force to levels approaching control. The standard dose is 300 ng/ml ouabain. The potency of natural and semisynthetic glycosides can be determined with this method. Catecholamines, like adrenaline (10 ng/ml) or isoprenaline (10 ng/ml), are active as well. EVALUATION The increase of contractile force is calculated as percentage of the predose level. Dose-response curves can be established using various doses. CRITICAL ASSESSMENT OF THE METHOD The use of isolated papillary muscle strips can be recommended for evaluation of inotropic compounds of various chemical classes. MODIFICATIONS OF THE METHOD Instead of cat papillary muscle the isolated left atrium of guinea pigs can be used (see Sect.A.1.2.6). For testing cardiac glycosides, the calcium content in the Ringer solution is reduced to 50 %. Andersom (1983) compared responses of guinea pig paced left atria to various positive inotropic agents at two different calcium concentrations (1.25 and 2.50 mM). Consistently good results were obtained at the lower calcium concentration with isoproterenol, ouabain, amrinone, and 3-isobutyl-1-methylxanthine. Böhm et al. (1989) studied positive inotropic substances like isoprenaline and milrinone in isolated cardiac preparations from different sources. They used isolated papillary muscles fromWistar–Kyoto rats and from spontaneously hypertensive rats, but also human papillary muscle strips from patients with moderate heart failure (NYHA II–III) and compared the effects with papillary muscle strips from patients with severe heart failure (NYHA IV). They recommended that new positive inotropic agents should be screened in human myocardial tissue from patients with heart failure. Labow et al. (1991) recommended a human atrial trabecular preparation for evaluation of inotropic substances. Böhm et al. (1989) tested positive inotropic agents in isolated cardiac preparations from different sources, e. g., human papillary muscle strips from patients with severe heart failure (NYHA IV), human papillary muscle strips from patients with moderate heart failure (NYHA II–III), human atrial trabeculae, isolated papillary muscles from Wistar–Kyoto rats, and isolated papillary muscles from spontaneous hypertensive rats. They suggested that positive inotropic effects should be screened in isolated myocardium from patients with heart failure. A.7.2.2 Isolated Hamster Cardiomyopathic Heart ... PURPOSE AND RATIONALE Special strains of Syrian hamsters develop cardiomyopathy. These animals can be used for evaluation of cardiotonic drugs (see Sect.A.6.0.4). PROCEDURE Hamsters with cardiomyopathy (Bio 14/6) at the age of 50weeks are used. Controls are normal Syrian hamsters (FIB hybrids) at the same age. The animals are pretreated with heparin (5 mg/kg i.p.) and 20 min later the heart is prepared according the method of Langendorff and perfused with heart Ringer solution under 75 mm H2O hydrostatic pressure. The preparation is allowed to equilibrate in the isolated state for 60 min at 32 °C with a diastolic preload of 1.5 g. The force of contractions is recorded isometrically by a strain gauge transducer on a polygraph, e. g., Heliscriptor He 19 recorder (Hellige GmbH, Freiburg, Germany). From these signals, the heart rate is measured by a chronometer. The coronary flow is measured by an electromagnetic flowmeter. Compounds are injected via the aortic cannula into the inflowing heart-Ringer solution. EVALUATION The contractile force and the coronary flow in hearts from diseased and normal animals is registered before and after application of the test drugs. Mean values and standard deviation are calculated before and after drug application and statistically compared using Student’s t-test. MODIFICATION OF THE METHOD Jasmin et al. (1979) showed after prolonged in vivo administration beneficial effects of a variety of cardiovascular drugs, including verapamil, prenylamine, dibenamine and propranolol. After chronic administration (4 or 12weeks subcutaneously), Weishaar et al. (1987) found beneficial effects of the calcium channel blocker diltiazem, but not by the administration of digitalis. In contrast, in the experiments of Ottenweller et al. (1987) hamsters treated orally with digoxin survived and showed significant amelioration of the pathological syndrome of heart failure. A.7.2.3 Potassium Loss from the Isolated Guinea Pig Heart ... PURPOSE AND RATIONALE Cardiac glycosides induce a net loss of potassium from cardiac tissue due to their inhibition of the Na+/K+ ATPase. Therefore, potassium is increased in the effluent of the isolated guinea pig heart. This phenomenon can be used as parameter for the activity of digitalis-like compounds (Lindner and Hajdu 1968). PROCEDURE The isolated heart of guinea pigs according to LANGENDORFF is prepared as described in Sect.A.3.1.1. The coronary outflow is measured by counting the drops of the effluent by a photocell. The effluent is collected in a funnel with a thin upwards shaped outlet allowing to withdraw small fluid samples for analysis by a flame photometer. A pump attached to a 4-way valve changes the samples to the flame photometer every 15 s in the following sequence: effluent Tyrode-solution from the heart, distilled water, Tyrodesolution used for perfusion, distilled water. The potassium content of affluent and effluent Tyrode-solution is compared and registered on a Varian-recorder. The difference is attributed to the potassium outflow from the heart. The dose-response curve is flat in the therapeutic range, much steeper in the toxic range. EVALUATION The following parameters are recorded and calculated: coronary flow [ml/min] contractile force potassium loss [mVal/min] CRITICAL ASSESSMENT OF THE METHOD A good correlation was found between the measured potassium loss and the positive inotropic effect of cardiac glycosides. The method is suitable for the quick determination of efficacy of digitalis-like substances and facilitates the discrimination from other positive inotropic compounds like adrenaline. A.7.3 In Vivo Tests A.7.3.1 Cardiac Toxicity in Cats (Hatcher’s Method) ... PURPOSE AND RATIONALE The purpose of the method, originally introduced by Hatcher and Brody (1910) and described in detail by Lind van Wijingaarden (1926), was to establish “cat units” for cardiac glycoside preparations. Hatcher and Brody defined “the cat unit as the amount of crystalline ouabain which is fatal within about ninety minutes to a kilogram of a cat when the drug in injected slowly and almost continuously into the femoral vein”. Time to cardiac arrest after intravenous infusion of a solution with defined concentration of the standard was used as reference and the unknown solution of the test preparation compared with the standard. The method can be used for testing natural and semisynthetic glycosides. PROCEDURE Cats of either sex weighing 2–3.5 kg are temporarily anesthetized with ether. Anesthesia is maintained with 70 mg/kg chloralose given intravenously. The animal is fixed on its legs on a heated operating table. Tracheostomy is performed and a tracheal cannula is inserted. ECG is recorded from lead II. Then, intravenous infusion of the test solution is started. The endpoint is cardiac arrest which should be reached within 30–60 min by proper adjustment of the concentration of the infused solution. MODIFICATIONS OF THE METHOD Hatcher’s original method has been modified by many authors. The method using guinea pigs, introduced by Knaffl-Lenz (1926) is in its essentials similar to the cat method. Guinea pigs weighing 400–600 g are anesthetized with urethane (1.75 g/kg i.m.) The animal is secured on a operating table and the trachea is cannulated. The jugular vein is cannulated for infusion of the test preparation. Cardiac arrest is recorded from ECG lead II. Dogs and guinea pigs were used by Dörner (1955). Decay Rate and Enteral Absorption Rate of Cardiac Glycosides ... PURPOSE AND RATIONALE The basic principle of Hatchers or Knaffl-Lenzs method is suitable to determine decay rates of cardiac glycosides. The decay of efficacy can by due to excretion or metabolic degradation of the glycoside. PROCEDURE Beagle dogs of either sex weighing 820 kg are anesthetized with 35mg/kg pentobarbital sodium i.v. The animal is fixed on its legs on a heated operating table. Tracheostomy is performed and a tracheal cannula inserted. The vena femoralis is cannulated for continuous infusion of a defined concentration (μg/kg/min) of the test compound. ECG is recorded from lead II. The signs of first toxic effects, e. g., extra systoles, AV-block) are recorded. At this time, the infusion is terminated and the total dose/kg of the applied glycoside registered. After 4, 8, 12, or 24 h the infusion procedure is repeated. Within this period of time the glycoside administered with the first dose is only partially metabolized or excreted. Therefore, the dose needed for observation of ECG changes during the second infusion will be lower than in the first experiment. EVALUATION The dose required in the second experiment for induction of ECG changes is equal to the amount of metabolized or excreted glycoside. This value is expressed as percentage of the amount required in the first experiment and indicates the decay rate of the glycoside. Testing after various time intervals, the decay rate can be visualized graphically and half life times be calculated. MODIFICATIONS OF THE METHOD Rhesus monkeys have been used since their response to cardiac glycosides is more similar to that of man than that of dogs (Lindner et al. 1979). The basic principle of Hatchers or Knaffl-Lenzs method is also suitable to determine enteral absorption of cardiac glycosides. Again, for this purpose dogs are preferred instead of cats or guinea pigs. The dose to induce cardiac arrest is determined in 3–6 dogs. To other dogs, the same test compound is given intraduodenally at a dose below the intravenous lethal dose. Ninety or 180 min afterwards, the intravenous infusion with the same infusion speed and the same concentration of the test compound as in the previous experiments is started and time until cardiac arrest determined. The higher the duodenal resorption of the compound, the lower the dose of the intravenous infusion will be. For evaluation, the intravenous dose needed in the second experimental series (with enteral predosing) is subtracted from the dose of the first series (without enteral predosing) and indicates the amount of absorbed compound. This value is expressed as percentage of the value of the first series and indicates the absorption rate. The efficacy and safety of a novel Na+, K+-ATPase inhibitor has been tested in dogs with propranolol-induced heart failure by Maixent et al. (1992). A.8 Effects on Blood Supply and on Arterial and Venous Tonus A.8.1 Models for Stroke and Multi-Infarct Cerebral Dysfunction A.8.1.1 Cerebral Ischemia by Carotid Artery Occlusion in Mongolian Gerbils ... PURPOSE AND RATIONALE The Mongolian gerbil (Meriones unguiculatus) is extremely susceptible to carotid occlusion because of the peculiar anatomical occurrence of an incomplete circle of Willis without posterior communicating artery and a frequently rudimentary anterior communicating artery. Clamping of both carotid arteries induces a bilateral temporary brain ischemia (Levine and Sohn 1969; Bosma et al. 1981; Mršulja et al. 1983; Hossmann et al. 1983; Chandler et al. 1985). This pathological animal model allows the simulation of circulatory disturbances in the human brain. The hippocampus is one of the most vulnerable regions of the brain to ischemia and anoxia. The gerbil is known to develop selective neuronal damage in the CA1 sector of the hippocampus following brief periods of forebrain ischemia. This damage differs from conventionally described ischemic neuronal injury because of its slow development (Ito et al. 1975; Kirino 1982; Hossmann et al. 1983). The occlusion time can be varied allowing determination of various parameters, e. g. ischemia induced amnesia (see Sect. F.3.1.8). PROCEDURE Male Mongolian gerbils (strain: Hoe GerK jirds) weighing 48–88 g are randomly divided into groups (10–15 animals for each test and control group). Prior to testing, the animals are housed in a climate-controlled environment (21 °C) with food and water available ad libitum. Fifteen minutes before surgery, the gerbils receive the test compound by oral or intraperitoneal administration. The control group is treated with vehicle alone. The exposure of the common carotid arteries is performed under anesthesia with sodium pentobarbital (32 mg/kg i.p.), chloralhydrate (100 mg/kg i.p.) and atropine sulfate (0.8 mg/kg i.p.). The carotid arteries are isolated from surrounding tissue and a loop of unwaxed dental floss is placed around each artery. A 2 cm length of double lumen catheter is passed from the level of carotid artery through the muscle layers of the dorsal surface of the neck. Each end of dental floss is threaded through a separate lumen, leaving a loose loop around the artery. Two days later, occlusion of each artery is produced by gently pulling the dental floss until the artery is completely occluded between the floss and the center wall of the catheter. Heifitz clips are placed on the floss against the exterior end of the tubing to maintain occlusion. After various intervals (5 to 30 min), the clips are removed and circulation is restored. Complete bilateral occlusion of the arteries is confirmed by behavioral symptoms, i. e., depression of spontaneous motor activity, shallow and rapid respiration, and ptosis. Care is taken to avoid a drop of body temperature during any stage of the experiment. After experimental manipulations, animals are placed on a heating pad until complete recovery of motor activity. Subjects are placed in individual observation glasses which are kept at a temperature of 29 °C. They are observed for neurological symptoms (such as circling behavior, jumping and rolling seizures, opisthotonus, tonic convulsions, etc.) for 90 min. After various intervals, the gerbils are sacrificed and their brains are removed. EVALUATION The following parameters are measured two hours after occlusion: Degree of brain edema: water content (difference in weight of wet and dry brain) Content of sodium and potassium. The hemispheres are separated and put on pre-weighted watch glasses to determine the wet weight. Then the hemispheres are dried in an open Petri dish for 2 days at a temperature of 95 °C. After cooling off, the dry weight is noted. Sodium and potassium concentrations in the dried brain hemispheres are determined by flame photometry. The Na+/K+ − ratio is calculated. For histological examinations, the animals are sacrificed at 2 or 4 days after ischemia under ether anesthesia by decapitation. The brains are then removed and frozen in CO2. Hippocampi are sectioned coronally with a cryostat at −14 °C. The section thickness for Nissl and glial fibrillary acid protein (GFAP) staining is 20 μm and for the histochemical localization of calcium 30 μm. Nissl staining and its quantitative evaluation. The sections are mounted by thawing on glass slides, stained, and cover slipped with Permount. In order to standardize the histological procedure and to rule out the possibility that differences in the staining intensity were due to technical inconsistency, slides from control and experimental groups are processed together, stained for 5 min, and differentiated in a series of alcohols for 3 min each. The extent of hippocampal nerve cell damage (as reflected by cell loss and decreased stainability) is assessed by measuring the amount of Nissl-stained material in a predetermined representative region of the CA1 area with the aid of a guided densitometer (Leitz Texture Analysis System). The measuring field is 50 × 500 μm, fitting to the width of the CA1 soma layer (about 40 μm). Calcium localization. A modification of technique described by Kashiwa and Atkinson (1963) is used for the cytochemical localization of ionic calcium. The principle of the technique is that calcium complexes with a chelating agent producing an insoluble chromophore. Stock solutions: Two solutions were used: a) glyoxalbis-(2-hydroxyanil) (GBHA), 0.4 g/100 ml absolute ethanol (2 ml 0.4 % GBHA); and b)NaOH, 5 g/100 ml distilled water (0.3 ml 5 % NaOH). Staining procedure: First, cryostat sections are placed immediately in cold absolute acetone for rapid fixation for 5 min. Next, floating sections are transferred into 96 % alcohol for 5 min and then transferred to staining solution for 3–4 min. Sections are then placed in 96 % alcohol and mounted on glass slides. Because of quenching, it is necessary to view and photograph immediately. GFAP (glial fibrillary acid proteinglial fibrillary acid protein) fluorescencemicroscopy. Following slide mounting, cryostat sections are fixed for 15 min in 3.5 % formaldehyde solution in 0.01 M phosphatebuffered saline (PBS). The sections are incubated with mouse primary antibody against GFAP (Boehringer, Mannheim, FRG) for 30 min diluted 1:50 PBS. This antibody shows cross reactions also with GFAP from pigs and rats, indicating lowspecies selectivity (Graber and Kreutzberg, 1986). The sections are rinsed in PBS and incubated to tetramethylrhodamine isothiocyanate (TRITC) specific for mouse immunoglobulin G (T-5393 from Sigma) diluted 1:50 in PBS. Control sections are incubated with PBS instead of primary antibody. Measurements, expressed as extinction units per measuring field, are taken from three slides of each animal and averaged. Statistical analysis is done by Student’s t-test. MODIFICATIONS OF THE METHOD “Sensitive” gerbils can be selected according to the method of Delbarre et al. (1988). In this method, pupil dilatation is obtained with atropine sulfate (1 %) 20 min before anesthesia. Ocular fundus is examined with direct ophthalmoscope (Heine) before ligation and 5 min later. Only animals with an absence of retinal blood flow after ligation are considered as positive. Using 31P nuclear magnetic resonance spectroscopy, Sasaki et al. (1989) studied energy metabolism of the ischemic brain of gerbils in vivo. An unanesthetized-gerbil model of cerebral ischemia was described by Chandler et al. (1985). Using microdialysis, adenosine and its metabolites were measured directly in the brain of male gerbils by Dux et al. (1990). Two microdialysis probes (CMA/10, Carnegie Medicine, Sweden) were implanted stereotactically in the brain of the animals, one in the left dorsal hippocampus and one in the right striatum. The fibres were fixed to the cranium using dental wax. The dialysate was collected in 5 min intervals, and the concentrations of adenosine, hypoxanthine and inosine were determined by HPLC (Zetterström et al. 1982; Fredholm et al. 1984). Kindy et al. (1992) measured glial fibrillary acid protein and vimentine on mRNA level by Northern blot analysis and protein content by immunoblot analysis in the gerbil neocortex, striatum and hippocampus after transient ischemia. McRae et al. (1994) studied the effect of drug treatment on activated microglial antigens in hippocampal sections after ischemia in gerbils with cerebral fluid from patients with Alzheimer’s disease and the amyloid precursor protein. Nurse and Corbett (1996) found neuroprotection in gerbils with global cerebral ischemia after several days of mild, drug-induced hypothermia. The protection by the AMPA-antagonistNBQX may be due to a decrease in body temperature. A protracted period of subnormal temperature during the postischemic period can obscure the interpretation of preclinical studies. A.8.1.2 Forebrain Ischemia in Rats ... PURPOSE AND RATIONALE Smith et al. (1984) described a model of forebrain ischemia in rats induced by transient occlusion of both carotid arteries and exsanguination to a blood pressure of 40 mm Hg. This method has been used extensively (Nuglisch et al. 1990; Oberpichler et al. 1990; Rischke and Krieglstein 1990; Krieglstein and Peruche 1991; Nuglisch et al. 1991; Prehn et al. 1991; Rischke and Krieglstein 1991; Seif el Nasr et al. 1992; Peruche et al. 1995). PROCEDURE Male Wistar rats weighing 250–300 g are anesthetized with 3.5 % halothane and then connected to a Starling type respirator delivering 0.8 % halothane and 30 % O2 in N2O. The jugular vein and the tail artery are catheterized for withdrawal of blood and for monitoring blood pressure. Anticoagulation is achieved by intravenous heparin (200 IU/kg) application. Blood gases, blood pH, blood pressure, and blood glucose are measured 5 min prior to ischemia and 10 min after ischemia. Halothane, but not N2O, is discontinued and the rats are allowed to recover for 30 min. During this period, muscle paralysis is maintained with 5 mg/kg suxamethonium chloride, repeated every 15 min. After injection of trimethaphan camphor sulfonate (5 mg/kg), forebrain ischemia is induced by clamping of both carotid arteries and exsanguination to a blood pressure of 40 mm Hg. To prevent decay of intra-ischemic brain temperature, the environmental temperature is adjusted to 30 °C by means of a infrared heating lamp. After 10 min of ischemia, the carotid clamps are removed and blood pressure is restored by re-infusing the shed blood. To minimize systemic acidosis, the rats receive intravenously 50 mg/kg NaHCO3. The animals are removed from the respirator when they regain spontaneous respiration. EVALUATION Various parameters are used to evaluate the consequences of transient forebrain ischemia and the effectiveness of drug treatment: Local cerebral blood flow determination with the [14C]iodoantipyrine method (Sakurada et al. 1978), Histological assessment of ischemic cell damage in the hippocampus on day 7 after ischemia (Seif el Nasr et al. 1990; Nuglisch et al. 1990), Local cerebral glucose utilization using the [14C]deoxyglucose method described by Sokoloff et al. (1977), Quantitative analysis of the electrocorticogram (Peruche et al. 1995). MODIFICATIONS OF THE METHOD Kochhar et al. (1988) used two focal cerebral ischemia models in rabbits: a multiple cerebral embolic model by injection of microspheres into the internal carotid circulation and a spinal chord ischemia model by occluding the aorta for predetermined periods. Gilboe et al. (1965) described the isolation and mechanical maintenance of the dog brain. Andjus et al. (1967) and Krieglstein et al. (1972) described the preparation of the isolated perfused rat brain for studying effects on cerebral metabolism. A cerebral ischemia model with conscious mice was described by Himori et al. (1990). A.8.1.3 Hypoxia Tolerance Test in Rats ... PURPOSE AND RATIONALE The electrical activity of the brain is dependent on a continuous energy supply. Hypoxia is induced in test animals by inhalation of nitrogen. Marked hypoxia depresses cerebral metabolism resulting in an electrical failure of the brain. The procedure is used to investigate the ability of test compounds to antagonize the hypoxia-induced electrical failure of the brain by measuring the hypoxia-tolerance and the EEG recovery. PROCEDURE Male Sprague Dawley rats or stroke-prone rats weighing 250–300 g are used. They are anesthetized with hexobarbital sodium (100–120 mg/kg, i.p) and surgically implanted with 2 epidural EEG-electrodes and a reference electrode to the parietal frontal cortex. After a minimum of a one week recovery period, testing can be started. The rats receive the test compound by intravenous or intraperitoneal administration. The control group is treated with vehicle alone. Thirty to 60 min after i.p. administration (immediately after i.v. administration) the animals are anaesthetized by hexobarbital sodium at 100–120 mg/kg, i.p. When the stage of surgical anesthesia is reached, the animals are placed in a hypoxia chamber. EEG and ECG are recorded using a Hellige recorder. Hypoxia is induced by inhalation of nitrogen (1200 l/h). On reaching an isoelectric EEG, the nitrogen inhalation is terminated and the animals are allowed to breath room air. The recording is continued until EEG potentials can again be registered. EVALUATION The following parameters are measured in the test and control groups Hypoxia tolerance (HT): The time from the start of nitrogen inhalation until the onset of isoelectric EEG. Latency of EEG recovery: The time from the end of nitrogen inhalation until the onset of EEG potentials. The values of test and control groups are compared. The percent change is calculated. Statistics: Student’s t-test by unpaired comparison. A.8.1.4 Middle Cerebral Artery Occlusion in Rats ... PURPOSE AND RATIONALE The permanent middle cerebral artery (MCA) occlusion technique in rats has been widely employed to evaluate various kinds of neuroprotective agents in cerebral ischemia (Ginsberg and Busto 1989). Focal cerebral infarction is achieved using a modification of the MCA occlusion model described by Tamura et al. (1981) and Pak et al. (1992). PROCEDURE Adult male Sprague–Dawley rats weighing 300–400 g are used in the experiments. The animals are anesthetized with a nitrous oxide-oxygenmixture (70:30 %) containing 1.0 to 1.2 % halothane. A mask is put on the nose and self-respiration is maintained during surgery, which takes around 20 to 30 min. The right femoral artery and vein are catheterized for monitoring blood pressure, blood sampling and administration of the drug. Left MCA occlusion is performed via a subtemporal approach without removal of zygomatic arch or temporal muscle. Under high magnification of a surgical microscope, the left MCA is coagulated with a microbipolar coagulator from the olfactory tract to the most proximal portion of the MCA through a cranial window, about 3 to 4 mm in diameter, and cut afterward. Anesthesia is stopped just after MCA occlusion. The arterial catheter is removed soon after MCA occlusion, but the venous catheter is maintained for constant infusion of the drug by a swivel system (Harvard Apparatus, UK.). The animals are maintained normothermic (37 °C) by a homeothermic system (Homeothermic Blanket System, Harvard Apparatus, UK.). During the surgery, mean arterial blood pressure (MABP) is recorded continuously (Model 7E polygraph, Grass, USA). Arterial gases and pH (178pH/blood gas analyzer, Corning, USA) as well as hematocrit and blood glucose are measured twice, once about 15 min before MCA occlusion and the other just following MCA occlusion. Bilateral temporal muscle temperature (Therm 2250–1, Ahlborn Mess- und Regelungstechnik, Germany) is monitored during the surgery and several minutes before sacrifice. Two, six, twelve and twenty-four hours after discontinuing anesthesia, each rat’s level of consciousness and motor activity are evaluated using a grading scale of 0 to 3 (0: normal activity; 1: spontaneous activity+/−; 2: not arousable by tactile stimulation; 3: not arousable by painful stimulation, no spontaneous activity). Immediately before sacrifice, neurological status is examined using a grading scale of 0 to 3 (0: no observable deficit; 1: forelimb flexion; 2: decreased resistance to lateral push without circling; 3: the same status as grade 2, with circling). Four groups of rats are studied: vehicle-treated controls, and drug-treated animals at 3 different doses. All the rats are re-anesthetized 24 h after MCA occlusion and sacrificed by intravenous injection of KCl. Immediately after sacrifice the brain is removed and frozen at −10 °C for 10 min. The forebrain is cut into eight coronal slices by a rat brain slicer which are processed with the tetrazolium chloride (TTC) emulsion technique. Areas of brain not stained by TTC are drawn on a diagram at 8 preselected coronal levels of forebrainwithout knowledge of the experimental treatment. The areas of ischemic damage in the cerebral hemisphere, cerebral cortex, and caudate nucleus, drawn in the diagram are measured with a planimeter (KP-21, Koizumi, Japan) and integrated to determine the volumes. MODIFICATIONS OF THE METHOD Hossmann (1982) reviewed the experimental models of cerebral ischemia. Yamamoto et al. (1992) studied the inhibition of NO biosynthesis on the volume of focal ischemic infarction produced by occlusion of the middle cerebral artery in spontaneously hypertensive rats. Shigeno et al. (1985) described a recirculation model following middle cerebral artery occlusion in rats. The trunk of the middle cerebral artery was isolated between the rhinocortical branch and the lenticulostriate artery and encircled with a loose-fitting suture of nylon thread. The thread was exteriorized through a small polyethylene catheter, which was previously introduced into the craniectomy site through a burr hole in the zygoma. The artery was occluded by retraction of the thread, which was then fixed with biological glue. Recirculation was achieved by cutting and removing the thread. Bederson et al. (1986a) occluded the middle cerebral artery at different sites in six groups of normal rats and characterized the anatomical sites that produce uniform cerebral infarction. A neurological system was developed that can be used to evaluate the effects of cerebral ischemia. Bederson et al. (1986b) evaluated the use of 2,3,5-triphenyltetrazolium chloride as a histopathological stain for identification and quantification of infarcted brain tissue after middle cerebral artery occlusion in rats. Yang et al. (1992) found a reduction of Na,K-ATPase activity in the ischemic hemisphere shortly after middle cerebral artery occlusion in rats. Du et al. (1996) induced transient focal cerebral ischemia in rats by a 90 min period of ligation of the right middle cerebral artery and both common carotid arteries. Germano et al. (1987) found a decrease of stroke size and deficits in rats with middle cerebral artery occlusion after treatment with kynurenic acid, a broad spectrum antagonist of excitatory amino acid receptors. Wu et al. (1999) reported that propentofylline attenuates microglial reaction in the rat spinal cord induced by middle cerebral artery occlusion. Gotti et al. (1988) found a reduction of the volume of infarcted tissue due to occlusion of the middle cerebral artery in rats and cats after administration of NMDA receptor antagonists. Hossmann and Schuier (1980) studied experimental brain infarcts in cats after occlusion of the left middle cerebral artery. Retro-orbital occlusion of the middle cerebral artery in cats was performed by Sundt and Waltz (1966) and by Gotti et al. (1988). Welsh et al. (1987), Backhauß et al. (1992) described focal cerebral ischemia in mice after permanent occlusion of the middle cerebral artery. Hara et al. (1997) found a reduction of ischemic and excitotoxic neuronal damage by inhibition of interleukin 1β-converting enzyme family proteases after occlusion of the middle cerebral artery in mice and rats. Nylon filaments were introduced from the carotid artery which were withdrawn after 2 h. One day later, the animals were tested for neurological deficits and the brains analyzed for infarct size and interleukin 1β levels. Huang et al. (1994) produced knock-out mice deficient in the neuronal isoform of NO synthase by targeted disruption of the neuronal nitric oxide synthase gene. In these mice, Hara et al. (1996) found reduced brain edema and infarction volume after transient middle coronary artery occlusion. Nishimura et al. (1998) described an experimental model of thromboembolic stroke without craniotomy in cynomolgus monkeys by delivering an autologous blood clot to the middle cerebral artery. A chronic catheter was implanted in the left carotid artery in male cynomolgus monkeys. A 5 cm long piece of an autologous blood clot was flushed into the internal carotid artery with physiological saline. A neurological score was assigned at 0.167, 0.5, 1, 2, 4, 6, and 24 h after embolization. In the acute phase after embolization, typical behavior consisted of circling gait and moderate deviation towards the side of embolization, long-lasting and strong extensor hypotonia of the contralateral lower and upper limbs, and mild to severe incoordination. Contralateral hemiplegia was observed over the following 24 h. At 24 h the animals were sacrificed immediately after the last neurological scoring, and the cerebral vasculature was inspected for the location of the clot. The brain was then cut into 2 mm thick coronal sections. Cerebral infarction size and location were ascertained by the triphenyl- 2H-tetrazolium chloride staining method. The lesions involved mostly the caudate nucleus, internal capsule, putamen and thalamus. Salom et al. (1999) subjected female goats to 20 min global cerebral ischemia under halothane/N2O anesthesia. An episode of transient global ischemia was achieved by occlusion of the two external carotid arteries and simultaneous external compression of the jugular veins by a neck tourniquet. A reperfusion period started when the occlusions were released, and it was monitored for 2 h. De Ley et al. (1988) studied experimental thromboembolic stroke induced by injection of a single autologous blood clot into the internal cerebral artery in dogs bypositron emission tomography. A.8.1.5 Photochemically Induced Focal Cerebral Ischemia in Rats ... PURPOSE AND RATIONALE Focal cerebral ischemia in rats can be induced by irradiation with intensive green light via a fibre optic through the skull after injection of the dye Rose Bengal. The resulting cerebral infarct can be studied for various parameters, such as infarct volume, water content, local cerebral blood flow and glucose utilization. PROCEDURE Male Sprague–Dawley rats (300–350 g) are used.Anesthesia is induced with 3 % halothane in oxygen and is maintained with 1%halothane in oxygen applied via a face mask. A small incision is made in the skin over the right femoral vein and a thin catheter is inserted. One ml of the dye Rose Bengal (in a concentration of 5 mg/ml of saline) is injected. A midline head incision is made and the right side of the skull is exposed. An intense green light, produced by a xenon lamp (75 W, Zeiss, FRG) and then passed through a filter (wavelength 570 nm, Schott, Mainz, FRG) and a heat filter (Schott, Mainz, FRG), is directed on the skull at the level of the bregma for 15 min. The 3 mm diameter of the illuminated circle is determined by passing the light through a fibre optic (Schott, Mainz, FRG) while in close contact to the skull. The temperature of the skull underneath the fibre optic does not change during the time of illumination. At the end of the induction period, the temporary catheter is removed from the femoral vein which remains patent following the closure of the catheterization site with liquid suture (Histoacryl, Braun, Melsungen, FRG), and the incisions in the leg and head are likewise sutured after liberal application of local anesthetic. The anesthetic gas mixture is discontinued and the rats are allowed to recover consciousness in a warmenvironment until such times as the appropriate experiment is to be performed.Due to the non-invasive nature of this technique it is not possible to measure blood pressure or blood gases during the ischemic period. However, rectal temperature and plasma glucose concentrations are controlled. Measurement of Infarct Volume Osmotically controlled mini-pumps (Model 2ML1 Alzet, USA) are placed into the peritoneum of two groups of six male Sprague Dawley rats (body weight 300–350 g). The mini-pumps are fitted via thin polyethylene catheters to the femoral vein of the rats. Each pump contains either 2 ml of physiological saline or 2 ml of a solution of the drug to be studied. The animals are then given an ischemic insult as described in the previous section. Seventy-two hours after the induction of ischemia, the rats are sacrificed by decapitation and the brains removed and frozen at −50 °C. Coronal sections (20 μ) are cut in a cryotome at −20 °C, fixed in Haidenhain’s Susa and stained with Cresyl Violet. The ischemic area on 90 sections is measured and the volume of ischemic change is then calculated using a linear trapezoidal extrapolation of the areas measured. Measurement of Brain Water Content Three groups each of six rats are used. One group receives no ischemic lesion (the illumination with green light is omitted from the experimental protocol) and two groups are lesioned as described above. One lesioned group receives the test drug orally at 15 min, 30 min, 1, 3 and 5 h after the induction of the ischemia or sham operation. The other group is treated with saline at the same time-points. Twenty-four hours later the rats are sacrificed by decapitation. The brains are rapidly removed and placed on a cutting block with 1 mm gradations. Two cuts are made 1 mm or less anterior and posterior to the lesion. The thick section so produced is then divided into left (non-lesioned) and right (lesioned) halves and placed in pre-weighed vials and the wet weights of the tissue samples are carefully measured. The tissue is then frozen in liquid nitrogen and then left under vacuum (less than 0.1 Torr) for 24 h. On removal the vials are sealed to prevent rehydration and reweighed to obtain the dry weight of tissue from which the water content (expressed as percentage of wet weight of tissue) is calculated. EVALUATION All data are presented as mean ± SD of the mean. For left (contralateral to the lesion) against right (ipsilateral to the lesion) comparisons, a t-test with paired comparison was used (P < 0.05). Statistical differences between groups were calculated using the unpaired t-test. MODIFICATIONS OF THE METHOD Boquillon et al. (1992) produced cerebral infarction in mice by intravenous injection of 10 mg/kg rose bengal, and by focal illumination of the intact skull surface for 3 min with a laser source, operating at 570 nm with power levels of 2, 5, 10, and 20 mW. Matsuno et al. (1993) used a similar model to induce cerebral ischemia in rats based on middle cerebral artery occlusion by the photochemical reaction of rose bengal after irradiation with high intensity green light. Stieg et al. (1999) studied neuroprotection by the NMDA receptor-associated open-channel blocker memantine in a photothrombotic model of cerebral focal ischemia in neonatal rat. An excellent correlation between infarct size determined by magnetic resonance imaging (MRI) and histopathological analysis in the same animals was found. A.8.1.6 Microdialysis and Neuroprotection Experiments After Global Ischemia in Rats ... PURPOSE AND RATIONALE Transient global ischemia can be induced in rats by electrocauterization of the vertebral arteries followed by clamping of the carotid arteries. PROCEDURE Male Wistar rats weighing 280–340 g are used. The rats are anesthetized with methohexital sodium (60 mg/kg i.v.) and the vertebral arteries are electrocauterized (Pulsinelli and Brierley 1979). The rats are fasted overnight and re-anesthetized on the following day with halothane and intubated. The femoral artery and vein are cannulated to allow blood sampling, blood withdrawal and recording of mean arterial pressure (MAP). Samples of blood are taken at regular time intervals and blood gas/acid base status is analyzed (Instrumentation Laboratory, 1306). Rectal temperature is measured with a thermistor and controlled at 37 °C by means of a heating lamp. Four-vessel occlusion ischemia is induced for 20 min by bilateral carotid clamping followed by a period of reflow. Microdialysis Experiments The head of the rat is fixed in a stereotactic frame. The skin is incised over the head, pulled apart and a 3 × 3 mm hole is drilled through the cranium. A microdialysis probe (Sandberg et al. 1986) is implanted into CA1 region of the hippocampus (2.2 mm lateral and 3.8 mm dorsal to bregma, and the window of the dialysis membrane 1.4–2.9 mm below the cortical surface). The electroencephalogram (EEG) is measured continuously with a tungsten electrode attached to the dialysis probe. The probe is perfused at a rate of 2.5 μl/min with a modified Ringer solution. Dialysates are sampled every 10 min and analyzed for purines (Hagberg et al. 1987) and amino acids (Lindroth et al. 1985). One group receives the test drug i.p. 15 min prior to ischemia whereas the control group obtains saline. The animals are followed during 20 min of ischemia and 2 h of reflow. HPLC analyses are carried out using a reversephase C18 column (Waters 10 μmμBondapak) with isocratic elution, a flow rate of 1.0 ml/min and at ambient temperature. For adenosine, inosine and hypoxanthine the mobile phase is 10 mM NH4H2PO4, pH6.0, 13 % methanol. Neuroprotection Experiments During ischemic insult and for 20 min of reflow, the temperature of the temporalis muscle is controlled at 37 °C. Immediately following ischemia the rats are divided into two groups. One group is treated with the test drug and the other with saline. A bolus injection is administered i.p. 15 min after ischemia and a miniosmotic pump is implanted into the abdominal cavity which delivers the test drug for 7 days. Control animals receive a bolus of saline and mini-osmotic pumps filled with saline. Seven days later the rats are anesthetized with pentobarbital and perfusion-fixed with formol saline. The histological evaluation is done “blind”. The hippocampal damage is semiquantified according to the following scoring system: 0 = no damage 1 = scanty damage, 2 = moderate damage 3 = severe damage 4 = complete loss of pyramidal cells in the hippocampus. EVALUATION The purine and amino acid data are expressed as means ± SEM and differences are evaluated with the nonparametric Mann–Whitney test. The neuroprotective efficacy of the test drug is evaluated with two-tailed Student’s t-test. MODIFICATIONS OF THE TEST In addition to the assessment of neuronal damage, Block et al. (1996) tested spatial learning of treated rats one week after 4-vessel occlusion in a Morris water maze. A.8.1.7 Hypoxia/Hypoglycemia in Hippocampal Slices ... PURPOSE AND RATIONALE The in vitro release of adenosine, inosine, and hypoxanthine from rat hippocampal slices can be determined with and without drug. PROCEDURE Male Sprague–Dawley rats weighing 150–275 g are decapitated, the hippocampi isolated and cut into 400 μm thick slices which are placed into KRB (4 °C) containing (mM) NaCl (118), KCl (4.85), MgSO4 (1.15), KH2PO4 (1.15), NaHCO3 (25), glucose (5.5), CaCl2 (1.3) equilibrated with 95 % O2/ 5 % CO2. The incubation medium is brought up to room temperature over a period of 30 min. The KRB is then replaced with fresh medium and the slices are incubated for a further 30 min at room temperature, followed by 30 min at 37 °C in fresh KRB. Following the initial incubations, slices are labelled for 45 min with 3H-adenine (5 μCi/ml) at 37 °C. Two labelled slices are transferred into plastic cylinders which have nylon net bases and these, together with the slices, are placed into glass superfusion chambers. Slices are superfused at a flow rate of 0.5 ml/min with KRB at 37 °C. After a 60 min wash, collection of 5 min fractions begins, which continues throughout the remainder of the experiment. A 1.25 ml aliquot of the fractions is taken for determination of radioactivity using scintillation spectrometry (scintillation fluid: Picofluor 15). The remaining 1.25 ml is taken for HPLC analysis of purines and amino acids. Hypoxia/hypoglycemia is induced by superfusion with KRB containing no glucose and 95%N2 and 5 % CO2 for 35 min followed by recovery. All other procedures are as described above. The test drug is added to the perfusion fluid at an appropriate concentration. The 1.25 ml aliquots taken for HPLC analysis are pooled with two other aliquots (total 3.75 ml), lyophilized and concentrated 10 fold before analysis. Samples are analyzed for adenosine, inosine and hypoxanthine with HPLC. The radioactivity associated with each of these fractions is also determined by collecting the eluent from the column at the appropriate times. HPLC analyses are carried out using a reversephase C18 column (Waters 10 μmμBondapak) with isocratic elution, a flow rate of 1.0 ml/min and at ambient temperature. For adenosine, inosine and hypoxanthine the mobile phase is 10 mM NH4 H 2PO4, pH6.0, 13 % methanol. EVALUATION Values for adenosine, inosine and hypoxanthine can be expressed in two ways: (1) release rate per slice (pmol/min × slice); (2) percentage of the total amount of released radioactivity (% total 3H-label released). The purine data are expressed as means ± SEM and differences are evaluated with the non-parametric Mann–Whitney test. A.8.1.8 Measurement of Local Cerebral Blood Flow and Glucose Utilization in Rats ... PURPOSE AND RATIONALE Cerebral glucose utilization can be determined using [14C]-2-deoxyglucose according to Sokoloff et al. (1977). Local cerebral blood flow using [14C]- iodoantipyrine is measured as described by Sakurada et al. (1978). PROCEDURE Animal Preparation The experiments are performed on male Sprague- Dawley rats (260–300 g). Catheters are placed, under light halothane (1 %) anesthesia, into the femoral vein and artery of each hind limb (for the measurement of mean arterial pressure, the sampling of arterial blood and the intravenous administration of drugs and radioisotopic tracer). The wound sites are then infused with local anesthetic, sutured, and protected by pads. The lower abdomen is covered by an elastic stocking, followed by a loose-fitting plaster coat. Anesthesia is discontinued and the rats are allowed at least two hours to recover before any further manipulations are performed. Experimental Protocol The rats are given an intravenous infusion (50 μl/min) of either saline or the test drug dissolved in saline. This infusion is maintained throughout the measurement of local cerebral blood flow or local cerebral glucose utilization. Local Cerebral Glucose Utilization A full description of the method for measuring local cerebral glucose utilization using [14C]-2-deoxyglucose has been published (Sokoloff et al. 1977). Five minutes after the administration of the test drug, the experiment is started with the intravenous administration of [14C]-2-deoxyglucose (125 μCi/kg). Fourteen timed arterial blood samples are taken during the following forty-five minutes. These samples are centrifuged and the plasma is measured for glucose concentration (using an automated glucose analyzer) and [14C] levels (by liquid scintillation counting). At the end of this period the rats are sacrificed by decapitation, the brain rapidly removed and frozen at −45 °C. Twenty micron thick coronal sections are cut in a cryostat (−22 °C) and autoradiograms are prepared by placing these sections in an array against Kodak SB-5Xray film along with pre-calibrated plastic standards range (55–851nCi/g) for seven days in light-tight cassettes. Local Cerebral Blood Flow The autoradiographic measurement of local cerebral blood flow using [14C]-iodoantipyrine is carried out as described by Sakurada et al. (1978). [14C]- iodoantipyrine (125 μCi/kg) is administered fifteen minutes after the infusion of the test drug has commenced. In a period of sixty seconds, eighteen timed arterial samples are collected in pre-weighed filterpaper discs from a free flowing arterial catheter. The discs are reweighed and the [14C] concentration of each is measured by liquid scintillation counting. At the end of one minute, the rat is decapitated and autoradiograms are prepared in the same manner as for the measurement of local cerebral glucose utilization. Densitometric Analysis of Autoradiograms Tissue [14C] concentrations were determined using a densitometer system (Zeiss, FRG) by reference to the images of the precalibrated standards. For each structure of interest, bilateral determination of optical densities are made on six different autoradiographic images in which the structure is best defined. The mean optical density is used to calculate [14C] concentrations. From this value, and the history of [14C] in the blood, values of local cerebral blood flow and glucose utilization are obtained using the respective operational equations of thesemethods (Sakurada et al. 1978; Sokoloff et al. 1977). EVALUATION Groups of data are statistically compared by t-test with unpaired comparison using the BONFERRONI correction factor for multiple group analyses. Linear regression data for comparing cerebral blood flow (CBF) and glucose utilization (GU) undergo log transformation as recommended by McCulloch et al. (1982). MODIFICATIONS OF THE METHOD Ito et al. (1990) measured glucose utilization in the mouse brain by the simultaneous use of [14C]2-deoxyglucose and [3H]3-O-methylglucose. High-resolution animal positron emission tomography was recommended by Magata et al. (1995) for noninvasive measurement of cerebral blood flow with 15O-water and glucose metabolic rate with 18 F-2- fluoro-2-deoxyglucose. The effect of ginseng pretreatment on cerebral glucose metabolism in ischemic rats using animal positron emission tomography (PET) with [18 F]-2 fluoro-2-deoxy-D-glucose ([18 F]-FDG) was described by Choi et al. (1997). Hawkins et al. (1993) developed a method for evaluating tumor glycolytic rates in vivo with nude mice injected with 2-[18 F]fluoro-2-deoxy-D-glucose and a dedicated animal positron emission tomography scanner. Positron emission tomography has been used with specific ligands for CNS imaging (de la Sayette 1991; Jones et al. 1991; Kung 1993). Rogers et al. (1994) synthesized 18 F-labelled vesamicol derivates to be evaluated in small animal positron emission tomography. Hume et al. (1997) measured in vivo saturation kinetics of two dopamine transporter probes using a small animal positron emission tomography scanner. A.8.1.9 Cerebrovascular Resistance in Anesthetized Baboons ... PURPOSE AND RATIONALE Cerebral blood flow and cerebrovascular resistance can be measured by injection of inert radioactive gas (133Xenon) and evaluation of the 133Xe clearance curve in anesthetized baboons. PROCEDURE Animal Preparation The experiments are performed on baboons (Papio or cynocephalus) weighing 9–13 kg. Initial sedation with phencyclidine (10 mg i.m.) is followed by an intravenous injection of sodium thiopental (75 mg/kg). The animals are intubated to a positive pressure ventilator delivering 70:30 % nitrous oxide and oxygen in open circuit. A continuous intravenous infusion of phencyclidine (0.01 mg/kg/min) is given throughout the course of the experiment. Suxamethonium (50 mg i.m.) is administered every 30 min in order to assist control of ventilation with the respiratory pump. During the experiments, the end tidal concentration of CO2 is continuously measured and the ventilating pump adjusted to maintain an arterial CO2 tension (PaCO2) of between 37 and 40 mm Hg for the control measurements. Arterial blood samples are taken during every measurement of cerebral blood flow (CBF) to measure PaCO2, PaO2 , and pH by direct reading electrodes (Corning). Body temperature is maintained around 37 °C by means of an electrically heated blanket and infrared heating lamps. Catheters are inserted into the aorta via femoral arteries for the continuous measurement of arterial blood pressure and for the withdrawal of arterial blood samples. Both femoral veins are cannulated, one for the continuous infusion of phencyclidine and the other for the infusion of the test drug. A catheter is inserted into the right lingual artery so that its tip lays just distal to the carotid bifurcation. This catheter is flushed at regular intervals with heparinized saline to prevent platelet aggregation at the tip. In the studies with required intravenous administration of test drug, the other branches of the external carotid artery are ligated. Where the requirement is for intracarotid administration of test drug, another catheter is retrogradely advanced into the external carotid artery so that its tip lays next to the tip of the lingual catheter. This catheter is then attached to a constant-rate infusion pump (Sage Instruments). Heparinized saline is infused at a rate of 0.2 ml/min to act as a control for drug infusion. A burr hole is made over the midline fissure and a catheter inserted into the sagittal sinus for the withdrawal of cerebral venous blood samples. The hole is sealed with plaster of Paris. The scalp and temporalis muscle are removed with diathermy down to the level of the zygomatic arch. Measurement of Cerebral Blood Flow, Cerebral Oxygen Utilization, and Cerebrovascular Resistance A collimated scintillation crystal is placed over the temporal region of the exposed skull on the right side and angled in such a way that viewed only brain and overlying skull. Approximately 260 μCi of 133Xenon dissolved in 0.5 ml sterile heparinized saline (500 IU) is injected over 1 s into the catheter in the lingual branch of the carotid artery. The gamma-ray emission of the 133Xe are detected by the scintillation counter attached to a photomultiplier. The pulses are amplified and subjected to pulse height analysis (peak 81KeV ± 8KeV) to reduce Compton scatter before fed into a rate meter and scaler. The output from the rate meter is displayed on a chart recorder. Cerebral blood flow is calculated from the height/area equation (Høedt-Rasmussen et al. 1966). The formula used is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ F = (H_2 - H_{10} ) \times 100/\lambda A_{10} \;, $$\end{document} where F is CBF in ml blood per 100 g brain tissue per min; λ = brain tissue/blood partition coefficient for 133Xe (the figure of 1.1 is used [Veall and Mallett 1966]); Hi = maximum initial height of the 133Xe clearance curve in counts per min as taken from the chart recorder; H10 = height of the clearance curve 10 min after the peak height in counts per s; A10 = total integrated counts over the 10 min of clearance as taken from the scaler and corrected for background activity over that period. Cerebral oxygen consumption is measured from the product of the DBF and the difference in oxygen content between the arterial blood and cerebral venous blood sampled from the sagittal sinus. Blood oxygen is measured by a charcoal-fuel cell system (Lex-O2-Con). An estimate of cerebrovascular resistance is obtained by subtracting the mean sagittal sinus pressure from the mean arterial pressure and dividing this pressure difference by the CBF. EEG Recording Electroencephalographic readings are recorded bilaterally throughout the experiment. A series of holes are drilled in the calvarium 10 mm apart in two rows. Each row is 14 mm lateral to the sagittal suture. The holes are threaded to receive nylon screws in which silver-silver chloride ball electrodes are fixed loosely. The electrodes are positioned epidurally and the free ends are soldered to a multi-channel socket which is mounted on the calvarium with plaster of Paris. Experimental Procedure Following completion of the surgery, the animals are left undisturbed for 1 h. At least three control estimations of CBF and other parameters are made until steady conditions of flow, arterial blood pressure, and blood gas tensions are obtained. Protocols Intravenous administration. After stable control values have been established, the infusion is started. The CBF is measured at 5 min after the start and again at 25 min. The infusion is stopped 10 min after this flow period, giving a total infusion time of 35 min. Further flow measurements are made at 10, 30, and 50 min after stopping the infusion. Intracarotid administration. After establishing control values, the intracarotid infusion of the test drug is begun. The CBF is measured at 10, 30, 50 and 70 min. The infusion is stopped 80 min after commencing, and post infusion measurements are made after 20, 40, and 60 min. EVALUATION Data are presented as mean values ± SEM Evaluation of statistical significance is performed by means of Student’s t-test with Bonferroni correction. MODIFICATIONS OF THE METHOD Kozniewska et al. (1992),Wang et al. (1992) measured cerebral blood flow in rats by intracarotid injection of 133Xe. Solomon et al. (1985) and Clozel and Watanabe (1993) induced cerebral vasoconstriction by injection of autologous blood in the cisterna magna of rats. Cerebral blood flow was measured with the radioactive microsphere technique. Lin et al. (2003) described a model of subarachnoid hemorrhage-induced cerebral vasospasm in mice. Adult mice received injections of autologous blood into the cisterna magna. The diameters of large intracranial vessels were measured 1 h to 7 days after the subarachnoid hemorrhage. A diffuse blood clot was evident in both the anterior and posterior circulations. Vascular wall thickening, lumenal narrowing, and corrugation of the internal elastic lamina were observed. Both acute (6–12 h) and delayed (1–3 days) phases of vasoconstriction occurred after subarachnoid hemorrhage. Overall mortality was only 3 %. The model is recommended for screening of therapeutic candidates. Delayed cerebral vasospasm was induced in anesthetized dogs by removal of 4 ml cerebrospinal fluid and injection of the same volume of fresh autologous arterial nonheparinized blood into the cisterna magna by Varsos et al. (1983) as a model of subarachnoid hemorrhage. The procedure was repeated on the third day and angiogramswere taken of the vertebral-basilar vessels. The reduction of diameter of the basilar artery was taken as endpoint. Imaizumi et al. (1996) produced experimental subarachnoid hemorrhage by intracisternal injection of arterial blood in rabbits. The degree of vasospasm and the effect of calcitonin gene-related peptide were evaluated angiographically by measuring the basilar artery diameter. Inoue et al. (1996) produced experimental subarachnoid hemorrhage in cynomolgus monkeys by placing a clot around the internal carotid artery. A series of angiographic analyses were performed, before subarachnoid hemorrhage and on days 7 and 14 after treatment with calcitonin gene-related peptide to examine changes in the diameter of the ipsilateral internal carotid artery, middle cerebral artery, and anterior cerebral artery. Hughes et al. (1994) adapted the 133xenon clearance technique for simultaneous measurement of cutaneous blood flow in rabbits at a large number of skin sites within the same animal. A.8.1.10 Effect on Cerebral Blood Flow in Cats (Fluvography) ... PURPOSE AND RATIONALE Cerebral blood flow in anaesthetized cats an be measured by fluvography. The heat transfer coefficient of the brain can be measured with a probe representing an indirect blood flow value. In this method, the measuring device consists of a thermo probe, which is attached to the tissue in order to record continually the heat transport (Hensel, 1956). The device depends on having an electrically heated part and an unheated reference point. The difference in temperature between the heated part of the device and the unheated reference point is a function of local blood flow. An increase in flow tends to lower the local temperature by carrying away the heat gain and vice versa. PROCEDURE Cats of either sex weighing 2.5–4.0 kg are anaesthetized by intraperitoneal administration of pentobarbital sodium (35 mg/kg) and intubated with a tracheal tube. The left femoral vein and the right femoral artery are cannulated for i.v. drug administration and determination of arterial blood pressure, respectively. The arterial cannula is connected to a Statham transducer P 23Db. For intraduodenal drug administration the duodenum is cannulated following laparotomy. Before actually starting the experiment, the arterial blood gas concentrations are determined. Animals are only used for further testing if they show normal blood gas concentrations. During the course of the experiment, blood flow, blood pressure and blood gas concentrations are regularly monitored. The head of the animal is fixed in a stereotactic device. The skull cap and the dura are opened, the probes are placed on the surface of the cortex in the region of the marginal frontal gyrus, and the exposed brain is covered with moist swabs. The Fluvograph (Hartmann + Braun, Frankfurt) is used with the appropriate thermo probes. To test the correct position of the thermocouple and the response of the animal, inhalations of carbon dioxide/ air or injections of epinephrine (adrenaline) are used, leading to a distinctive increase in cerebral blood flow. Following stabilization of the parameters mentioned above, the standard compound is administered and the change in blood flow is recorded. Five min after obtaining the original values, the test compound is administered. Standard compound: pentoxifylline 1 and 3 mg/kg (i.v. administration) 10 and 30 mg/kg (i.d. administration) EVALUATION The percent change in the heat transfer coefficient is used as an indirect measure for the change of cerebral blood flow. Statistics: Student’s t-test is performed by unpaired comparison. A.8.1.11 Effect on Cerebral Blood Flow and in Ischemic Skeletal Muscle in Rats (Laser-Doppler-Effect) ... PURPOSE AND RATIONALE The principle of the Laser Doppler effect is based on the fact that a laser light beam directed on tissue is scattered in static structures as well as in moving cells. Light beams scattered in moving red cells undergo a frequency shift according to the Doppler effect, while beams scattered in static tissue alone remain unshifted in frequency. The number of Doppler shifts per time is recorded as a measure for erythrocyte flow in a given volume. This means, that the direction of flow cannot be determined, but relative changes in micro circulatory blood flow can be recorded. The procedure can be used to detect test compounds that improve the blood supply of the brain or the flow of red blood cells in the ischemic skeletal muscle. PROCEDURE Male Sprague-Dawley rats weighing 300–500 g are anaesthetized with pentobarbital sodium (60 mg/kg i.p.). The trachea is exposed and intubated with a short tracheal tube to allow ventilation. The following vessels have to be cannulated: The femoral vein is cannulated for test drug administration. The femoral artery is cannulated for blood pressure recording and blood gas analysis. Before actually starting the experiment, the arterial blood gas concentrations are determined. Animals are only used for further testing if they show normal blood gas concentrations (pa CO2: 32–42 mm Hg; pa O2: 70–110 mm Hg). The mean arterial blood pressure should not drop below 100 mm Hg. During the course of the experiment, blood flow, blood pressure and blood gas concentrations are regularly monitored. For Cerebral Blood Flow The head of the animal is fixed in a stereotactic device. After trepanation of the skull (opening 3 mm in diameter), the Laser Doppler probe is placed 1 mm above the surface of the brain. Values are measured with the Laser Doppler apparatus (Periflux F2, Perimed KB, Stockholm). Following stabilization of the parameters mentioned above, the standard compound is administered and the change in blood flow is recorded. Five min after obtaining the original values, the test compound is infused. Following two administrations of the test compound, the standard compound is administered again. Duration of the effect is measured as half life in seconds. For Peripheral Blood Flow A small area of the femoral artery of the right hind limb is exposed and the Laser Doppler probe is placed 1 mm above the muscle surface. Before actually starting the experiment, the arterial blood gas concentrations are determined. Animals are only used for further proceeding if they show normal blood gas concentrations. During the course of the experiment, the blood pressure is recorded. The RBC flux is recorded continuously and after stabilization of the output signal, the femoral artery is occluded leading to underperfusion of the muscles of the right pelvic limb. At this stage, the test compound is administered by intravenous infusion for 10 min (0.05 ml/min). Standard compound for cerebral blood flow is propentofylline (1 mg/kg, i.v.). The percent increase in blood flow produced by propentofylline ranges between 40 % and 60 %. EVALUATION The percent increase in blood flow after test drug administration is determined (compared to the value before drug administration). Statistics: Student’s t-test by unpaired comparison, test substance versus standard. MODIFICATIONS OF THE METHOD Iadecola (1992), Prado et al. (1992), Raszkiewicz et al. (1992) measured the influence of nitric oxide on cortical cerebral blood flow in anesthetized rats by Laser-Doppler flowmetry. Benessiano et al. (1985) measured aortic blood flow with range-gated Doppler flowmeter in anesthetized rats. Partridge (1991) measured nerve blood flow in the sciatic nerve of anesthetized rats with a Laser Doppler Flowmeter after application of local anesthetics and of epinephrine. A.8.1.12 Traumatic Brain Injury ... PURPOSE AND RATIONALE A major goal in research into mechanisms of brain damage and dysfunction in patients with severe head injury and in discovery of potential therapies is the development of a suitable animal model. While a variety of experimental techniques have been developed (Denny-Brown and Russell 1941; Gurdjian et al. 1954; Ommaya and Gennarelli 1974; Sullivan et al. 1976; Nilsson et al. 1977; Hayes et al. 1984; Marmarou et al. 1994; Mésenge et al. 1996), the most widely employed technique is fluid percussion, which produces brain injury by rapid injection of fluid into the closed cranial cavity (Sullivan et al. 1976; McIntosh et al. 1989, 1990; Faden et al. 1989; Dixon et al. 1991; Sun and Faden 1995; Petty et al. 1996; Laurer et al. 2000; Maegele et al. 2005).Most authors used rats, however, other species, such ad cats (Sullivan et al. 1976; Hayes et al. 1983, 1984), rabbits (Lindgren and Rinder 1969) and mice (Hall et al. 1988; Mésenge et al. 1996) were employed. PROCEDURE Surgical Preparation Male Sprague Dawley rats weighing from 400 to 500 g are anesthetized with ketamine (80 mg/kg, i.m.) and sodium pentobarbital (20 mg/kg, i.p.). During surgical preparation and throughout the experiment, all wounds are infused with a topical anesthetic (lidocaine hydrochloride 2.0 %). Catheters are inserted into the femoral vein for drug administration and into the femoral artery for blood pressure/blood gas monitoring. A 2.0 mm hollow female Leur-Loc fitting (to induce trauma) is rigidly fixed with dental cement to the animal’s skull in a craniectomy centered over the left parietal cortex 5 mm from lambda, 5 mm from bregma, 4 mm from sagittal suture. The dura is left intact at this opening. Immediately following surgical preparation, a constant i.v. infusion of sodium barbital (15 mg/kg/h) is begun and maintained for the duration of the studies. Drug Administration Drugs or equal volumes of saline are administered through the femoral vein over 10 min by constant infusion beginning 15 min before trauma. Fluid-Percussion Injury The fluid-percussion device consists of a Plexiglas cylindrical reservoir, 60 cm long and 4.5 cm in diameter, bounded at one end by a Plexiglas, cork-covered piston mounted on O-rings. The opposite of the reservoir is fitted with a 2-cm-long metal housing on which a transducer is mounted and connected to a 5-mm tube (2 mm inner diameter) that terminates with a male Luer-Loc fitting. At the time of injury the tube is connected with the female Luer-Loc fitting that has been chronically implanted over the exposed dura of the rat. After the entire system is filled with 37 °C isotonic saline, injury is induced by a metal pendulum which strikes the piston of the device from a predetermined height. The device produces a pulse of increased intracranial pressure of fairly constant duration (21–23 ms) by injecting various volumes of saline into the closed cranial cavity. Brief displacement and deformation of neural tissue results from the rapid epidural injection of saline. The magnitude of injury is regulated by varying the height of the pendulum, which results in corresponding variations of the intracranial pressure expressed in atmospheres. The pressure pulses are measured extracranially by a transducer and recorded on a storage oscilloscope. EVALUATION Behavioral Outcome Posttraumatic deficits are evaluated at 24 h, 1week and 2weeks following trauma. Outcomes include forelimb flexion (right and left), lateral pulsion (right and left) and angle score (left, right and vertical position). Scores range from 0 (maximal deficits) to 5 (normal) for each task, By combining scores of all tests, a composite neuroscore is determined, ranging from 0 to 35 (Faden 1993). Histopathology At 2weeks, following final neurological scoring, the rats are sacrificed by decapitation. The brain is removed, quickly frozen in isopentane and stored in a –80 °C freezer until sectioning. Coronal brain sections are selected to span the longitudinal axis of the dorsal hippocampus between –3.2 and –3.8 Bregma. Sections (16 mm thick) are cut at –18 °C in a microtome-cryostat and thaw-mounted onto chrome-gelatin rubbed microscope glass slides and kept at –80 °C for histological study. Sections are stained with Crystal violet. CA1 and CA3 pyramidal cells with a distinct nucleus and nucleolus are counted as viable neurons, in one reticle within CA3 and in three reticles (R1, R2 and R3) within the subfield of the hippocampus, in both right and left hemispheres. The number of viable neurons is counted twice at 400 × microscope field. An immunochemical method is used to detect glial fibrillary acidic protein (GFAP)-positive astrocytes in the hippocampus (Faddis and Vijayan 1988). Counting of the number of cells is done under 400 × light microscopy in the dorsal CA1 subfield between medial and lateral regions. Statistical Analysis Neuroscores from forelimb flexion tests, lateral pulsion tests and angle board tests are statistically analyzed by non-parametric Mann-Whitney U-tests. Histological data are analyzed by one way ANOVA test, followed by Scheffe’s test. MODIFICATIONS OF THE METHOD Shohami et al. (1995) tested the effect of a non-psychotropic cannabinoid which acts as a non-competitive NMDA antagonist on motor and memory functions after closed head injury in the rat. Fox et al. (1998) developed a mouse model of traumatic brain injury using a device that produces controlled cortical impact, permitting independent manipulation of tissue deformation and impact velocity and resulting in sustained sensory/motor and cognitive defects. Tang et al. (1997) reported impairment in learning and memory in an experimental model of concussive brain injury in mice. Bemana and Nago (1998) induced acute intercranial hypertension in cats by continuous inflation of an extradural balloon with physiological saline at a constant rate of 0.5 ml/h for 3 h. At this point, inflation was discontinued and the balloon remained expanded for an additional hour after which it was deflated. A model of traumatic injury to the spinal cord was used by Springer et al. (1997). Female Long Evans rats weighing 200–250 g were anesthetized with pentobarbital and a dorsal laminectomy was performed to expose the spinal cord at thoracic level T 10. The vertebral column was stabilized by clamping the column at vertebra 8 and 11. The New York University (NYU) impactor device was used which produces accurate and reproducible damage to the rat spinal cord (Gruner 1992; Basso et al. 1996). This device is a weight drop apparatus that uses optical potentiometers to record the movement of a 10-g impact rod and the vertebral column following impact and is connected to a PC that monitors rod and vertebral movements during impact. A.8.1.13 Cerebral Blood Flow Measured by NMRI ... PURPOSE AND RATIONALE Over the past several years, magnetic resonance imaging (MRI) has become an established tool in the drug discovery and development process. The main advantages of MRI are its high resolution, non-invasiveness and versatility, which allow comprehensive characterization of a disease state and the effects of drug intervention. Recent advances now allow the application of this technique to the characterization of models of lung inflammation in rats and to the profiling of anti-inflammatory drugs. Repeated measurements can be carried out on the same animal, and time-courses of events can be easily assessed. Furthermore, the prospect of using MRI to detect non-invasively a sustained mucus hypersecretory phenotype induced by endotoxin brings an important new perspective to models of chronic obstructive pulmonary disease in animals. Importantly, it might be possible to extend the use of this technique to the clinical study of inflammation in the lung and the consequences of drug treatment (Beckmann et al. 2003, 2004). Functional magnetic resonance imaging has been developed as pharmacological magnetic resonance imaging for pharmacodynamic assays and to establish brain-penetrating parameters (Leslie and James 2000). Although the regional cerebral metabolic rate of glucose is strongly increased during cerebral activity, the cerebral metabolic rate of O2 is not increased in direct proportion. The result is that the relative uptake of O2 from blood actually decreases. The veins and capillaries draining from the activated region are “arterialized” and their deoxyhemoglobin concentration is reduced. Deoxygenated and oxygenated hemoglobin have different magnetization properties; thus the changes in the ratio of these two entities can be detected by blood-oxygen-level-dependent (BOLD) magnetic resonance imaging. At least for studies in animals, these methods may be preferred to positron emission tomography (Cherry and Phelps 1996). Petty et al. (2003) studied the in vivo neuroprotective effects of a systemically active antagonist of the NMDA receptor glycine site by magnetic resonance imaging in ischemic stroke in rats. PROCEDURE Transient Model of Focal Ischemia in Rats In the right common carotid artery was ligated. The transient model of middle cerebral artery occlusion was based on techniques described by Zea Longa et al. (1989) and Belayev et al. (1996). By means of an operating microscope, the right common carotid artery was exposed through a midline neck incision. The right superior thyroid, occipital, and pterygopalatine arteries were ligated and cut. A poly-L-lysine-coated 3–0 nylon monofilament with a heat-blunted tip was inserted through the proximal external carotid artery into the internal carotid artery and pushed forward a distance of 19 or 20 mm from the carotid bifurcation, depending on the weight of the rat, so as to occlude the origin of the middle cerebral artery. After suture placement, the neck incision was closed and the animal was allowed to regain consciousness. Two hours following occlusion of the artery, the rats were tested on a standard neurological battery to confirm the presence of a neurological deficit. Animals that did not exhibit a forelimb flexion were excluded from further study. At this time, the rats were re-anesthetised and the intraluminal suture was completely withdrawn to restore the blood supply. Magnetic Resonance Imaging (MRI) Measurements Measurements were performed 30 min, 3 h, and 24 h after the onset of ischemia on a 7-T Bruker BIOSPEC experimental scanner (DBX; Bruker Medical, Ettlingen, Germany) with a 30-cm bore magnet and actively shielded gradient coils (200 mT/m; rise time < 80 μs). A 72-mm resonator was used for rf transmission; signals were detected with a 35-mm inductively coupled surface coil placed over the skull of the animal. The rf coils were decoupled from each other – the transmitter coil actively and the receiver coil passively. Using gradient-echo imaging, sagittal pilot scans were performed to ensure accurate positioning of the animal in the magnet. For this purpose, the coronal plane 5.9 mm posterior to the rhinal fissure was placed in the isocenter of the magnet, thus focusing on the center of the ischemic territory resulting from the middle cerebral artery occlusion. For the determination of the temporal evolution of the ischemic lesion, two NMR imaging modalities were used. A field of view of 3.2 cm, a slice thickness of 1.5 mm, and an interslice distance of 2 mm were used for both sequences. Multislice packages were recorded by placing the center of the multislice imaging packet 5.9 mm posterior to the rhinal fissure. Diffusion-weighted imaging was performed using a Stejskal–Tanner spin-echo sequence [echo time (TE) = 37.2 ms, repetition time (TR) = 2325 ms, eight slices] in six rats per group. To enable quantification of the apparent diffusion coefficient (ADC) of brain water, three b values were used (b = 50, 825, and 1600 s/mm2). ADC maps were calculated pixelwise using the monoexponential model (Le Bihan et al. 1986). Perfusion-weighted imaging was performed with an ultrafast version of the arterial spin tagging technique (Kerskens et al. 1996; Franke et al. 2000) in four rats per group. In independent experiments, three coronal slices were recorded, thus covering the central part of the ischemic lesion. Measurement parameters were: TE = 3.5 ms, TR = 7.4 ms, MATRIX = 128 × 64, AVERAGE = 8. Each experiment consisted of two image acquisitions separated by a recovery period. During the first acquisition, blood flowing through the neck was adiabatically inverted (preparation TIME = 3 s; z-gradient = 5 mT/m; B1 FIELD = 150 mG; off-resonance FREQUENCY = 6000Hz; mean preparation DISTANCE = 2.8 cm upstream from the imaging plane); in the second acquisition, inflowing spins were left undisturbed. Both phases were separated by a recovery period of 10 s. In each perfusion experiment, the two images suffered the same signal loss due to magnetization transfer effects but differed in the magnetization of the inflowing blood. Perfusion-weighted images were obtained by subtraction of the acquisitions with and without prior adiabatic spin inversion. In the second acquisition, inflowing spins were left undisturbed. Perfusion-weighted images were obtained by subtraction of the acquisitions with and without prior adiabatic spin inversion. EVALUATION Data were transferred to a PC and image analysis was carried out using the image processing software Scion Image for Windows (Scion Corporation, Frederick, Md., USA). Lesion volumes were calculated using ADC maps, as the ischemic lesion area was estimated by summing up all pixels with a relative ADC < 80 % compared to the healthy, contralateral hemisphere (Hoehn-Berlage et al. 1995). Perfusion signal intensities are referred to the homologous contralateral regions and given as ratios of ipsilateral to contralateral values. MODIFICATIONS OF THE METHOD Edema following middle cerebral artery occlusion in spontaneously hypertensive rats was measured by magnetic resonance imaging (Seega and Elger 1993; Elger et al. 1994a). Magnetic resonance imaging was also used to determine the size of intracerebral hemorrhage in rats induced by stereotactic microinfusion of collagenase into the caudate putamen (Elger et al. 1994b). Reese et al. (2000) visualized regional brain activation by bicucculine by functional magnetic resonance imaging. Time-resolved assessment of bicucculine-induced changes in local cerebral blood volume was achieved using magnetite nanoparticles as an intravascular contrast agent. Pevsner et al. (2001) described a photothrombotic method of acute small stroke induction in rats with histopathologic and in vivo magnetic resonance imaging (MRI) observations from 3 to 6 h after irradiation, which is homologous to a human autopsy specimen. Utilizing 30 min of irradiation with minimal beam intensity (0.1 W/cm2) cold white light in conjunction with 20 mg of intravenous (i.v.) rose bengal as a rapid infusion, small infarcts were induced photochemically in the frontal lobes of rats. Using in vivo and ex vivo magnetic resonance imaging, Ohlstein et al. (2000) evaluated the effects of tranilast, an antiallergic drug, on neointima formation following balloon angioplasty of the rat coronary artery. Swain et al. (2003) employed T-two-star (T2*)-weighted and flow-alternating inversion recovery (FAIR) functional magnetic resonance imaging to assess chronic changes in blood volume and flow as a result of exercise in rats. Prolonged exercise induced angiogenesis and increased cerebral blood flow in primary motor cortex. Using MRI evaluation of brain damage, Banfi et al. (2004) demonstrated that pentoxifylline prevents spontaneous brain ischemia in stroke-prone rats. Henderson et al. (2004) studied functional magnetic resonance imaging during hypotension in young and adult cats. In a magnetic resonance imaging study Shirhan et al. (2004) found that spermine reduces infarction and neurological deficit a rat model of middle cerebral artery occlusion. Paczynski et al. (2000) studied the effects of fluid management on edema volume and midline shift in a rat model of ischemic stroke. MRI were obtained 24 h after the onset of ischemia so that the ratio of hemispheric volumes ipsilateral and contralateral to the infarct and the extent of midline shift could be obtained. Cash et al. (2001) evaluated the effectiveness of aminoguanidine as a neuroprotective agent in a rat model of transient middle cerebral artery occlusion using serial magnetic resonance imaging. The MRI protocol consisted of three interleaved imaging regimens: proton density-weighted imaging (PDWI), T2-weighted imaging (T2WI) and diffusion-weighted imaging (DWI). Repetition time (TR) was 3 s for each of the three regimens and echo times (TE) were 70 ms for the T2WI and DWI and 28 ms for the PDWI. For DWI, diffusion-sensitizing gradients (b-value 590 × 10–3 s/mm2) were applied along the inferior to superior axis of the brain. Two averages were acquired per phase encode step. The images were collected at an in-plane resolution of 0.31 × 0.31 mm from 18 contiguous, 1-mm-thick slices, with a total acquisition time of 43 min. A.8.2 Peripheral Blood Supply A.8.2.1 Perfused Hindquarter Preparation with Sympathetic Nerve Stimulation in Rats ... PURPOSE AND RATIONALE Perfusion of the hindquarter in rats with a constant flow rate allows the evaluation of the effect of drugs on the peripheral vascular bed. Since constant blood flow is maintained, changes in the vascular resistance of the perfused bed are directly proportional to changes in the perfusion pressure. PROCEDURE Male Wistar rats weighing between 250 and 300 g are pre-treated with heparin (1000 units/kg i.v.) and anesthetized with pentobarbital sodium (50 mg/kg i.p.) The animals are intubated with a tracheal tube and positive pressure ventilation is maintained with a Harvard Rodent Respirator at 4–6 ml/stroke and 50 strokes/min. The right jugular vein is cannulated with polyethylene tubing for administration of drugs. The lumbar sympathetic chain is isolated dorsal to the inferior mesenteric branches via an abdominal midline incision. The aorta is freed from the vena cava and two silk ligatures are placed around the aorta. The aorta is ligated and cannulated proximal as well as distally with polyethylene tubings. A short piece of rubber tubing is inserted at the distal end to allow intraarterial injections of drugs. Two “T” junctions allow the measurement of arterial pressure and perfusion pressure by Statham P 23Db pressure transducers being recorded through a Hellige physiological recorder. From the proximal part of the aorta, blood is forced to its distal part by a peristaltic pump (Desaga) through a glass coil kept at 40 °C. Flow rate is adjusted to produce a stable perfusion pressure as close to the systemic pressure as possible. After initial adjustment, flow rate is not altered for the remainder of the experiment. Following perfusion pressure stabilization, the sympathetic chain is isolated and a small (1 mm wide, 2 mm long) curved bipolar electrode is placed around the nerve for electrical stimulation. Square-wave pulses from a Grass stimulator are used to activate the nerve with a constant current of 2.5milliamps, supramaximal voltage and varying frequencies of 5 ms duration. A dose-response curve is established for norepinephrine by giving doses of 0.01 μg, 0.03 μg, 0.1 μg, 0.3 μg, 1.0 μg, and 3.0 μg intra-arterially and measuring perfusion pressure changes. Similarly, a frequency-response curve to nerve stimulation is established by stimulation at 3Hz, 6Hz, and 10Hz for 30 s. Two predrug readings are taken to insure consistent responses. A minimum of four animals is used for each test compound. EVALUATION The first predrug dose-response curves are compared with the second predrug, 5 min and 60 min postdrug dose-response curves. From regression equations for norepinephrine and nerve stimulation, mean responses and potency values with 95 % confidence limits are calculated. MODIFICATIONS OF THE METHOD Folkow et al. (1970) perfused the hindquarters of spontaneously hypertensive rats and control rats at a constant rate of flow with an oxygenated plasma substitute in order to study the increased flow resistance and vascular reactivity. The hindquarters were isolated from the upper part of the body by standardized mass ligatures at identical levels until the aorta and the inferior caval vein provided the only intact circulatory connections between the two parts of each animal. Thimm et al. (1984) described reflex increases in heart-rate induced by perfusing the hind leg of the rat with solutions containing lactic acid. Thimm and Baum (1987) obtained spike recordings from chemosensitive nerve fibres of group III and IV of the rat nervus peroneus. Applications were performed either by perfusion of the circulatory isolated hindleg or by superfusion of the isolated musculus extensor digitorum longus. Kitzen et al. (1978) used the perfused hind limb of the dog with sympathetic nerve stimulation for cardiovascular analysis. Reitan et al. (1991) developed a near anesthetic-free isolated hindlimb model in the dog and studied the effects of halothane and atropine sulfate on vascular resistance. Wiegershausen and Deptalla (1969) used the isolated perfused hindlimb of the cat to study the influence of local anesthetics on the vasoconstrictor actions induced by bradykinin, epinephrine and histamine. Santiago et al. (1994) analyzed the responses to bradykinin in the hindquarters vascular bed of the cat. Champion et al. (1996, 1997) analyzed the responses of human synthetic adrenomedullin, an analog of adrenomedullin and calcitonin gene-related peptides in the hindlimb vascular bed of the cat. A.8.2.2 Effect on Peripheral Blood Flow in Rats ... PURPOSE AND RATIONALE Various methods exist to measure peripheral blood flow in rats, such as the microsphere technique, electromagnetic flowmetry and Doppler ultrasonic flowmetry. Radioactive microspheres are used to calculate the distribution of blood from the heart to various organs and tissues before and after the administration of test compounds. In this method, microspheres are injected into the left cardiac ventricle. It is postulated that the first contraction of the cardiac muscle will expel these spheres into the circulation. Consequently the microspheres can be trapped in different organs according to the organ’s perfusion rate. It is not a primary screening method but it is a useful test for distinguishing compounds with blood flow altering activities. The microspheres used are 14 μ in diameter. They are marked with isotopes. In this test, four different radioactive elements are used (Cr51, Sr85, Sc46, Ce141), allowing the determination of blood flow before dosing and after the administration of 3 different compounds or 3 different doses (of the same compound). PROCEDURE Male Wistar rats weighing 500–550 g are anaesthetized with pentobarbital. The trachea is exposed and intubated with a short endotracheal tube to allow ventilation. Prior to testing the jugular vein is cannulated for administration of test drugs. The carotid artery is cannulated and later on the catheter is passed retrograde into the ventricle. Ventricular pressure is recorded to assure the correct emplacement of the catheter tip in the ventricle. This catheter is connected to another catheter allowing the injection of microspheres into the left ventricle later on. The right arteria brachialis is cannulated and connected to a Hellige blood pressure recorder. During the course of the test, blood pressure will be measured continuously. The left femoral artery is cannulated and connected to an infusion pump. During the experiment blood will be withdrawn from this artery. After these preparations the rat is allowed 15–30 min to recover. Before actually starting the experiment, the arterial blood gas concentration of each animal is measured. Animals are only used for the experiment if they show normal blood gas concentrations. During the following procedure blood pressure, ventricular pressure and the heart rate are continuously recorded. To determine baseline blood flow animals receive 0.2 ml vehicle/min over a 3 min period. In the 4th minute rats receive the first injection of microspheres (Cr51). Simultaneously 0.5 ml/min blood is withdrawn from the femoral artery catheter for one minute, the pump thus being used as a reference organ. The animals are allowed 20 min to recover before the administration of drugs. The test compound is infused into the jugular vein at a rate of 0.2 ml/min for 3 min followed by injection of the second microsphere (Sr85). The same procedure is repeated using the other two microspheres (Sc46 and Ce141) following administration of the second and third test compound. At the end of the experiment blood gas concentrations are measured. The animals are killed and their organs are removed. Usually blood flow is determined in the following organs: brain (right and left hemisphere; right hemisphere showing slight ischemia due to cannulation of carotis) cerebellum lungs heart kidney (right and left) skeletal muscle (right hind extremity) duodenum stomach spleen diaphragm adrenal gland (right and left) To determine effects of test compounds on the blood flow in the underperfused skeletal muscle the same experiment can be performed with the right femoral artery being clamped. In this way effects of the test drug on the ischemic and normal skeletal muscle (left thoracic limb) can be compared in the same animal. EVALUATION The rate of blood flow/tissue at a certain time is determined by measuring radioactivity in the different tissues and comparing the results to that of the blood sample. MODIFICATIONS OF THE METHOD Blood flow in various peripheral organs, e. g., renal blood, flow can be measured with electromagnetic flowmeters (e. g., Transflow601, Skalar Medical, Holland) or with Doppler ultrasonic flowmetry (Shaffer and Medvedev 1991). Lappe et al. (1986) studied regional vascular resistance in conscious spontaneously hypertensive rats which were chronically instrumented with pulse Doppler flow probes to allow measurement of renal, mesenteric and hind quarters blood flow. Hartman et al. (1994) validated a transit-time ultrasonic volume flow meter by simultaneous measurements with an electromagnetic flow metering method. Lepore et al. (1999) used electron paramagnetic resonance to investigate the time course of nitric oxide generation and its susceptibility of nitric oxide synthase in ischemia-reperfusion injury to rat skeletal muscle in vivo. Total hind limb ischemia was applied for 2 h using a rubber band tourniquet method. At the end of ischemia the tourniquet was removed and the limb allowed to reperfuse for various time intervals. Beattie et al. (1995) measured carotid arterial vascular resistance in anesthetized rabbits. Carotid blood flow was measured by a Doppler flow probe placed around the right common carotid artery. Dose-response curves of reduction of carotid arterial vascular resistance were constructed after injection of various doses of substance P-methyl ester via the right lingual artery. Intravenous injection of various doses of a selective tachykinin NK1 receptor antagonist inhibited this effect dose-dependently. A.8.2.3 Effect on Peripheral Blood Flow in Anesthetized Dogs ... PURPOSE AND RATIONALE Effects on blood pressure have to be analyzed whether they are mediated by central, cardial, or peripheral action. By injecting small doses of the test compound directly into a vascular bed, thus avoiding changes of central hemodynamics, peripheral vasodilating activity of a compound can be tested. This test is used to evaluate direct vasodilating or constricting activities of drugs in vivo-measurements of blood flow. PROCEDURE Male or female Beagle or Labrador-Harrier dogs weighing 15–25 kg are used. The dogs are premedicated intravenously with heparin (bolus of 500 IU/kg and successive injections of 50 IU/kg every 30 min) and anesthetized by intravenous injection of thiobarbital sodium (0.5 mg/kg i.v.), chloralose (20 mg/kg i.v.) and urethane (250 mg/kg i.v.). Respiration is maintained with room air through a tracheal tube using a positive pressure respirator. Blood gas analysis is performed at regular time intervals. Oxygen is supplied via the respirator as needed. Preparation for Hemodynamic Measurements To measure peripheral blood flow and to administer the test substance, a bypass is inserted into a femoral artery incorporating an electromagnetic flow probe and a port for injections. The other femoral artery is also equipped with a bypass used for the administration of a reference compound or a second test drug. For recording of peripheral blood pressure and heart rate, one of the bypasses is connected to a pressure transducer (Statham P 23BD). All parameters are recorded continuously during the whole experiment. Experimental Course When stable hemodynamic conditions are achieved for at least 20 min, the vehicle is administered (control), and 10 min later the test compound. Immediately after each administration, the port is flushed with physiological saline. Successive doses are administered after recovery to baseline values. Readings are taken at times 0, 0.5, 1, 2, 5 and 10 min, and, if necessary, at additional 10 min-intervals following drug administration. Standard compound: carbocromene 1 mg/kg Characteristics: blood pressure – systolic, BPs – diastolic, BPd heart rate, HR peripheral blood flow, PF EVALUATION Changes in blood pressure, heart rate and peripheral blood flow at different times after drug administration are compared to vehicle control values obtained in the 10 min pre-drug period. With n > 2, results are presented as mean ± SEM. Statistical significance is assessed by means of the paired t-test. Scores are compared to the efficacy of standard compounds for intensity and for duration of the effect. MODIFICATIONS OF THE METHOD Regional blood flow can be determined by the use of microspheres (Rudolph and Heyman 1967). The method is based on the principle that biologically inert microspheres will be trapped due their diameter in the microvasculature (Hales and Cliff 1977). The use of radioactive microspheres has some disadvantages (Buckberg et al. 1971). The use of fluorescent labeled microspheres for measurement of regional organ perfusion has been recommended (Glenny et al. 1993; Prinzen and Glenny 1994; van Oosterhout et al. 1995). Raab et al. (1999), Thein et al. (2000) described the automation of the use of fluorescent microspheres using a special sample processing unit. A Zymate-Robotic System (Zymark, Idstein, Germany) was modified to handle a special filtration device. Ebara et al. (1994) measured renal blood flow in dogs after intrarenal arterial infusion of adrenomedullin. A.8.2.4 Effect on Peripheral Blood Supply Measured by Local Oxygen Pressure ... PURPOSE AND RATIONALE Local oxygen pressure is directly related to oxygen supply to peripheral organs, e. g., muscle (Luebbers 1969; Kessler 1969). The local oxygen pressure (PO2) is recorded directly on the muscle surface. In the following procedure the effect of test compounds on the local oxygen pressure (PO2) of the normal and the ischemic skeletal muscle is determined. PROCEDURE Male Beagle dogs weighing 15–20 kg are used. The dog is anesthetized by intraperitoneal administration of pentobarbital sodium (Nembutal). Prior to testing, the following vessels have to be cannulated: The V. femoralis of the left pelvic limb is cannulated for administration of test compounds. The A. femoralis of the left pelvic limb is cannulated for blood pressure recording. The V. femoralis of the right pelvic limb is cannulated. During the course of this test blood will be withdrawn from this vein to monitor lactate concentrations. Small areas of muscles of the right pelvic limb and the right thoracic limb are exposed. Muscle relaxation is induced by intravenous injection of 0.1 mg/kg alcuronium chloride (Alloferin) and maintained by i.p. administration of 0.05 mg/kg Alloferin at 30 min intervals. The trachea is exposed and intubated to assist the dog’s respiration. A PO2 electrode is placed on the exposed muscle area of the right hind limb. After stabilization of PO2 curves, the femoral artery of the right hind limb is occluded by putting a clip around the vessel. Muscle PO2 drops rapidly. Following stabilization, test compounds are given by intravenous infusion for 10 min or by intraduodenal administration at this stage. The PO2 of the non ischemic muscle is recorded simultaneously via a second electrode on the right thoracic extremity. The clip is removed after maximally one hour. This procedure can be repeated up to four times in one animal. Blood gas concentrations and pH are determined at the beginning and end of each experiment. Standard compound: pentoxifylline EVALUATION The following parameters are determined: Maximal increase in PO2 (mm Hg) after administration of test drug duration of effect by determining the half life A.8.2.5 Effect on Mesenteric Blood Flow in Rats ... PURPOSE AND RATIONALE Blood flow in the mesenteric vascular bed in situ (Bhattacharya et al. 1977; Eikenburg 1984; Randall et al. 1989; Jackson and Inagami 1990) can be studied in rats in a way similar to that of the perfused hindquarter. PROCEDURE Wistar rats of either sex weighing 250–300 g are anesthetized with a combination of urethane (500 mg/kg i.v.) and sodium pentobarbitone (30 mg/ kg). The abdomen is opened by a midline incision and a segment of the superior mesenteric artery is exposed by careful dissection of the surrounding tissue. Care is taken to avoid damage to the accompanying nerve terminals. One cannula is inserted into the carotid artery and the other into the superior mesenteric artery. Blood from the carotid artery is forced by a peristaltic pump (Desaga) into the superior mesenteric artery, using a glass coil kept at 40 °C. Blood required to fill the tubing initially is obtained from donor rats. Heparin is administered intravenously to the animals prior to cannulation of the mesenteric artery. The blood pressure and the perfusion pressure are measured by Statham P 23Db pressure transducers and recorded through a 2-channel Hellige recorder. The pump speed is initially adjusted so that the perfusion pressure equals the systemic blood pressure. Intraarterial injections into the mesenteric vascular bed are made by puncturing the tubing going towards the periphery. Intravenous injections are made through a cannula inserted into the external jugular vein. EVALUATION Changes in the vascular resistance are measured by comparing perfusion pressure before and after drug administration. If constant blood flow is maintained, changes in the vascular resistance of the perfused bed are directly proportional to changes in the perfusion pressure. MODIFICATIONS OF THE METHOD Reactivity in the mesenteric vascular bed can be tested in an isolated preparation (McGregor 1965; Kawasaki and Takasaki 1984; Laher and Triggle 1984; McAdams 1984; Foy and Nuhu 1985; Longhurst and Head 1985; Soma et al. 1985; Hsueh et al. 1986; Longhurst et al. 1986; Manzini and Perretti 1988; Nassar et al. 1988; Randall and Hiley 1988). The abdomen of anesthetized rats is opened and the superior mesenteric artery is separated from surrounding tissue in the region of the aorta. A cannula is inserted into the superior mesenteric artery at its origin from the abdominal aorta. The cannula is filled with heparinized Krebs solution. The ileocoeliac branch of the artery is tied off and the intestine separated from the mesentery by cutting close to the intestinal border of the mesentery. The cannulated artery and its vascular bed are dissected out and mounted in an organ bath. The preparation is perfused with oxygenated Krebs-bicarbonate buffer (pH 7.4) at 37 °C. Perfusion pressure is recorded via a side arm of the arterial cannula using a Statham pressure transducer. The flow rate is adjusted to give a baseline perfusion pressure of 20–30 mm Hg. The test substances are infused into another side arm of the arterial cannula for 15 s using an infusion pump. After three stimuli with norepinephrine (1 μg) or potassium chloride (1 mg), the test drugs are infused followed by further stimulation. The inhibition of increase of perfusion pressure after test drugs is expressed as percentage of control. Nuki et al. (1994) compared the vasodilating activity of chicken calcitonin gene-related peptide with human α-CGRP and rat CGRP in the precontracted mesenteric vascular bed of rats. The rabbit isolated arterially perfused intestinal segment preparation was used by Brown et al. (1983) as a model for vascular dopamine receptors. Komidori et al. (1992) recommended the isolated rat mesenteric vascular-intestinal loop preparation as an excellent model fort demonstrating resistance changes in isolated vascular beds while simultaneously measuring endogenous catecholamine overflow. Pelissier et al. (1992) showed that perfusion with hypotonic solutions removed the endothelial layer in the isolated perfused mesenteric vascular bed of the rat, allowing the study of endothelial-dependent vascular responses. Santiago et al. (1993) used the mesenteric vascular bed of the cat to study the inhibitory effects of the bradykinin receptor antagonist Hoe 140 on vascular responses to bradykinin. The responses of adrenomedullin and adrenomedullin analogs in the mesenteric vascular bed of the cat were compared by Santiago et al. (1995). Chu and Beilin (1994) studied the mesenteric vascular reactivity which is reduced in pregnant rats after application of bradykinin and the bradykinin receptor antagonist Hoe 140. Mulavi and Halpern (1977), Qiu et al. (1995) studied the mechanical and contractile properties of in situ localized mesenteric arteries in normotensive and spontaneously hypertensive rats. A.8.2.6 Effect on Pulmonary Blood Flow ... PURPOSE AND RATIONALE During controlled pulmonary blood flow, lobar arterial pressure can be measured in anesthetized cats (Lippton et al. 1984; Hyman et al. 1989; McMahon and Kadowitz 1993; deWitt et al. 1994). PROCEDURE Adult cats of either sex weighing 2.5 to 4.5 kg are sedated with ketamine hydrochloride (10–15 mg/kg i.m.) and anesthetized with pentobarbital sodium (30 mg/ kg i.v.). The animals are fixed in supine position and supplemental doses of anesthetic are administered to maintain a uniform level of anesthesia. The trachea is intubated and the animals breath room air enriched with 95 % O2/5 % CO2. Systemic arterial pressure is measured from a catheter inserted into the aorta from a femoral artery, and intravenous injections are made from a catheter positioned in the inferior vena cava from a femoral vein. For perfusion of the left lower lung lobe, a special designed 28-cm 6 F triple-lumen balloon perfusion catheter (Arrow International, Reading, PA) is passed under fluoroscopic guidance from the left external jugular vein into the artery to the left lower lobe. The animal is heparinized by 1000 IU/kg i.v., and the lobar artery is isolated by distension of the balloon cuff on the perfusion catheter. The lobe is then perfused by way of the catheter lumen beyond the balloon cuff, with blood withdrawn from a femoral artery with a perfusion pump. Lobar arterial pressure is measured from a second port 5 mm from the cuff on the perfusion catheter. The perfusion rate is adjusted so that lobar arterial perfusion pressure approximates mean pressure in the main pulmonary artery. Left atrial pressure is measured with a 6 F double-lumen catheter passed transseptally into the vein draining the left lower lobe. The catheter tip is positioned so that the left atrial pressure port on the distal lumen is 1–2 cm into the lobar vein and the second catheter port is near the venoatrial junction. Lobar arterial pressure can be elevated to an high steady state level by the administration of N ω -nitro-Larginine ω , followed by an intralobar infusion of the stable prostaglandin/endoperoxide analogue U-46619. EVALUATION Dose–response curves after administration of graded doses of drugs, e. g., decrease of lobar arterial pressure after various doses of bradykinin, are established. The effects of antagonists, e. g. HOE 140, can be studied. MODIFICATIONS OF THE METHOD Liu et al. (1992) used a blood-perfused rat lung preparation to study pulmonary vasoconstriction or endothelium-dependent relaxation. Byron et al. (1986) studied the deposition and airway-to-perfusate transfer of disodium fluorescein from 3–4 μm solid aerosols in an isolated perfused lung preparation of rats. Mor et al. (1990) determined angiotensin-converting enzyme activity in the isolated perfused guinea pig lung. Franks et al. (1990) used in Beagle dogs a single breath technique employing freon-22 as the soluble marker gas simultaneously with measurement of aortic blood flow by an electromagnetic flowmeter. Tanaka et al. (1992) measured lung water content in dogs with acute pulmonary hypertension induced by injection of glass beads. Drake et al. (1978) studied filtration characteristics of the exchange vessels in isolated dog lung by calculating the volume conductance with use of different components of the weight-gain curve following changes in capillary pressure. Heaton et al. (1995) studied the effects of human adrenomedullin on the pulmonary vascular bed of isolated, blood perfused rat lung. DeWitt et al. (1994), Lippton et al. (1994) investigated the effects of adrenomedullin in the pulmonary and systemic vascular bed of the cat. Nossaman et al. (1995) compared the effects of adrenomedullin, an adrenomedullin analog, and CGRP in the pulmonary vascular bed of the cat and the rat. A.8.2.7 Effect on Contractile Force of Ischemic Muscle ... PURPOSE AND RATIONALE Skeletal muscle is stimulated until it reaches its maximal force of contraction. This means that the muscle is forced to function at a level near exhaustion and has to use maximally the substrate supplied by the circulation. Then, the femoral artery is occluded, leading to underperfusion and a subsequent lack of substrate. As a consequence, the muscle’s force of contraction decreases rapidly. Measuring the change in contractile force caused by drug administration reveals a drug’s ability to restore ischemic muscle functions. In the following procedure, the drugs are tested for their effect on the force of contraction of the ischemic skeletal muscle. PROCEDURE Male Wistar rats weighing 400–450 g are anaesthetized by intraperitoneal administration of pentobarbital (Nembutal) (35 mg/kg). A tracheal tube is placed to assist the rat’s ventilation. The left carotid artery is cannulated for blood pressure recording and the left jugular vein is cannulated for the i.v. administration of test drugs. An incision is made to the skin of the right pelvic limb distal to the groin and the skeletal muscle is exposed down to the ankle. The skin is carefully trimmed away from the muscle to assure that contractions cannot be impaired by retraction of the skin. The major nerve supply is severed and a small length of the descending branch of the femoral artery is prepared free. The freely hanging muscle is attached to the force transducer (range 0–500 g, Z 6, Rhema, Germany) and a resting tension of 50 g is placed on the muscle. To prevent dehydration, the skin is left attached to the muscle and the muscle is kept moist by the continuous drip of a 0.9%NaClsolution. After these preparations, the rat is allowed to recover at least 30 min. Two needle electrodes are inserted into the muscle. Square impulses of 40 ms are generated with Stimulator 1 (Hugo Sachs Elektronik, Freiburg, Germany). The muscle is stimulated with a frequency of about 80 contractions per minute. The amplitude is increased gradually up to the muscle’s maximal contractile force (usually between 2.0 and 3 mA). Following stabilization, the femoral artery is occluded with a clip for 5 min and subsequently reopened. After at least 15 min, test drugs are administered by intravenous infusion (0.075 ml/min) for 10 min. Five minutes after starting drug infusion, the artery is clamped again (for 5 min) while drug infusion is still going on. The force of contraction is continuously recorded. After declamping the artery, the rat is allowed to recover for at least 30 min before the whole procedure is repeated with another test drug. In this way, 3 different compounds can be tested in the same animal. Standard compound: pentoxifylline EVALUATION The following parameters are measured: the percent inhibition of contractile force before drug administration (artery being clamped) the percent inhibition of contractile force after drug administration (artery being clamped) The percent increase in contractile force after drug administration is calculated. CRITICAL ASSESSMENT OF THE METHOD An attempt is made to measure not only the effects of the drug on vasculature tonus but also on muscle metabolism. MODIFICATIONS OF THE METHOD Weselcouch and Demusz (1990) studied drug effects in the ischemic hindlimbs of ferrets. The hindlimb was stimulated to contract isometrically via supramaximal electrical stimulation of the sciatic nerve. Ischemia was induced by partial occlusion of the abdominal aorta. Pentoxifylline attenuated the loss of function in a dose-related manner. Okyayuz-Baklouti et al. (1992) studied the functional, histomorphological and biochemical changes in atrophying skeletal muscle using a novel immobilization model in the rat. Le Tallec et al. (1996) reported the effects of dimethylformamide on in vivo fatigue and metabolism in rat skeletal muscle measured by 31P nuclear magnetic resonance spectroscopy. A.8.2.8 Effect on Perfusion of Rabbit Ear (Pissemski Method) ... PURPOSE AND RATIONALE The procedure was described as early as 1914 by Pissemski, based on experiments of Krawkow (1913) in fish gills. It can be used to elucidate vasoactive properties (both vasoconstrictive and vasodilating) of compounds. The isolated rabbit’s ear is used to determine the effect of test compounds on its perfusion rate. Administration of norfenephrine induces vasoconstriction leading to a decrease in perfusion rate. A compound with vasodilatory properties will inhibit the norfenephrine induced fall in perfusion rate whereas a vasoconstrictor will potentiate this effect. PROCEDURE A rabbit of either sex weighing 1.5-3 kg is sacrificed by CO2 narcosis and its ears are severed immediately. The ear is placed on a glass disc, the posterior auricular artery is exposed and cannulated. The cannula is connected to a tubing with a T-branch allowing the infusion of different solutions. Ringer’s solution, kept at room temperature, is infused under 40 cm water column pressure via the cannula. The perfusion flow volume is recorded using a time ordinate recorder and a CONDON tipper or a photoelectric drop counter. Prior to drug administration, the pH of the Ringer solution (containing test compound) must be determined. If the pH is greater than 8.5 or smaller than 6.5, it should be adjusted by adding a diluted NaOH- or HCl-solution. Testing for Vasodilatory (Norfenephrine Antagonistic) Activity Norfenephrine is infused at a concentration of 0.5 μg/ ml until the maximal contraction is reached. The test compound is prepared in Ringer’s solution at a concentration of 100 μg/ml. A volume of 30 ml is infused via the cannula over a 15 min period under constant pressure. The change of perfusion rate is determined. If there is a positive response (increase in perfusion rate), the test may be repeated using lower concentrations. If there is a negative response (further decrease in perfusion rate), the compound can be tested for vasoconstrictive activity. Testing for Vasoconstrictive Activity This test is repeated as described above without administration of norfenephrine. Standard compounds: as vasodilator – dihydralazine – theophylline – pentoxyfylline 100 μg/ml as vasoconstrictor – norfenephrine (Novadral) EVALUATION Testing for Vasodilatory Activity The perfusion rate of the ear vessel is determined during the course of the test: R = perfusion rate of vehicle perfused vessel RN = perfusion rate of norfenephrine constricted vessel RNP = perfusion rate of norfenephrine constricted vessel following compound administration The percent inhibition of norfenephrine induced decrease in perfusion pressure is calculated using the following formula: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \% \;{\rm inhibition} = \frac{{(RN - RNP)}}{{R - RN}} \times 100 $$\end{document} Testing for Vasoconstrictive Activity The normal perfusion rate (ear vessel perfused with Ringer’s solution) is taken as 100 %. The percent inhibition of perfusion rate following compound administration is determined. MODIFICATIONS OF THE METHOD Schlossmann (1927) used the isolated rabbit ear preparation according to Pissemski for determination of the adrenaline content in blood. De la Lande and Rand (1965), de la Lande et al. (1967) described a method of perfusing the isolated central artery of the rabbit ear. Small segments of the artery, taken from the base of the ear, were perfused at a constant rate with Krebs solution at 37 °C. To enable drugs to be applied either to the intima or the adventitia, the artery was double cannulated so that the intraluminal and extraluminal perfusion media did not mix. Constrictor responses were measured by the maximum rise in perfusion pressure. Steinsland et al. (1973) studied the inhibition of adrenergic transmission by parasympathicomimetics in the isolated central ear artery of the rabbit. Perfusion was performed at a constant flow rate with Krebs’ solution and perfusion pressure was recorded with a transducer. Allen et al. (1973) incubated isolated segments of rabbit ear artery with (3H)-(−)-noradrenaline and measured the amount of tritium released into the luminal perfusate and into the extraluminal superfusate. Budai et al. (1990) used isolated proximal 3–4-cm segments of the rabbit ear artery or rat tail artery in a low volume perfusion-superfusion system for measurement of transmitter release from blood vessels in vitro. Miyahara et al. (1993) used arterial rings rabbit ear arteries in vitro which were contracted by perivascular nerve stimulation, or 5 × 10-7 noradrenaline or high potassium (29.6 mM) solution. High doses of dexamethasone or clobetasol-17-propionate decreased the amplitude of contractions. Furthermore, the authors performed in vivo experiments in albino rabbits, whereby the fur was removed from the distal parts of the ear by applying a depilatory cream at least 24 h before the experiments. The apical regions of the ear were then stripped with adhesive tape 7 times to remove the keratinous epidermal layer. The rabbit was anesthetized and the experimental parts of the ear were placed under a high resolution magnifying camera and immobilized using bilayer adhesive tapes. The vascular reactions induced by topical application of corticosteroids were recorded chronically using videotapes. Aoki and Chiba (1993) described a method for separate intraluminal and extraluminal perfusion of the basilar artery in dogs. A polyethylene roof was designed to cover the canine basilary artery so that an extraluminal superfusion stream could pass over the artery that simultaneously received an intraluminal perfusion. A.8.2.9 Effect on Venous Tonus In Situ in Dogs ... PURPOSE AND RATIONALE Veins can be classified into two groups: those that respond and those that do not respond to epinephrine, acetylcholine and sympathetic nerve stimulation. As studies in dogs have shown (Rice et al. 1966) the reactive veins have a considerable amount of smooth muscle whereas the nonreactive ones lack any appreciable amount of smooth muscle fibres in the tunica media. A special preparation allows the registration of localized venous vasoconstriction. PROCEDURE Dogs weighing 20–30 kg are anesthetized with 35 mg/kg pentobarbital sodium i.v. The trachea is cannulated and the dog ventilated with a respiration pump. The femoral vein is cannulated for systemic injections. After administration of 5 mg/kg heparin sodium i.v., the saphenous vein and the femoral artery are cannulated. The venous cannula is placed approximately 1 cm distal to its junction with another vein. After the non-perfused branch of the junction is ligated, constant blood flow is maintained from the femoral artery by using a Sigmamotor pump. The flow is adjusted so that a normal physiologic pressure in the vein is maintained. Perfusion pressure is measured between the pump and the vein so that any changes in pressure reflect changes in venous resistance. The peak changes in perfusion pressure are used to measure pressure changes from recorded data. The blood flow is maintained on a constant level. Therefore, changes in pressure must reflect changes in resistance. Pressure is recorded with a polygraph using an Statham pressure transducer (P23AA). In addition to recording perfusion pressure, venous pressure is measured at two additional points along the vein. In order to record venous pressure centrally from the site of perfusion, the shaft of a 27-gauge needle is placed into the end of a 10 cm piece of a thin Silastic tubing. At the other end, a 27 gauge needle is inserted and attached to a Statham pressure transducer (P23B). Pressure is recorded on a polygraph. One needle is inserted into the vein just proximal of the junction of the two veins. The second needle is placed into the vein so that the distance between the tip of the perfusion cannula and the first needle is the same as the distance between the two needles. In this way pressure decreases across the junction and an adjacent segment can be measured simultaneously. Injections of test compounds are made into the cannula between the pump and the saphenous vein. Changes in pressure measured by the three transducers are recorded. As standard, doses of 0.1–1.0 μg norepinephrine are injected. EVALUATION Responses to test drugs are measured in mm Hg and calculated as percentage of response to norepinephrine. A.8.3 Arterial Aneurysms A.8.3.1 General Considerations Abdominal aortic aneurysms represent a life-threatening condition characterized by chronic inflammation, destructive remodeling of the extracellular matrix and segmental dilatation of the aortic wall (Dobrin 1989; Ernst 1993). Several authors described animal models of aneurysms (Carrell et al. 1999; Dobrin 1999; Daugherty and Cassis 2004). Most studies were performed in mice. Abdominal aortic aneurysms are evoked by genetically defined defects in extracellular matrix maturation, increased degradation of elastin and collagen, aberrant cholesterol homeostasis, or enhanced production of angiotensin peptides. The Blotchy mouse has an X-linked trait that leads to aortic aneurysms and subsequent fatal rupture in nearly all affected male mice (Brophy et al. 1988; Reilly et al. 1990). Maki et al. (2002) showed that inactivation of the lysyl oxidase gene Lox leads to aortic aneurysms, cardiovascular dysfunction, and perinatal death in mice. Aneurysm development has been noted in a number of mice with deficiencies in the components of the matrix metalloproteinase system (Silence et al. 2001, 2002). The use of mice in atherosclerosis research was escalated by the development of mice that are deficient in either apoE or LDL receptors susceptible to aneurysm development (Ishibashi et al. 1994; Prescott et al. 1999). Accelerated atherosclerosis, aortic aneurysms formation, and ischemic heart disease were found in apolipoprotein E and endothelial nitric oxide synthase double-knockout mice (Kuhlencordt et al. 2001). ACE inhibition reduces some symptoms of vascular pathology in apoE and eNOS compound-deficient mice (Knowles et al. 2000). Mice with deficiency of the LDL receptor-related protein (LRP) showed pathological changes in the aortic arch and abdominal aorta with substantial lengthening, dilatation, thickening and large aneurysms (Herz and Strickland 2001; Boucher et al. 2003). Salt-sensitive aortic aneurysms and rupture in hypertensive transgenic mice that overproduce angiotensin II were described by Nishijo et al. (1998). The infusion of elastase into the infrarenal segment has been used as model for abdominal aorta aneurysms in rats (Anidjar et al. 1990) and mice (Pyo et al. 2000). Lee et al. (2001) described abdominal aortic aneu rysms in mice lacking expression of inducible nitric oxide synthase. Periarterial application of calcium chloride was used to induce aneurysms of the rabbit common carotid artery (Gertz et al. 1988) and in the rabbit aorta (Freestone et al. 1997). This technique has been used in mice by Chiou et al. (2001) and Longo et al. (2002). ... MODIFICATIONS OF THE METHOD Nomoto et al. (2003) described the effects of two inhibitors of renin-angiotensin system on attenuation of postoperative remodeling after left ventricular aneurysm repair in rats. A.8.3.2 Angiotensin II-Induced Aortic Aneurysm in Mice ... PURPOSE AND RATIONALE Angiotensin II promotes atherosclerotic lesions and aneurysms in apolipoprotein E-deficient mice (Daugherty et al. 2000, 2001; Knowles et al. 2000; Wang et al. 2001; Manning et al. 2002, 2003; Deng et al. 2003; Martin-McNulty et al. 2003; Saraff et al. 2003). Wang et al. (2005) reported that a Rho-kinase inhibitor attenuated angiotensin II-induced abdominal aortic aneurysm in apolipoprotein E-deficient mice by inhibiting apoptosis and proteolysis. PROCEDURE Animal Preparation Osmotic minipumps (model 2004, Alzet) containing either PBS or Ang II (1.44 mg/kg per day) in PBS were implanted subcutaneously in 6-month-old apoE-KO male mice (Jackson Laboratories). Two days before saline and Ang II infusion, mice were provided with water (Ang IIgroup) or water containing test compound at a concentration of 0.5 mg/ml (low-dose group) or 1.0 mg/ml (high-dose group). Age-matched apoE-KO mice without any treatment were used as naïve controls. At the end of the 30-day treatment period, mice were euthanized, and the hearts were perfused with DEPC in saline. The arterial tree was rapidly dissected from fat and connective tissue and snap-frozen in liquid nitrogen. MORPHOLOGICAL EXAMINATION Quantification of Aneurysm Formation After the aorta was dissected free from the surrounding connective tissue, images were recorded with a digital camera and later used to measure the outer diameter of the suprarenal aorta at the midpoint between the diaphragm and right renal artery. A commonly used clinic standard to diagnose abdominal aortic aneurysm is an increase in aortic diameter of ≈ 50 % (Johnston et al. 1991). The average diameter of the normal suprarenal aorta in naïve control mice is 0.8 mm. A threshold of 1.22 mm was set as evidence of an incidence of aneurysm formation. Aneurysm severity was assessed with a scoring system described by Daugherty et al. (2001) : type 0, no aneurysm (the suprarenal region of the aorta was not obviously different from naïve apoE-KO mice without Ang II treatment); type I, a dilated lumen with no thrombus; type II, remodeled tissue often containing thrombus; type III, a pronounced bulbous form of type II containing thrombus; and type IV, multiple aneurysms containing thrombus. To analyze this measurement semiquantitatively, the numerical score assigned to the type of aneurysm for each animal in a group was averaged to generate a pathology score for statistical comparison. Quantification of Atherosclerotic LesionArea The left and right carotid arteries and the aortic arch were dissected, excised, opened longitudinally, and pinned down on wax-coated Petri dishes. Atherosclerotic lesions were visible without staining. Images of the open luminal surface of the vessels were captured with a digital camera (Sony) mounted on a dissecting microscope. The atherosclerotic lesion area was quantified by use of the C-Simple system (Compix) and expressed as a percentage of the total luminal surface area (Wang et al. 2000, 2001; Martin-McNulty et al. 2003). Histology and Immunohistochemical Staining Two representative suprarenal aortas from each group were fixed in formalin, embedded in paraffin, and cut into 5-μm-thick sections. The adjacent sections were stained with hematoxylin and eosin or by the immunohistochemical method. To identify macrophages in the aortic wall, a purified rat anti-mouse Mac- 3 monoclonal antibody (BD Pharmingen) was used for immunochemistry staining (PhenoPath Laboratories). To localize cells undergoing nuclear DNA fragmentation, in situ terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) was performed using an in situ apoptosis detection kit (Roche Biochemicals) (Song et al. 2000; Feng et al. 2002). Paraffin sections were deparaffinized and rehydrated. Sections were then washed with PBS and incubated with proteinase K (20 μg/ml) for 20 min. Endogenous peroxidase was inactivated with 3 % hydrogen peroxide in methanol at room temperature. TdT, which catalyzes a template-independent addition of deoxyribonucleotide to 3-OH ends of DNA, was used to incorporate digoxigenin-conjugated dUTP to the ends of DNA fragment in situ. The TUNEL signal was then detected with an anti-digoxigenin antibody conjugated with peroxidase and developed with diaminobenzidine as a chromogen. Sections were counterstained with hematoxylin, dehydrated, and cleared before coverslips were placed. Both positive and negative control slides were processed at the same time in each experiment. The presence of apoptotic cells was scored as nuclear staining, with a distinctive morphological appearance associated with cell shrinkage and chromatin condensation. EVALUATION Results are presented as mean ± SE for the number of animals used. Statistical comparison for the incidence of abdominal aortic aneurysms was performed by χ2 analysis. Multiple comparison of mean values was performed by ANOVA, followed by a subsequent Student-Newman-Keuls test for repeated measures. Differences were considered statistically significant at a value of P < 0.05. A.8.4 Angiogenesis and Anti-Angiogenesis A.8.4.1 General Considerations Regulation of new blood vessel formation, angiogenesis, is precisely programmed throughout the lifetime of vertebrates. Besides the role of angiogenesis in normal function, it is an essential component of disease processes, including tumor growth, rheumatoid arthritis, psoriasis, and diabetic retinopathy (Folkman and Klagsbrun 1987; Klagsbrun and D’Amore 1991; Folkman and Shing 1992). Multiple factors that stimulate angiogenesis either directly or indirectly have been described, including the fibroblast growth factor family (Esch et al. 1985), vascular endothelial growth factor (Leung et al. 1990; Thomas 1996; Ferrara and DavisSmyth 1997), epidermal growth factor (Gospadarowicz et al. 1979), transforming growth factor-α and -β (Schreiber et a 1986; Yang and Moses 1990), tumor necrosis factor-α (Leibovich et al. 1987), angiogenin (Fettetal. 1985), CYR61, a product of a growth factorinducible immediate early gene (Babic et al. 1998) ect. The pharmacological inhibition of angiogenesis is of considerable interest in the development of new therapeutic modalities for the treatment of diseases such as diabetic retinopathy, atherosclerosis, hemangiomas, rheumatoid arthritis and cancer, in which pathological angiogenesis occurs (Ezekowitz et al. 1992; Folkman and Shing 1992; Fan and Brem 1992; O’Brien et al. 1994). Several natural inhibitors of angiogenesis were described, such as thrombospondin (Good et al. 1990), somatostatin (Barrie et al. (1993), angiostatin, isolated from a subclone of Lewis lung carcinoma, (O’Reilly et al. 1994, 1996), endostatin, a 20 kDa angiogenesis inhibitor from a murine hemangioendothelioma which is a C-terminal fragment of collagen XVIII (O’Reilly et al. 1997; Dhanabal et al. 1999), vasostatin (Pike et al. 1998). Angiogenesis was studied ex vivo by culturing rat or mouse aortic rings in collagen gel (Zhu et al. 2003). Unlike rat aorta explants, unstimulated mouse aortic rings were unable to spontaneously produce an angiogenic response under serum-free conditions. They, however, responded to basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF), generating networks of branching neovessels. Couffinhal et al. (1998) published a mouse model of angiogenesis. The femoral artery of one hind-limb was ligated and excised. Laser Doppler perfusion imaging was employed to document the consequent reduction in hind-limb blood-flow, which typically persisted for up to 7 days. Neovascularization was shown to develop in association with augmented expression of VEGF mRNA and protein from skeletal myocytes as well as endothelial cells from the ischemic hind-limb. A.8.4.2 Endothelial Cell Proliferation ... PURPOSE AND RATIONALE Human umbilical vein endothelial cells (HUVEC) were used by various authors to study endothelial cell proliferation (Bussolino et al. 1992; Benelli et al. 1995; Danesi et al. 1997; Hu 1998; Iurlaro et al. 1998; Vacca et al. 1999; Xin et al. 1999). PROCEDURE The HUV-EC-C human endothelial cells (American Type Culture Collection, Rockville, MD) are cultured at 37 °C and 5%CO2 in 90 % Ham’s F12K, 10%fetal bovine serum, 30 μg/ml endothelial cell growth factor, 100 μg/ml heparin, and 4 mM L-glutamine. The effect of test compound on HUV-EC-C cell proliferation is evaluated on 3 × 103 cells/well in 24-well plates. After 24 h, the test compound in various concentrations of the vehicle are added, and plates are incubated for 72 h. Cells are then harvested with trypsin/EDTA and counted by an hemocytometer. EVALUATION Results are expressed as number of cells in vehicle and compound-treated cultures and are the mean of three separate experiments ± SE. MODIFICATIONS OF THE METHOD In addition to human umbilical veil endothelial cells, Pike et al. (1998) used fetal bovine heart endothelial cells and measured DNA synthesis by [3H]thymidine deoxyribose uptake. Oikawa et al. (1991) used vascular cells from bovine carotid arteries and tested cell proliferation in a collagen gel and cell migration in a Boyden chamber. Bovine capillary endothelial cells were used by Folkman et al. (1979), Clapp et al. (1993), O'Reilly et al. (1997), Cao et al. (1999). A.8.4.3 Chorioallantoic Membrane Assay ... PURPOSE AND RATIONALE The chick chorioallantoic membrane assay, originally described by Auerbach et al. (1974), has been used with some modifications by several authors to test angiogenesis and inhibition of angiogenesis, e. g., by Taylor and Folkman (1982), Crum et al. (1985), Vu et al. (1985), McNatt et al. (1992, 1999), Barrie et al. (1993), Clapp et al. (1993), Gagliardi and Collins (1993), Benelli et al. (1995), Ribatti et al. (1995), Klauber et al. (1996), Oikawa and Shimamura (1996), Danesi et al. (1997), O’Reilly et al. (1997), Iurlaro et al. (1998), Cao et al. (1999), Vacca et al. (1999). PROCEDURE Fertilized White Leghorn chicken eggs are incubated at 37 °C at constant humidity. On incubation day 3, a square window is opened in the shell and 2 to 3 ml of albumen is removed to allow detachment of the developing chorioallantoic membrane (CAM). The window is sealed with a glass and the eggs are returned to the incubator. On day 8, 1 mm3 gelatin sponges loaded with 3 μl phosphate-buffered saline alone as the negative control or containing 3 μg (1 mg/ml) of the angiogenic recombinant basic fibroblast growth factor alone as positive control, or together with various doses of test compound, are implanted on top of the CAM. The sponge traps the sample and allows slow release of the product. CAM are examined daily until day 12, when the angiogenic response peaks. On day 12, blood vessels entering the sponge within the focal plane of the CAM are recognized microscopically, counted by two observers in a double-blind fashion under a Zeiss SR stereomicroscope, and photographed in ovo with the MC63 Camera system (Zeiss, Oberkochen, Germany). To better highlight vessels, the CAM are injected into a large allantoic vein with India ink solution, fixed in Serra’s fluid, dehydrated in graded ethanols, and rendered transparent in methylbenzoate. On day 12, after microscopic counting, the embryos and their membranes are fixed in ovo in Bouin’s fluid. The sponges and the underlying and immediately adjacent CAM portions are removed, embedded in paraffin, sectioned at 8 pm along a plane parallel to the CAM surface, and stained with a 0.5 % aqueous solution of toluidine blue. EVALUATION Angiogenesis is measured by a planimetric point count method (Ribatti et al. 1999): four to six 250 × magnification fields covering almost the whole of every third section within 30 serial slides of each sponge per sample are analyzed within a superimposed 144 intersection point square reticulum of 0.125 mm2. Only transversely sectioned microvessels, ie, capillaries and venules with or without a 3 to 10 μm lumen occupying the intersection points, are counted and calculated as the mean ±1 SD per section, per CAM, and groups of CAM. Statistical significance of differences is calculated by comparing the data from each experiment to their controls using Student’s t-test. MODIFICATIONS OF THE METHOD Oh et al. (1997) studied the lymphatics of differentiated avian chorioallantoic membrane using microinjection of Mercox resin, semi- and ultrathin sectioning, immunohistochemical detection of fibronectin and α-smooth muscle actin, and in situ hybridization with vascular endothelial growth factor VEGFR-2 and VEGFR-3 probes. Using the chick chorioallantoic membrane assay, Giannopoulou et al. (2003) showed that amifostine, an inorganic thiophosphate-cytoprotective agent, inhibits angiogenesis in vivo. A.8.4.4 Cornea Neovascularization ... PURPOSE AND RATIONALE Neovascularization of the rabbit cornea has been used by several authors to study inhibition of angiogenesis (Gimbrone et al. 1974;Crum et al. 1985;BenEzra et al. 1987, 1997; Klauber et al. 1996; McNatt et al. 1999; Joussen et al. 1999). PROCEDURE New Zealand White rabbits are anesthetized for surgery and quantification of newly developed blood vessels with 5 mg/kg xylazine hydrochloride and 35 mg/kg ketamine hydrochloride i.m. Corneal blood vessels are induced by basic fibroblast growth factor which is applied in carrier pellets. These pellets are produced by dispersing 50 μl of 2 % methylcellulose containing 500 ng human recombinant basic fibroblast growth factor diluted in 10 μl phosphate-buffered saline in plastic rods with a diameter of 4 mm. Dried pellets are folded twice and implanted intrastromally in the 12 o’clock position into a corneal tunnel. This tunnel is created by a central cut of approximately 50 % depth and extended into the peripheral cornea to a point 2.0 mm away from the limbus. Following implantation, the central entrance of the tunnel is closed with a single 10–0 nylon suture in order to ensure that the tear film does not dissolve the pellet and uncontrolled liberation of the growth factor is prevented. The test substance is dissolved in a viscous gel containing 0.002 % polyacrylic acid, 0.04 % sorbitol, and 0.001 % cetrimide in a watery base. The eyes are treated once daily with 0.1 ml of this gel which is applied in the lower conjunctiva sac. The eyes are closed for several seconds to avoid loss of the substance. Each animal’s contralateral eye receives gel without test substance and serves as control. Control animals receive the viscous gel without test substance. Animals are observed daily under an operating microscope, and vascular growth is documented on days 6, 9, 12, and 16 after surgery. The number of blood vessels, their length and the dimension of the vascularized area are quantified with a caliper under the operating microscope as well as on standardized photographs. On every observation day corneas are stained with fluorescein in order to show epithelial irregularities due to the topical treatment. EVALUATION Differences between treated eyes and controls are tested for significance using unpaired Student’s t-test. MODIFICATIONS OF THE METHOD Damms et al. (1997) characterized the neovascularization that follows the intracorneal injection of bovine albumin in rabbits as a model of angiogenesis. New Zealand white rabbits received intracorneal injections of phosphate buffered saline with and without various amounts of bovine albumin. The rabbits were co-sensitized or pre-sensitized by intramuscular bovine albumin. The corneal response was quantified by ranking photographs taken periodically after the injection. Babic et al. (1998) tested an angiogenesis promotor in the corneal pocket angiogenesis assay in rats. Xin et al. (1999) studied inhibitors of angiogenesis in the corneal angiogenesis assay in rats. A 1.5 mm incision was made approximately 1 mm from the center of the cornea in anesthetized Sprague Dawley rats. Using a curved spatula, the incision was bluntly dissected through the stroma toward the outer canthus of the eye. A hydron pellet (2 × 20 mm) containing 200 ng vascular endothelial growth factor and 100 ng sucralfrate was inserted into the base of the pocket. Foschi et al. (1994), Benelli et al. (1995), Danesi et al. (1997) studied neovascularization of rat cornea induced by chemical injury. Both eyes of ether-anesthetized rats were cauterized by applying a AgNO3/ KNO3 (1:1, w/w) applicator to the surface of the cornea eccentrically at a point approximately 2 mm from the corneoscleral limbus. Rats were treated 4 times daily for 6 days with eye drops. The eyes were examined by slit-lamp microscopy daily for 6 days to the evaluate the growth of the vessels. On the 6th day after cauterization, the rats were anesthetized and the upper body perfused through a cannula inserted in the ascending aorta with Ringer’s solution until the normal pink color of the fundi disappeared and then with a mixture of 10 % India ink/6%gelatin in Ringer’s solution. The eyes were enucleated and placed in 4 % formaldehyde. The cornea and a 1 mm rim of adjacent scleral tissue were dissected from the rest of the globe and three full thickness peripheral radial cuts were made to allow flattening of the cornea. The corneas were then placed on a glass slide in mounting media, magnified, and photographed. The area occupied by blood vessels was calculated and the area vascularization of drug treated animals was compared to that of control rats. Kenyon et al. (1996), Cao et al. (1999) performed the corneal micropocket assay in mice. A.8.4.5 Rat Subcutaneous Air Sac Model ... PURPOSE AND RATIONALE Lichtenberg et al. (1997, 1999) recommended the subcutaneous air sac model in rats as a simple method for in vivo screening of antiangiogenesis. Subcutaneous injection of air in the rat results in the formation of an air pouch. If air pouches are kept inflated by repeated injections of air the develop a structure of synovial lining (Edwards et al. 1981). The subcutaneous air pouch appears more like a bursal cavity than a synovial joint (Kowanko et al. 1986) and after 8–10 days the cells of the air sac appear as a transparent membrane on which the formation of new vessels can be studied. PROCEDURE Under anesthesia 10–15 ml of air is introduced dorsally to female Sprague Dawley rats weighing 150–180 g by subcutaneous injections using a 25 gauge needle to produce an air sac located approximately 4–5 cm behind the head of the animal. The air sacs are re-inflated every forth day. The wall of the air sac becomes progressively thicker with time and after approximately 10 days a sufficient lining of cells has been established. For sponge implantation, the animals are anesthetized again. A 1.5 cm incision is made through the clipped skin covering the air sac and blunt dissection is used to open a 2 cm deep cavity towards the cranial base of the air sac by careful separation of the skin from the membrane. A cellulose implant (Spontex sponge) with a diameter of 8 mm is carefully pressed into the cavity of themembrane away from the incision site and the incision closed by sutures. The animals are treated for 10 days with various doses of test compound in a volume of 10 ml/kg or vehicle. The subcutaneous injection is made under light CO2/O2 anesthesia into the hind leg 5–7 cm away from the air sac. This injection site is chosen to eliminate any risk of inducing irritative side-effects on the membrane. After 10 days treatment, the animals are sacrificed after having received 20 min before an injection of 1 |Ci of 125I-labelled immunoglobulin via the tail vein. The overlying skin of the air sac is removed to expose the transparent membrane. The extent of vascular proliferation is scored in situ: 1+: slight background vascularization; 2+: few new vessels reach the sponge; 3+: many new vessels reach and penetrate the implant; 4+: very intense formation of new vessels which reach and penetrate the implant. Following in situ scoring, the implant and the membrane from each animal are placed in the same plastic vial containing 10 % formalin and the radioactivity is measured in a γ -counter. The implants are examined microscopically after staining with haematoxylin and eosin. EVALUATION The extent of vascular proliferation scored in situ is compared between vehicle and treated animals by the Wilcoxon test. The angiogenic response measured by 125I-activity in cpm is subjected to analysis of variance followed by Dunnett’s t-test to compare each dose with the vehicle. The cpm’s are log-transformed to obtain variance homogeneity. The correlation between in situ scores and cpm is estimated by Spearman’s rank correlation coefficient after ranking cpm values. MODIFICATIONS OF THE METHOD In a further study, Lichtenberg et al. (1999) inoculated vascular endothelial growth factor producing tumor cells subcutaneously directly on the membrane, and the formation of vessels was measured 8 days later. Furthermore, slow-release pellets containing angiogenic factors, basic fibroblast growth factor or vascular endothelial growth factor, were implanted on the subcutaneous membrane. Nakamura et al. (1999) studied suppression of angiogenesis induced by S-180 mouse tumor cells in the dorsal air sac assay in mice. Funahashi et al. (1999) developed a mouse dorsal air sac model for quantifying in vivo tumor-induced angiogenesis which is determined by measuring the blood volume in an area of skin held in contact with a tumor cell-containing chamber, using 51Cr-labeled red blood cells. Schreiber et al. (1986) described the hamster cheek pouch assay for testing angiogenic/antiangiogenic activity. A.8.4.6 Mesenteric Window Angiogenesis Model ... PURPOSE AND RATIONALE Norrby et al. (1986, 1990, 1995) described the mesenteric window assay in rats for quantitative measurement of induction and inhibition of angiogenesis. The tissue being used is the membranous, ‘window’-like parts of the mesentery which is normally vascularized and appears to lack significant physiologic angiogenesis. Since the mesenteric window natively measures only 5–10 μm in thickness, the vasculature is virtually two-dimensional. Due to the structural and metabolic simplicity of the test tissue, the mesenteric window microvasculature is regarded as an ideal test system for establishing the functional influences of defined factors (Zweifach 1973). PROCEDURE Angiogenesis is induced by i.p. injection of the mastcell secretagogue compound 48/80 twice daily for 4.5 days to male Sprague Dawley rats weighing about 225 g. Test compounds or saline are injected s.c. 1 h before each injection of compound 48/80. Angiogenesis is quantified by microscopically counting the number of vessel profiles per unit length of the mesenteric window in 4 microtome sections per specimen, cut perpendicularly to the surface, from the central part of the window. This reflects the degree of branching, the degree of tortuosity and the degree of spatial expansion of the vasculature. Four specimens per animal are analyzed. Four mesenteric window specimens are spread, fixed on objective slides and stained with toluidine blue to measure the relative vascularized area. Three randomly selected vascular view fields per mesentericwindow spread are analyzed for microvascular length per unit area of vascularized tissue. The total microvascular length is computed from the vascularized area of each animal multiplied by the mean microvascular length for the corresponding treatment group. EVALUATION The non-parametric two-tailed Mann-Whitney U rank sum test for unpaired observations is used for statistical analysis. A.8.4.7 Quantification of Vascular Endothelial Growth Factor-C ... PURPOSE AND RATIONALE Vascular endothelial growth factor (VEGF) has achieved considerable therapeutic interest (Clauss 1998; Enholm et al. 1998; Ferrara et al. 2004). Weich et al. (2004) described an ELISA for quantification of vascular endothelial growth factor-C. PROCEDURE Materials and Methods The fully processed rat protein dNdC-VEGF-C and dNdC-VEGF-D were produced in insect cells and purified from supernatants (Kirkin et al. 2001). Human dNdC-VEGF-C and soluble VEGFR-3 production was achieved according to (Joukov et al. 1997; Hornig et al. 1999). A polyclonal antibody against rat VEGF-C was developed in rabbits (antibody 4080; BioGenes Berlin). A total amount of 1.2 mg rat VEGF-C (containing a C-terminal 6His-tag) was used for immunization of two New Zealand white rabbits. After immunization with 0.1 mg protein, each rabbit was boosted on days 7, 14, 28, 56 and 84 with the same amount. The dilution of the serum for half-maximal titer was 1:10,000. Total IgG from rabbit serum was isolated using HiTrap Protein A Sepharose columns (Amersham Bioscience, Freiburg). Generations of Cell Lines, Serum-Free Cell Culture Supernatants, Lysates and Tissue Sample Preparation Experiments were conducted using three human (PC-3 cells, 293 cells, COLO 800 cells) and four rat (10AS, ARIP, BRL3A, MT-450) tumour cell lines and 1640 medium (Gibco-BRL, Bethesda, Md., USA). Stable transfected clones were selected and tested for VEGF- C expression and secretion using a polyclonal anti- VEGF-C antiserum. The cells were grown to 80 % confluence in 75- cm2 tissue culture flasks (Nunc, Roskilde, Denmark). Conditioned media was collected under low-serum (2 %) growth conditions. Tumor tissues were snapfrozen in liquid nitrogen and homogenized in RIPA buffer (0.1 % SDS, 1 % IGEPAL CA-630, 0.5 % Na-deoxycholate, protease-inhibitor cocktail in phosphatebuffered saline). VEGF-C Sandwich-ELISA The VEGF-C antibody 4080 was isolated from serum using HiTrap Protein-A Sepharose columns. Then, depletion of the anti-his antibody fraction was done by antigen-affinity purification using 10 mg of immobilized 6H-tagged TxnTb protein [Tryparedoxin (Txn) from Trypanosoma brucei (Tb)]. Antigen-affinity purification for the antibody 4080 was performed by immobilizing 1 mg rat VEGF-C on an NHS-activated Hi- Trap column (Amersham Bioscience, Freiburg). The development of a highly sensitive and specific sandwich ELISA for VEGF-C was done using standard methods. Rabbit IgG 4080 (10 μg/ml) was used for coating and the antigen-affinity purified and biotinylated antibody 4080 at 1 μg/ml was used as a detector antibody. Biotinylation of antibody 4080 was done with 6 mg IgG in 100 mM carbonate buffer, pH 8.5 at 3 mg/ml with using biotin-amidohexanoic acid NHS (Sigma, St. Louis, Mo., USA). The molecular ratio biotin:protein was 30:1. As a standard, human and rat dNdC-VEGF-C was used over a concentration range between 0.1 and 6.25 ng/ml. For visualization of the detector, streptavidin-enzyme conjugate was used (Endogen, Woburn, Mass., USA) followed by the addition of TMB (tetra-methyl-benzidine; Roche Mannheim, Germany). EVALUATION After stopping the reaction with 1 M H2SO4, the absorbance was measured at 450 and 620 nm with an ELISA plate reader (Labsystems, Finland). Generally, the samples were analyzed in different dilutions, measuring each dilution in duplicate. Samples were diluted at least 1:2 with sample diluent (BenderMedSystems, Vienna). MODIFICATIONS OF THE METHOD Rissanen et al. (2003) found that VEGF-D is the strongest angiogenesis and lymphangiogenetic factor among VEGFs delivered into skeletal muscle via adenoviruses. A.8.4.8 Inhibitors of Vascular Endothelial Growth Factor ... PURPOSE AND RATIONALE Inhibitors of vascular endothelial growth factor have gained therapeutic interest (Whittles et al. 2002; Gingrich et al. 2003; Hamma-Kourbali et al. 2003; Verheul and Pinedo 2003; Fernandez et al. 2004; Roberts et al. 2004; Baka et al. 2006). In particular, VEGF Trap, a soluble decoy receptor comprising portions of VEGF receptors 1 and 2, has been studied (Wulff et al. 2001; Holash et al. 2002; Kim et al. 2002; Hood and Cheresh 2003; Saishin et al. 2003; Fukasawa and Korc 2004; Fraser et al. 2005; Hu et al. 2005; Lau et al. 2005). Byrne et al. (2003) found that vascular endothelial growth factor-Trap decreases tumor burden, inhibits ascites, and causes dramatic vascular remodeling in an ovarian cancer model. PROCEDURE Cell Lines Ascites fluid from athymic mice previously inoculated with OVCAR-3 cells was used. Cells from the SKOV- 3 human cystadenocarcinoma cell line were grown in McCoy’s 5a medium with 1.5 mM L-glutamine, penicillin, and streptomycin, supplemented with 10 % FCS. Cells were grown to confluence and harvested by trypsinization with 0.25 mg/ml trypsin/EDTA and suspended in PBS before inoculation into mice. Animals Athymic Balb c nu/nu mice were housed under pathogen-free conditions and fed autoclaved pellets and water. Retroviral Constructs The pLZR Phoenix vector was modified by the addition of a MCS followed by an internal ribosome entry sequence-GFP cassette (Rommel et al. 1999). Thus, genes subcloned into the MCS produce bicistronic constructs under the control of the viral 5′ long terminal repeat. The entire coding sequence of mVEGF164 was inserted into the MCS for the construct used to transduce cells with VEGF, whereas the MCS was left empty for the GFP-only vector. Constructs were transfected into Amphotrophic packaging lines to produced infective virus using standard techniques (Grignani et al. 1998). SKOV-3 MODEL SKOV-3 cell lines were infected with Amphotrophic viruses encoding either mVEGF164 and GFP or GFP only. Cells that were successfully transduced with the retroviruses were collected by FACS using a Cytomation MoFlo (Fort Collins, Colo., USA) with fluorescence emission from GFP measured with a 530/540 nm bandpass filter. More than 50 % of the cells were GFP positive after infection, allowing > 4.0 × 105 cells to be collected and used to establish cell lines. To verify viral transduction, cells were resorted several days later and found to be > 80 % positive for GFP expression. Cells were then expanded, aliquoted, and frozen. All experiments were performed with an aliquot expanded by four to five passages and tested for viability before injection. In Vivo Adenoviral and SKOV-3 Studies Adenoviral constructs were achieved according to Thurston et al. (2000). Adenoviral plaque-forming units (5.0 × 108) or 1.0 × 107 SKOV-3 cells were suspended in a volume of 300–400 μl of PBS or serumfree cell culture medium and injected i.p. into female nude mice. VEGF-Trap or control buffer was delivered twice weekly at 25 mg/kg via s.c. injection in a volume of 50–200 μl. Mice were assessed daily for general health and development of ascites and weighed at least twice weekly. Animals were sacrificed if they had lost > 10 % of body weight or had persistent ascites on three consecutive assessments. After sacrifice, ascites was removed with a sterile thin caliber plastic transfer pipette and quantified, and hematocrit was measured. OVCAR-3 MODEL OVCAR-3 cells obtained from ascites fluid were prepared (Hu et al. 2002). Briefly, 2 × 106 cells in 500 μl of RPMI 1640 were injected i.p. into athymic Balb/C nude (nu/nu) mice. Fourteen days after inoculation, blinded administration of VEGF-Trap or human Fc as control was initiated at a dose of 25 mg/kg. Injections were given s.c. in the nape of the neck using a 28.5- gauge needle and a 0.5-ml insulin syringe. Injections (0.05 ml) were administered twice weekly throughout the experimental period. Body weight and abdominal circumference were quantified twice weekly. In addition, animals were monitored daily for evidence of advanced disease (listlessness, extensive swelling of the abdominal cavity). At the end of the experiment, all remaining mice underwent euthanasia with CO2 followed by cervical dislocation. The volume of ascites was measured, and tumors were excised and weighed. Immediately before sacrifice, mice received i.v. injection with FITC lycopersicon lectin (see below). Tumor Vasculature According to Holash et al. (2002) s.c. tumors were es- tablished. After small s.c. tumors became palpable (1 week after implantation), treatment with the VEGF- Trap was initiated. VEGF-Trap or an equivalent volume of vehicle was delivered twice weekly s.c. at the nape of the neck. Tumor vasculature was visualized by using antibodies to platelet-endothelial cell adhesion molecule for immunohistochemistry. VEGF-Trap-treated OVCAR-3 tumor-bearing mice and control, untreated tumor-bearing mice were anesthetized by i.m. injection with ketamine (87 mg/kg) and xylazine (13 mg/kg), followed by i.v. injection with 100 μl of FITC lycopersicon lectin or 100 μg of Cy3 albumin (Jackson Immunology Research, West Grove, Pa., USA). Then 10 min later, mice were perfused through the ascending aorta with 4 % paraformaldehyde in PBS for 2 min. Tumors and control organs were extracted and placed in fixative for 1–2 h followed by immersion in 30 % sucrose/PBS overnight, embedded in OCT, cryostat sectioned, and viewed by fluorescence microscopy.