Evaluation of ELISA-Based Multiplex Peptides for the Detection of Human Serum Antibodies Induced by Zika Virus Infection across Various Countries

There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

Abstract

Zika virus (ZIKV) is a mosquito-borne Flavivirus with a positive-sense RNA genome, which are generally transmitted through the bite of an infected Aedes mosquito. ZIKV infections could be associated with neurological sequelae that, and otherwise produces similar clinical symptoms as other co-circulating pathogens. Past infection with one member of the Flavivirus genus often induces cross-reactive antibodies against other flaviruses. These attributes complicate the ability to differentially diagnose ZIKV infection from other endemic mosquito-borne viruses, making it both a public health issue as well as a diagnostic challenge. We report the results from serological analyses using arbovirus-specific peptides on 339 samples that were previously collected from 6 countries. Overall, we found that our multiplexed peptide-based ELISA was highly efficient for identifying ZIKV antibodies as early as 2 weeks post infection, and that it correlates with microneutralization, plaque reduction neutralization tests (PRNTs) and commercial tests for ZIKV in previously characterized samples. We observed that seropositivity varied by patient cohort, reflecting the sampling period in relation to the 2015–2016 ZIKV outbreak. This work evaluates the accuracy, specificity, and sensitivity of our peptide-based ELISA method for detecting ZIKV antibodies from geographically diverse regions. These findings can contribute to ongoing serological methods development and can be adapted for use in future studies.

Related collections

Most cited references 38

Record: found
Abstract: found
Article: not found

Zika virus outbreak on Yap Island, Federated States of Micronesia.

Mark Duffy, Tai-Ho Chen, W. Thane Hancock … (2009)

In 2007, physicians on Yap Island reported an outbreak of illness characterized by rash, conjunctivitis, and arthralgia. Although serum from some patients had IgM antibody against dengue virus, the illness seemed clinically distinct from previously detected dengue. Subsequent testing with the use of consensus primers detected Zika virus RNA in the serum of the patients but no dengue virus or other arboviral RNA. No previous outbreaks and only 14 cases of Zika virus disease have been previously documented. We obtained serum samples from patients and interviewed patients for information on clinical signs and symptoms. Zika virus disease was confirmed by a finding of Zika virus RNA or a specific neutralizing antibody response to Zika virus in the serum. Patients with IgM antibody against Zika virus who had a potentially cross-reactive neutralizing-antibody response were classified as having probable Zika virus disease. We conducted a household survey to estimate the proportion of Yap residents with IgM antibody against Zika virus and to identify possible mosquito vectors of Zika virus. We identified 49 confirmed and 59 probable cases of Zika virus disease. The patients resided in 9 of the 10 municipalities on Yap. Rash, fever, arthralgia, and conjunctivitis were common symptoms. No hospitalizations, hemorrhagic manifestations, or deaths due to Zika virus were reported. We estimated that 73% (95% confidence interval, 68 to 77) of Yap residents 3 years of age or older had been recently infected with Zika virus. Aedes hensilli was the predominant mosquito species identified. This outbreak of Zika virus illness in Micronesia represents transmission of Zika virus outside Africa and Asia. Although most patients had mild illness, clinicians and public health officials should be aware of the risk of further expansion of Zika virus transmission. 2009 Massachusetts Medical Society

0 comments Cited 355 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: found

Is Open Access

Zika Virus Outside Africa

Edward B. Hayes (2009)

In April 2007, an outbreak of illness characterized by rash, arthralgia, and conjunctivitis was reported on Yap Island in the Federated States of Micronesia. Serum samples from patients in the acute phase of illness contained RNA of Zika virus (ZIKV), a flavivirus in the same family as yellow fever, dengue, West Nile, and Japanese encephalitis viruses. These findings show that ZIKV has spread outside its usual geographic range ( 1 , 2 ). Sixty years earlier, on April 18, 1947, fever developed in a rhesus monkey that had been placed in a cage on a tree platform in the Zika Forest of Uganda ( 3 ). The monkey, Rhesus 766, was a sentinel animal in the Rockefeller Foundation’s program for research on jungle yellow fever. Two days later, Rhesus 766, still febrile, was brought to the Foundation’s laboratory at Entebbe and its serum was inoculated into mice. After 10 days all mice that were inoculated intracerebrally were sick, and a filterable transmissible agent, later named Zika virus, was isolated from the mouse brains. In early 1948, ZIKV was also isolated from Aedes africanus mosquitoes trapped in the same forest ( 4 ). Serologic studies indicated that humans could also be infected ( 5 ). Transmission of ZIKV by artificially fed Ae. aegypti mosquitoes to mice and a monkey in a laboratory was reported in 1956 ( 6 ). ZIKV was isolated from humans in Nigeria during studies conducted in 1968 and during 1971–1975; in 1 study, 40% of the persons tested had neutralizing antibody to ZIKV ( 7 – 9 ). Human isolates were obtained from febrile children 10 months, 2 years (2 cases), and 3 years of age, all without other clinical details described, and from a 10 year-old boy with fever, headache, and body pains ( 7 , 8 ). From 1951 through 1981, serologic evidence of human ZIKV infection was reported from other African countries such as Uganda, Tanzania, Egypt, Central African Republic, Sierra Leone ( 10 ), and Gabon, and in parts of Asia including India, Malaysia, the Philippines, Thailand, Vietnam, and Indonesia ( 10 – 14 ). In additional investigations, the virus was isolated from Ae. aegypti mosquitoes in Malaysia, a human in Senegal, and mosquitoes in Côte d’Ivoire ( 15 – 17 ). In 1981 Olson et al. reported 7 people with serologic evidence of ZIKV illness in Indonesia ( 11 ). A subsequent serologic study indicated that 9/71 (13%) human volunteers in Lombok, Indonesia, had neutralizing antibody to ZIKV ( 18 ). The outbreak on Yap Island in 2007 shows that ZIKV illness has been detected outside of Africa and Asia (Figure 1). Figure 1 Approximate known distribution of Zika virus, 1947–2007. Red circle represents Yap Island. Yellow indicates human serologic evidence; red indicates virus isolated from humans; green represents mosquito isolates. Dynamics of Transmission ZIKV has been isolated from Ae. africanus, Ae. apicoargenteus, Ae. luteocephalus, Ae. aegypti, Ae vitattus, and Ae. furcifer mosquitoes ( 9 , 15 , 17 , 19 ). Ae. hensilii was the predominant mosquito species present on Yap during the ZIKV disease outbreak in 2007, but investigators were unable to detect ZIKV in any mosquitoes on the island during the outbreak ( 2 ). Dick noted that Ae. africanus mosquitoes, which were abundant and infected with ZIKV in the Zika Forest, were not likely to enter monkey cages such as the one containing Rhesus 766 ( 5 ) raising the doubt that the monkey might have acquired ZIKV from some other mosquito species or through some other mechanism. During the studies of yellow fever in the Zika Forest, investigators had to begin tethering monkeys in trees because caged monkeys did not acquire yellow fever virus when the virus was present in mosquitoes ( 5 ). Thus, despite finding ZIKV in Ae. Africanus mosquitoes, Dick was not sure whether or not these mosquitoes were actually the vector for enzootic ZIKV transmission to monkeys. Boorman and Porterfield subsequently demonstrated transmission of ZIKV to mice and monkeys by Ae. aegypti in a laboratory ( 6 ). Virus content in the mosquitoes was high on the day of artificial feeding, dropped to undetectable levels through day 10 after feeding, had increased by day 15, and remained high from days 20 through 60 ( 6 ). Their study suggests that the extrinsic incubation period for ZIKV in mosquitoes is ≈10 days. The authors cautioned that their results did not conclusively demonstrate that Ae. aegypti mosquitoes could transmit ZIKV at lower levels of viremia than what might occur among host animals in natural settings. Nevertheless, their results, along with the viral isolations from wild mosquitoes and monkeys and the phylogenetic proximity of ZIKV to other mosquito-borne flaviviruses, make it reasonable to conclude that ZIKV is transmitted through mosquito bites. There is to date no solid evidence of nonprimate reservoirs of ZIKV, but 1 study did find antibody to ZIKV in rodents ( 20 ). Further laboratory, field, and epidemiologic studies would be useful to better define vector competence for ZIKV, to determine if there are any other arthropod vectors or reservoir hosts, and to evaluate the possibility of congenital infection or transmission through blood transfusion. Virology and Pathogenesis ZIKV is an RNA virus containing 10,794 nucleotides encoding 3,419 amino acids. It is closely related to Spondweni virus; the 2 viruses are the only members of their clade within the mosquito-borne cluster of flaviviruses (Figure 2) ( 1 , 21 , 22 ). The next nearest relatives include Ilheus, Rocio, and St. Louis encephalitis viruses; yellow fever virus is the prototype of the family, which also includes dengue, Japanese encephalitis, and West Nile viruses ( 1 , 21 ). Studies in the Zika Forest suggested that ZIKV infection blunted the viremia caused by yellow fever virus in monkeys but did not block transmission of yellow fever virus ( 19 , 23 ). Figure 2 Phylogenetic relationship of Zika virus to other flaviviruses based on nucleic acid sequence of nonstructural viral protein 5, with permission from Dr Robert Lanciotti ( 1 ). Enc, encephalitis; ME, meningoencephalitis. Information regarding pathogenesis of ZIKV is scarce but mosquito-borne flaviviruses are thought to replicate initially in dendritic cells near the site of inoculation then spread to lymph nodes and the bloodstream ( 24 ). Although flaviviral replication is thought to occur in cellular cytoplasm, 1 study suggested that ZIKV antigens could be found in infected cell nuclei ( 25 ). To date, infectious ZIKV has been detected in human blood as early as the day of illness onset; viral nucleic acid has been detected as late as 11 days after onset ( 1 , 26 ). The virus was isolated from the serum of a monkey 9 days after experimental inoculation ( 5 ). ZIKV is killed by potassium permanganate, ether, and temperatures >60°C, but it is not effectively neutralized with 10% ethanol ( 5 ). Clinical Manifestations The first well-documented report of human ZIKV disease was in 1964 when Simpson described his own occupationally acquired ZIKV illness at age 28 ( 27 ). It began with mild headache. The next day, a maculopapular rash covered his face, neck, trunk, and upper arms, and spread to his palms and soles. Transient fever, malaise, and back pain developed. By the evening of the second day of illness he was afebrile, the rash was fading, and he felt better. By day three, he felt well and had only the rash, which disappeared over the next 2 days. ZIKV was isolated from serum collected while he was febrile. In 1973, Filipe et al. reported laboratory-acquired ZIKV illness in a man with acute onset of fever, headache, and joint pain but no rash ( 26 ). ZIKV was isolated from serum collected on the first day of symptoms; the man’s illness resolved in ≈1 week. Of the 7 ZIKV case-patients in Indonesia described by Olson et al. all had fever, but they were detected by hospital-based surveillance for febrile illness ( 11 ). Other manifestations included anorexia, diarrhea, constipation, abdominal pain, and dizziness. One patient had conjunctivitis but none had rash. The outbreak on Yap Island was characterized by rash, conjunctivitis, and arthralgia ( 1 , 2 ). Other less frequent manifestations included myalgia, headache, retroorbital pain, edema, and vomiting ( 2 ). Diagnosis Diagnostic tests for ZIKV infection include PCR tests on acute-phase serum samples, which detect viral RNA, and other tests to detect specific antibody against ZIKV in serum. An ELISA has been developed at the Arboviral Diagnostic and Reference Laboratory of the Centers for Disease Control and Prevention (Ft. Collins, CO, USA) to detect immunoglobulin (Ig) M to ZIKV ( 1 ). In the samples from Yap Island, cross-reactive results in sera from convalescent-phase patients occurred more frequently among patients with evidence of previous flavivirus infections than among those with apparent primary ZIKV infections ( 1 , 2 ). Cross-reactivity was more frequently noted with dengue virus than with yellow fever, Japanese encephalitis, Murray Valley encephalitis, or West Nile viruses, but there were too few samples tested to derive robust estimates of the sensitivity and specificity of the ELISA. IgM was detectable as early as 3 days after onset of illness in some persons; 1 person with evidence of previous flavivirus infection had not developed IgM at day 5 but did have it by day 8 ( 1 ). Neutralizing antibody developed as early as 5 days after illness onset. The plaque reduction neutralization assay generally has improved specificity over immunoassays, but may still yield cross-reactive results in secondary flavivirus infections. PCR tests can be conducted on samples obtained less than 10 days after illness onset; 1 patient from Yap Island still had detectable viral RNA on day 11 ( 1 ). In general, diagnostic testing for flavivirus infections should include an acute-phase serum sample collected as early as possible after onset of illness and a second sample collected 2 to 3 weeks after the first. Public Health Implications Because the virus has spread outside Africa and Asia, ZIKV should be considered an emerging pathogen. Fortunately, ZIKV illness to date has been mild and self-limited, but before West Nile virus caused large outbreaks of neuroinvasive disease in Romania and in North America, it was also considered to be a relatively innocuous pathogen ( 28 ). The discovery of ZIKV on the physically isolated community of Yap Island is testimony to the potential for travel or commerce to spread the virus across large distances. A medical volunteer who was on Yap Island during the ZIKV disease outbreak became ill and was likely viremic with ZIKV after her return to the United States ( 2 ). The competence of mosquitoes in the Americas for ZIKV is not known and this question should be addressed. Spread of ZIKV across the Pacific could be difficult to detect because of the cross-reactivity of diagnostic flavivirus antibody assays. ZIKV disease could easily be confused with dengue and might contribute to illness during dengue outbreaks. Recognition of the spread of ZIKV and of the impact of ZIKV on human health will require collaboration between clinicians, public health officials, and high-quality reference laboratories. Given that the epidemiology of ZIKV transmission on Yap Island appeared to be similar to that of dengue, strategies for prevention and control of ZIKV disease should include promoting the use of insect repellent and interventions to reduce the abundance of potential mosquito vectors. Officials responsible for public health surveillance in the Pacific region and the United States should be alert to the potential spread of ZIKV and keep in mind the possible diagnostic confusion between ZIKV illness and dengue.

0 comments Cited 319 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: not found

Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State, Micronesia, 2007

Robert Lanciotti, Olga Kosoy, Janeen Laven … (2008)

Zika virus (ZIKV) is a mosquito-transmitted virus in the family Flaviviridae and genus Flavivirus. It was initially isolated in 1947 from blood of a febrile sentinel rhesus monkey during a yellow fever study in the Zika forest of Uganda ( 1 ). The virus was subsequently isolated from a pool of Aedes africanus mosquitoes collected in 1948 from the same region of the Zika forest; a serologic survey conducted at that time showed that 6.1% of the residents in nearby regions of Uganda had specific antibodies to ZIKV ( 1 , 2 ). Over the next 20 years, several ZIKV isolates were obtained from Aedes spp. in Africa (Ae. africanus) and Malaysia (Ae. aegypti), implicating these species as likely epidemic or enzootic vectors ( 3 – 5 ). Several ZIKV human isolates were also obtained in the 1960s and 1970s from East and West Africa during routine arbovirus surveillance studies in the absence of epidemics ( 6 – 8 ). Additional serologic studies in the 1950s and 1960s detected ZIKV infections among humans in Egypt, Nigeria, Uganda, India, Malaysia, Indonesia, Pakistan, Thailand, North Vietnam, and the Philippines ( 5 ). These data strongly suggest widespread occurrence of ZIKV from Africa to Southeast Asia west and north of the Wallace line. In 1977, ZIKV infection was confirmed among 7 patients in central Java, Indonesia, during an acute fever study ( 9 ). Data on these 7 ZIKV cases and several previously reported human infections indicated that clinical characteristics of infection with ZIKV included fever, headache, malaise, stomach ache, dizziness, anorexia, and maculopapular rash; in all cases infection appeared relatively mild, self-limiting, and nonlethal ( 6 , 8 – 10 ). In April 2007, an epidemic of rash, conjunctivitis, and arthralgia was noted by physicians in Yap State, Federated States of Micronesia ( 11 ). Laboratory testing with a rapid assay suggested that a dengue virus (DENV) was the causative agent. In June 2007, samples were sent for confirmatory testing to the Arbovirus Diagnostic Laboratory at the Centers for Disease Control and Prevention (CDC, Fort Collins, CO, USA). Serologic testing by immunoglobulin (Ig) M–capture ELISA with DENV antigen confirmed recent flavivirus infection in several patients. Testing by reverse transcription–PCR (RT-PCR) with flavivirus consensus primers generated DNA fragments, which when subjected to nucleic acid sequencing, demonstrated ≈90% nucleotide identity with ZIKV. These findings indicated that ZIKV was the causative agent of the Yap epidemic. We report serologic parameters of the immune response among ZIKV-infected humans, data on estimated levels of viremia, and the complete coding region nucleic acid sequence of ZIKV associated with this epidemic. Methods Analysis of Patient Samples Details of the epidemic, including clinical and laboratory findings for all patients, will be reported elsewhere (M.R. Duffy et al., unpub. data). A subset of ZIKV-infected patients for whom acute- and convalescent-phase paired serum specimens had been collected was analyzed by using several serologic assays to evaluate the extent of cross-reactivity to several related flaviviruses. Patients were classified as primary flavivirus/ZIKV infected or secondary flavivirus/ZIKV probable infected. Primary flavivirus/ZIKV–infected patients were those in whom acute-phase serum specimens ( 1 heterologous flaviviruses in their acute-phase specimen and were also IgM positive for ZIKV in their acute-phase specimen, or IgM and IgG positive for ZIKV in their convalescent-phase specimen. The designation “ZIKV probable” was used because secondary flavivirus infections demonstrate extensive cross-reactivity with other flaviviruses, and in some cases, higher serologic reactivity to the original infecting flavivirus (“original antigenic sin” phenomenon). Thus, in secondary flavivirus infections shown in Tables 1 and 2, serologic data alone is insufficient to confirm ZIKV as the recently infecting flavivirus. However, these secondary flavivirus/ZIKV probable infections were likely recent ZIKV infections because ZIKV was the only virus detected during the epidemic in Yap, a relatively small and isolated island ( 11 ). Table 1 IgG and IgM testing with heterologous flaviviruses of patients infected with ZIKV, Yap State, Micronesia, 2007* Patient Days after onset IgG IgM ZIKV ZIKV DENV YFV JEV MVEV WNV Primary flavivirus ZIKV 822a 5 1.5 23.2 1.3 1.4 1.7 1.1 – 822b 10 1.2 39.5 1.2 1.0 2.4 1.2 – 822c 24 3.3 13.1 2.7 0.63 1.8 1.3 – 830a 2 1.1 1.3 4.4 0.48 4.4 2.9 – 830b 21 1.8 16.3 1.9 0.63 1.3 1.6 – 849a 3 1.5 4.5 0.92 0.95 1.2 0.66 – 849b 18 3.0 18.2 2.2 1.0 2.7 1.5 – 862a 6 1.9 25.4 1.7 1.1 1.8 1.0 – 862b 20 2.6 15.4 2 1.1 2.3 1.1 Eq Secondary flavivirus ZIKV (probable) 817a 1 5.9 1.4 1.7 0.8 1.7 0.7 – 817b 19 5.7 8.1 5.1 2.1 1.7 1.0 – 833a 1 3.4 1.7 3.7 1.0 2.8 1.3 – 833b 19 8.2 3.1 2.3 0.9 2.5 1.3 – 844a 2 3.8 3.8 6.8 2.0 21.5 0.7 – 844b 16 8.5 12.7 14.9 7.0 42.9 1.6 – 955a 1 5.0 1.8 3.7 1.0 3.4 2.4 Eq 955b 14 26.6 10.9 3.4 0.8 1.7 4.0 Eq 968a 1 4.0 1.7 1.3 0.6 1.2 1.2 – 968b 3 12.3 20.4 2.9 0.8 0.9 2.0 – 839a 3 1 0.92 3.4 0.7 2.7 2.1 – 839b 20 4.9 17.2 2.2 2.1 1.9 1.8 – 847a 5 0.9 0.94 4.1 4.1 2.3 1.3 – 847b 8 14.1 21.5 1.4 3.3 1.1 2.6 – *Ig, immunoglobulin; ZIKV, Zika virus; DENV, dengue virus type 1–4 mixture; YFV, yellow fever virus; JEV, Japanese encephalitis virus; MVEV, Murray Valley encephalitis virus; WNV, West Nile virus; –, negative. Eq, result in equivocal range of the assay. IgG and IgM testing was conducted by ELISA except for WNV, which was tested by microsphere assay; ELISA values are patient optical densities divided by negative control optical densities; 3 positive. Table 2 Neutralization testing with heterologous flaviviruses of patients infected with ZIKV, Yap State, Micronesia, 2007* Patient Days after onset PRNT90 titer ZIKV DENV1 DENV2 DENV3 DENV4 JEV YFV WNV SLEV MVEV Primary flavivirus ZIKV 822a 5 320 3 were considered positive, and values 2–3 were considered equivocal. Neutralizing antibody titers were determined by using a PRNT with a 90% cut-off value ( 15 ). Real-Time RT-PCR Two real-time primer/probe sets specific for the ZIKV 2007 strain were designed by using ZIKV 2007 nucleotide sequence data in the PrimerExpress software package (Applied Biosystems, Foster City, CA, USA). Primers were synthesized by Operon Biotechnologies (Huntsville, AL, USA) with 5-FAM as the reporter dye for the probe (Table 3). All real-time assays were performed by using the QuantiTect Probe RT-PCR Kit (QIAGEN, Valencia, CA, USA) with amplification in the iCycler instrument (Bio-Rad, Hercules, CA, USA) following the manufacturer’s protocol. Specificity of the ZIKV primers was evaluated by testing the following viral RNAs, all of which yielded negative results: DENV-1, DENV-2, DENV-3, DENV-4, WNV, St. Louis encephalitis virus, YFV, Powassan virus, Semliki Forest virus, o’nyong-nyong virus, chikungunya virus, and Spondweni virus (SPOV). Table 3 Description and performance characteristics of Zika virus real-time RT-PCR primer/probe sets* Primer Genome position† Sequence (5′ → 3′) Sensitivity, no. copies Specificity‡ ZIKV 835 835–857 TTGGTCATGATACTGCTGATTGC ZIKV 911c 911–890 CCTTCCACAAAGTCCCTATTGC 100 ZIKV ZIKV 860-FAM 860–886 CGGCATACAGCATCAGGTGCATAGGAG ZIKV 1086 1086–1102 CCGCTGCCCAACACAAG ZIKV 1162c 1162–1139 CCACTAACGTTCTTTTGCAGACAT 25 ZIKV ZIKV 1107-FAM 1107–1137 AGCCTACCTTGACAAGCAGTCAGACACTCAA *RT-PCR, reverse transcription–PCR; ZIKV, Zika virus. †Based on ZIKV MR 766 GenBank accession no. AY632535. ‡ZIKV specificity indicates a positive result with ZIKV only and no reactivity with dengue virus-1 (DENV-1), DENV-2, DENV-3, DENV-4, West Nile virus, St. Louis encephalitis virus, yellow fever virus, Powassan virus, Semliki Forest virus, o’nyong-nyong virus, chikungunya virus, and Spondweni virus. Sensitivity of the ZIKV real-time assay was evaluated by testing dilutions of known copy numbers of an RNA transcript copy of the ZIKV 2007 sequence. Copy numbers of RNA were determined by using the Ribogreen RNA-specific Quantitiation Kit (Invitrogen) and the TBE-380 mini-fluorometer (Turner Biosystems, Sunnyvale, CA, USA). RNA transcripts ranging from 16,000 to 0.2 copies were tested in quadruplicate to determine the sensitivity limit and to construct a standard curve for estimating the genome copy number of ZIKV in patient samples. All serum samples obtained during the epidemic were tested for ZIKV RNA by using this newly designed real-time RT-PCR. Concentration of viral RNA (copies/milliliter) was estimated in ZIKV-positive patients by using the standard curve calculated by the iCycler instrument (Table 4). All RT-PCR–positive specimens were placed on monolayers of Vero, LLC-MK2, and C6/36 cells to isolate virus; no specimens showed virus replication. Table 4 Results of quantitative real-time RT-PCR of samples from ZIKV-positive patients, Yap State, Micronesia, 2007* Patient Days after onset ZIKV real-time RT-PCR Ct-860† Ct-1107† Result Estimated copies/mL‡ 824 1 34.3 34.7 + 11,647 939 2 32.0 32.4 + 67,817 947 2 34.3 33.9 + 21,495 949 2 35.1 35.1 + 8,573 969 1 29.4 29.3 + 728,800 037 1 32.1 32.5 + 62,816 830a 2 30.7 30.0 + 426,325 847a 5 34.8 34.7 + 11,647 950a 0 32.2 32.7 + 53,894 943 3 37.6 35.6 + 5,845 952 1 29.3 29.5 + 625,280 958 11 29.9 30.3 + 338,797 970 1 35.5 34.8 + 10,788 42 0 32.9 33.6 + 27,048 941 3 31.1 38.0 + 930 964 0 38.3 37.6 + 1,263 063a 2 37.5 38.0 + 930 *RT-PCR, reverse transcription–PCR; ZIKV, Zika virus; Ct, crossing threshold; +, positive. †Ct values with primer set 835/911c/860-FAM or 1086/1162c/1107-FAM. Values 1 of the heterologous flaviviruses tested, and all demonstrated low levels of cross-reactive IgM as shown by a P/N value in the equivocal range. PRNT90 results showed that among secondary flavivirus/ZIKV–probable patients, the neutralizing antibody response was higher to ZIKV and more cross-reactive, a finding commonly observed among secondary flavivirus infections. A >4-fold PRNT90 titer between ZIKV and heterologous flaviviruses was observed in only 3 of the 7 patients. In all other cases, the PRNT difference between ZIKV and other flaviviruses tested was 38.5, which suggests either a false-positive result or a sample with low levels of ZIKV RNA below the defined cut-off of the assay. Table 4 shows estimated viral concentrations of the 17 ZIKV-positive specimens. The viral RNA concentrations were ≈900–729,000 copies/mL. Most (15 of 17) of the ZIKV-positive samples were from specimens collected 2 patients; in these overlap regions the sequence identity between different patients was ≈100%. Only 2-nt differences between patients were noted within the overlapping regions, strongly suggesting that 1 ZIKV strain circulated during the epidemic. Percentage identity over the entire coding region of ZIKV 2007 EC sequence, when compared with the prototype ZIKV (MR 766, isolated in 1947), was 88.9% and 96.5% at the nucleotide and amino acid levels, respectively. Phylogenetic trees constructed from the complete coding region of all available flaviviruses generated by a variety of methods (neighbor-joining, maximum-parsimony, or minimum-evolution) showed the same overall topology, with the ZIKV prototype and 2007 EC virus placed in a unique clade (clade 10) within the mosquito-borne flavivirus cluster previously described by Kuno et al. ( 16 ). Alignment with phylogenetic tree construction by neighbor-joining, maximum-parsimony, or minimum-evolution algorithms was also performed for the NS5 region of all available flaviviruses because extensive sequencing and phylogenetic analysis have been conducted for this region ( 16 ). Three additional ZIKV strains isolated from Senegal in 1984 and sequenced in this study were also included in a tree. This NS5 tree demonstrated similar topology to the complete coding region tree, with all ZIKVs placed within a unique clade (clade 10) along with SPOV. Figure 1 shows the NS5 tree with only mosquito-borne flaviviruses (cluster) displayed. This NS5 tree also shows that within the Zika/Spondweni clade there appear to be 3 branches among ZIKVs: Nigerian ZIKVs, prototype MR766, and 2007 Yap virus. Percentage identity among these ZIKVs confirms the tree topology, in which ZIKV 2007 EC is most distally related to East and West African ZIKV strains (data not shown). The predicted amino acid sequence of ZIKV 2007 EC contains the Asn-X-Ser/Thr glycosylation motif at position 154 in the envelope glycoprotein, found in many flaviviruses, yet absent by deletion in the prototype ZIKV MR 766. This region of the prototype virus, along with 3 ZIKVs isolated from Senegal in 1984, was sequenced (Figure 2). Included in this alignment is a ZIKV isolate from GenBank (accession no. AF372422). Sequencing confirmed that prototype ZIKV MR766 has a 4-aa (12-nt) deletion when compared with ZIKV 2007 EC virus and ZIKVs from Senegal. Figure 2 Alignment of nucleotide and amino acid sequences adjacent to the envelope (ENV)–154 glycosylation site of Zika virus strains. Dashes indicate deletions. EC, epidemic consensus. Discussion Historically, ZIKV has rarely been associated with human disease, with only 1 small cluster of human cases in Indonesia reported ( 9 ). We report a widespread epidemic of human disease associated with ZIKV in Yap State in 2007. ZIKV epidemics may have occurred but been misdiagnosed as dengue because of similar clinical symptoms and serologic cross-reactivity with DENVs. Our serologic data indicate that ZIKV-infected patients can be positive in an IgM assay for DENVs, particularly if ZIKV is a secondary flavivirus infection. If ZIKV is the first flavivirus encountered, our data indicate that cross-reactivity is minimal. However, when ZIKV infection occurs after a flavivirus infection, our data indicate that the extent of cross-reactivity in the IgM assay is greater. Therefore, if ZIKV infections occur in a population with DENV (or other flavivirus) background immunity, our data suggest that extensive cross-reactivity in the dengue IgM assay will occur, which could lead to the erroneous conclusion that dengue caused the epidemic. Whether this cross-reactivity has occurred is open to speculation. However, reexamination of specimens from dengue epidemics may provide an answer. In addition, use of virus isolation or RT-PCR for laboratory diagnosis of dengue infections would also prevent this misinterpretation. Therefore, use of virus detection assays in dengue epidemics should be a component of laboratory testing algorithms. Levels of viremia among ZIKV-infected patients were relatively low. Unfortunately, measurement of concentration of infectious ZIKV was not possible because a virus isolate was not obtained from any patient during the epidemic. Absence of a ZIKV 2007 isolate also precluded use of a ZIKV 2007 isolate to generate a standard curve in the RT-PCR, which in turn could have estimated the concentration of infectious virus within patients. An estimation of the number of genome copies circulating in ZIKV-infected patients was calculated by using an RNA transcript and provides some indication of infectious virus concentration in ZIKV-infected patients. If one assumes a ratio range of 200–500 genome copies per infectious virus particle, a range reported for several flaviviruses, then the copies/milliliter values in Table 4 would be in the range of ≈2–3,500 infectious virus particles/mL, with only 4 specimens in which ZIKV exceeded 1,000 infectious units/mL ( 18 , 19 ). These findings may partially explain why ZIKV was not isolated, especially if one considers that shipping samples to our laboratory took ≈1 week, and shipping conditions were not conducive to virus isolation. These concentration estimates are also consistent with those of a study in which a ZIKV-infected human volunteer showed low viremia; virus was isolated only on day 4, and the volunteer was unable to infect Ae. aegypti mosquitoes that fed on the patient during the acute stage of disease ( 10 ). Although generation of a complete coding region nucleic acid sequence by using a combination of patient samples from the epidemic is an unconventional approach, it was performed out of necessity because of limited volumes of patient samples. However, the extent of agreement among overlapping regions confirms that the sequence obtained accurately represents the virus associated with the epidemic. Nucleic acid sequence of ZIKV 2007 showed divergence (11%) from the prototype strain (MR766) isolated in 1947. However, the predicted amino acid sequence is fairly conserved (96%), which is likely the result of the selective pressure maintained on the virus because replication occurs in vertebrate hosts and arthropod vectors. Phylogenetic trees based on the complete coding region or the NS5 region confirm results of a study in which ZIKV was classified in a unique clade among the mosquito-borne flaviviruses and most closely related to SPOV ( 16 ). The NS5 mosquito-borne flavivirus tree (Figure 1), which includes additional ZIKV isolates, confirms these relationships and suggests that there are 3 subclades among ZIKV isolates that reflect geographic origin. Senegal ZIKVs and prototype virus from Uganda may represent West and East African lineages, respectively. The 2007 ZIKV is distantly related to these 2 African subclades and may represent divergence from a common ancestor with spread throughout Southeast Asia and the Pacific. Human ZIKV cases were detected in peninsular Malaysia in 1980, which confirms that ZIKV was active in this region before 2007 ( 9 ). Additional sequence analysis of other temporally and geographically distinct ZIKV strains is needed to further elucidate relationships among these viruses. Of particular interest is an additional 12 nt in the envelope gene (corresponding to 4 aa) in our ZIKV isolate that were not present in the ZIKV prototype virus (Figure 2). This difference is noteworthy because these 4 aa correspond to the envelope protein 154 glycosylation motif found in many flaviviruses and associated in some instances with virulence. This glycosylation motif is also absent because of a 6-aa deletion in the ZIKV isolate obtained from GenBank (accession no. AF372422); however, the geographic and temporal origins of this virus were not available. Loss of the envelope protein 154 glycoslyation site has been observed in some flaviviruses, and in the case of Kunjin virus has been shown to occur during passage. However, with Kunjin virus, the glycosylation site motif was lost because of a 1-base mutation, rather than a deletion, that altered the N-X-S/T sequon ( 20 ). Loss of this glycosylation site by a 4-aa deletion has also been observed in several lineage-2 WNV strains when compared with all other WNV strains ( 21 ). The glycoslyation motif in WNV may be lost during extensive mouse brain passage; however, no direct evidence exists to support this hypothesis ( 21 ). This process may occur in ZIKV; the glycoslyation motif in MR 766 may have been present in earlier passages of prototype MR766 and lost during extensive mouse brain passage. However, earlier passage strains of MR766 were not available for investigating this hypothesis. Alternatively, the presence or absence of this glycosylation motif may represent an ancient evolutionary event with subsequent divergence of 2 ZIKV types with or without the E-154 glycosylation site amino acids. Sequence data derived from 3 additional ZIKV isolates from Senegal showed that glycosylation is intact in these isolates, which suggests evolutionary divergence. More extensive sequence analysis of available ZIKV strains of various temporal, geographic, and passage histories may provide some insight into this issue.

0 comments Cited 297 times – based on 0 reviews      Review now

Bookmark

All references

Author and article information

Contributors

Luis Martinez-Sobrido: Role: Academic Editor

Journal

Journal ID (nlm-ta): Viruses

Journal ID (iso-abbrev): Viruses

Journal ID (publisher-id): viruses

Title: Viruses

Publisher: MDPI

ISSN (Electronic): 1999-4915

Publication date (Electronic): 08 July 2021

Publication date Collection: July 2021

Volume: 13

Issue: 7

Electronic Location Identifier: 1319

Affiliations

[1 ]J. Craig Venter Institute, La Jolla, CA 92137, USA; mpmviedma@ 123456gmail.com (M.d.P.M.V.); gtan@ 123456jcvi.org (G.S.T.)

[2 ]J. Craig Venter Institute, Rockville, MD 20850, USA; spanossian@ 123456student.umgc.edu

[3 ]Department of Microbiology and Molecular Biology, Brigham Young University, Provo, UT 84602, USA; kennedylincoln@ 123456icloud.com

[4 ]Instituto de Investigacion en Microbiologia, Universidad Nacional Autónoma de Honduras, Tegucigalpa, Honduras; kimfa_2010@ 123456hotmail.com (K.G.); isismaria_rodas@ 123456hotmail.com (I.F.); lparham29@ 123456hotmail.com (L.P.); ivettelorenzana@ 123456yahoo.com (I.L.)

[5 ]Institute Goncalo Moniz, Fiocruz Bahia, Salvador 40296-710, Brazil; laisepaixao@ 123456live.com (L.d.M.); lilliangomes20@ 123456gmail.com (L.N.G.); vsboaventura@ 123456gmail.com (V.B.)

[6 ]Departmento de Enfermedades Infecciosas e Inmunología Pediátrica, Escuela de Medicina, Pontificia Universidad Católica de Chile, Santiago H955+8Q, Chile; tcgarcia21@ 123456gmail.com (T.G.-S.); cperret@ 123456uc.cl (C.P.); rmedinai@ 123456uc.cl (R.A.M.)

[7 ]Center for Infectious Disease and Vaccine Research, La Jolla Institute for Immunology, La Jolla, CA 92037, USA; dweiskopf@ 123456lji.org (D.W.); alex@ 123456lji.org (A.S.); dharshan_fom@ 123456kdu.ac.lk (A.D.D.S.)

[8 ]Department of Medicine, Infectious Diseases Division, University of California San Diego, La Jolla, CA 92037, USA

[9 ]Hospital Universitário-Universidade Federal do Maranhão, São Luís 65000-000, Brazil; aamouradasilva@ 123456gmail.com

[10 ]Faculdade de Medicina da Bahia-Universidade Federal da Bahia, Salvador 40000-000, Brazil; kakrami@ 123456ucsd.edu (K.M.A.); ricardo.khouri@ 123456fiocruz.br (R.K.)

[11 ]Instituto Nacional de Nutricion, Universidad Nacional Autonoma de Mexico, Mexico City 04510, Mexico; gmrps@ 123456unam.mx

[12 ]Department of Medicine, University of California San Diego, La Jolla, CA 92037, USA

[13 ]Genetech Research Institute, Colombo 00800, Sri Lanka

[14 ]Department of Paraclinical Sciences, Faculty of Medicine, General Sir John Kotelawala Defence University, Ratmalana 10390, Sri Lanka

[15 ]Department of Microbiology, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA

[16 ]Department of Pediatrics, Section of Infectious Diseases, University of Colorado School of Medicine, Aurora, CO 80045, USA; daniel.olson@ 123456childrenscolorado.org

Author notes

[* ]Correspondence: brett_pickett@ 123456byu.edu

Author information

Maria del Pilar Martinez Viedma https://orcid.org/0000-0002-8885-5008

Laise de Moraes https://orcid.org/0000-0001-9095-5860

Viviane Boaventura https://orcid.org/0000-0002-7241-6844

Rafael A. Medina https://orcid.org/0000-0002-5013-6884

Ricardo Khouri https://orcid.org/0000-0001-5664-4436

Brett E. Pickett https://orcid.org/0000-0001-7930-8160

Article

Publisher ID: viruses-13-01319

DOI: 10.3390/v13071319

PMC ID: 8310037

SO-VID: 3f706293-3fac-4295-9e19-b1b46bccfcb0

License:

Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license ( https://creativecommons.org/licenses/by/4.0/).

Evaluation of ELISA-Based Multiplex Peptides for the Detection of Human Serum Antibodies Induced by Zika Virus Infection across Various Countries

Read this article at

Abstract

Related collections

Zika Virus

Most cited references 38

Zika virus outbreak on Yap Island, Federated States of Micronesia.

Zika Virus Outside Africa

Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State, Micronesia, 2007

Author and article information

Contributors

Journal

Affiliations

Author notes

Author information

Article

History

Categories

Comments

Comment on this article

Similar content 242

Cited by 1

Most referenced authors 671