Introduction Malaria and filariasis are two of the most important vector-borne parasitic diseases in Southeast Asia. Although China and several other countries in the region have reported a marked downward trend in malaria cases, high malaria incidence has been observed in the major neighboring endemic countries such as Myanmar, Bangladesh, and India [1]. Cross-border migration provides increased opportunities for malaria infections. Further, the high frequencies of natural disasters augment the risk of imminent outbreaks of malaria. Therefore, malaria surveillance and vector control become very important tools to prevent malaria outbreaks in low-transmission areas [1]. Currently, insecticide-treated bed nets (ITNs) and indoor residual spray (IRS) are the primary vector control tools in the Global Strategy for Malaria Control and the Roll Back Malaria program [2] and in the Global Fund to Fight AIDS, Tuberculosis and Malaria [3]. Pyrethroids are currently the only class of insecticide approved for use on ITNs [4] due to their high toxicity to insects, rapid rate of knockdown, strong mosquito excito-repellency, and low mammalian toxicity [5]. Reducing vector-human contact by the use of ITNs has been shown effective in reducing malaria transmission [6], [7]. However, the emergence and spread of insecticide resistance has significantly hampered the efficacy of ITN programs [8]. Insecticides remain the most important vector control method; however, insecticide resistance poses a major threat to vector-borne disease control due to lack of other viable alternatives. Several methods have been proposed to mitigate insecticide resistance in vector mosquito populations, including insecticide rotation strategies [1] and combinational use of insecticides with different modes of action. Resistance to any particular insecticide is mitigated, since the selection pressure is removed before resistance is developed. Combinational use of insecticides with different modes of action is currently applicable to IRS only, with the assumption that mosquito vectors exhibit low resistance to the new insecticides under consideration. Adding IRS to the ITN program becomes an increasingly popular malaria control strategy worldwide due to increasing resistance to pyrethroids used in ITNs [8]. WHO-recommended products for IRS include four classes of insecticides: pyrethroids, organochlorines, organophosphates, and carbamates [1]. However, the long-term consequences of insecticide rotation and combinational use of insecticides on mosquito insecticide resistance are not clear. The mosquito Anopheles sinensis is the most important malaria vector in China and other Southeast Asian countries [9]–[14]. In southern China, An. sinensis play an important role in the natural transmission of both malaria and filariasis (Wuchereria bancrofti) [15]–[17], as well as Romanomermis jingdeensis [18] and Setaria digitata [19]–[21]. The major breeding sites of An. sinensis in China are rice fields where various classes of insecticides have been used in agricultural pest control regimes in rotation [22], [23]. Although An. sinensis is not the intended target in this pest control regimes, it has been directly exposed to the insecticides over a period of four decades [24]–[26]. Therefore, An. sinensis in China also represents an interesting model in which to examine the consequence of long-term rotational use of various insecticides on resistance evolution. In this study, we examined the extent and distribution of insecticide resistance in An. sinensis against the four classes of insecticides recommended by WHO for malaria vector control by IRS. It also indirectly examined the long-term consequences of rotational use of insecticides on mosquito resistance evolution. Using An. Sinensis populations from central and southern China, general correlations between insecticide-specific resistance and geography can be examined. The information obtained from this investigation can be used to guide insecticide rotation strategies. Another major objective of this study was to examine the importance of target site insensitivity and various metabolic detoxification enzymes in resistance to the major classes of insecticides used in IRS. Pyrethroids and organochlorines function as neurotoxins that act by prolonging sodium channel activation whereas organophosphates and carbamates kill insects by inhibiting acetylcholinesterase found in the central nervous system [27]. The voltage-sensitive sodium channel proteins are the major target site for pyrethroids and DDT, and a mutation at codon 1014 the para sodium ion channel gene causes knockdown resistance (kdr) [27]. On the other hand, a mutation at codon 119 of the acetylcholinesterase (ace-1) gene that leads to a single amino acid substitution of glycine to serine in the binding pocket of acetylcholinesterase may confer resistance to organophosphates and carbamates. In addition to target-site insensitivity, metabolic detoxification enzymes—including cytochrome P450 monooxygenases (P450s), carboxylesterases, and glutathione S-transferases (GSTs) —may also augment insecticide resistance [27]. The possible pleiotropic role of metabolic enzymes on resistance and the relative significance of each mechanism on resistance to multiple classes of insecticides in An. sinensis are unknown. This information is particularly valuable to the development of reliable molecular-based resistance surveillance tools. Materials and Methods Ethics statement No specific permits were required for the described field studies. For mosquito collection in rice paddies, oral consent was obtained from field owners in each location. No sites were protected by law and this study did not involve endangered or protected species. Study sites The study was conducted in malaria endemic sites in southern China (Yunnan Province) and central China (Anhui Province) (Fig. 1). Yunnan Province has the highest malaria incidence in China and is responsible for about 50% of officially reported malaria cases in China [28]. Malaria in Yunnan province is mesoendemic with perennial circulation of both P. vivax and P. falciparum parasites [28], [29]. Anhui Province is hypo-endemic, with Plasmodium vivax as the predominant malaria species [30]. The Yunnan site was located in Yingjiang and Lianghe Counties, Dehong Prefecture, and the Anhui site was in suburbs of Bengbu City. Rice is the major agricultural crop in these study sites, with 1–2 harvests per year. Due to severe insect pest damage to the rice, insecticide use for pest control has been very intensive, with several rounds of sprays administered during each growing season. From 1960 to 1990, insecticides were extensively used in agriculture in China because the government routinely subsidized pesticide expenses by as much as 85%. The pesticides used were predominantly organochlorines and organophosphates from the 1970s up to the early 1980s. Since the mid-1980s, pyrethroids have been the dominant insecticides with pyrethroids-treated areas constituting more than one third of the total insecticide-treated area in China [26], [31]. In addition to their agricultural use, pyrethroids have had various public-health applications—as indoor sprays or incense, impregnated in bed nets, or as tools in public sanitation. Other insecticides, including organophosphates and carbamates, have been used widely but less extensively than pyrethroids. 10.1371/journal.pntd.0002889.g001 Figure 1 Sampling sites of Anopheles sinensis mosquitoes in southern (Yunnan) and central (Anhui) China. Mosquito sample collection During May–August 2012, Anopheles sinensis mosquito larvae and pupae were collected from irrigated rice fields and small ponds with aquatic plants, using standard 350-ml dippers. We used adults reared from field-collected larvae for this study to minimize the influence of mosquito age and blood feeding history on resistance measurements [4], [32]. For each site, we collected mosquito larvae from >100 breeding sites in each of the five villages, separated by 5–10 km from each other, to avoid using genetically-related siblings in the subsequent resistance analysis. We collected a total of 4,000 anopheline larvae per site. The collected mosquito larvae were transported to the local rearing facility to be reared into adults. All adult mosquitoes were identified to species using the published morphological keys of Dong [33]. An. sinensis adult mosquitoes were provided with fresh 10% sucrose solution daily. Insecticide susceptibility bioassay After the mosquitoes were identified to species, An. sinensis female adult mosquitoes at 3–4 days post emergence were tested for susceptibility to five insecticides belonging to four classes (0.05% deltamethrin, 0.75% permethrin, 5% malathion, 0.1% bendiocarb, and 4% DDT), using the standard WHO resistance tube assay [4]. The discriminating dose used for each insecticide should kill 99.9% susceptible mosquitoes [4]. As a susceptible mosquito control, we used a laboratory susceptible strain that has been maintained in the insectary of the Jiangsu Institute of Parasitic Diseases in Wuxi, China, for more than 10 years with no insecticide exposure. For each insecticide, a total of 100–150 female mosquitoes were tested in insecticide susceptibility bioassays, with 20 mosquitoes per tube. Equal number of mosquitoes were exposed to the corresponding control papers impregnated with silicone oil (deltamethrin/permethrin control), olive oil (malathion/bendiocarb control), and resila oil (DDT control). After a 1-hr exposure, mosquitoes were transferred to recovery cups and maintained on 10% sucrose solution for 24 hrs, and the number of surviving mosquitoes was recorded. Here, we defined resistant for the mosquitoes alive 24 hours after the end of the bioassay and susceptible for the mosquitoes knocked down during the 60 min exposure time or within 24 hr recovery period [34]. Mosquitoes were considered knocked down if they were unable to walk from the center to the border of a 7-cm filter paper disc, either alone or when they were mechanically stimulated [4]. After the resistance/susceptible status were recorded, one leg of each mosquito was removed and preserved individually in 95% alcohol for subsequent DNA analysis, and the remainder of the body was immediately tested for metabolic enzyme activities. Therefore, only fresh mosquitoes were tested for metabolic enzyme activities. Our definition of susceptible mosquitoes was based on knockdown phenotype, rather than death phenotype. As such, metabolic enzyme activities of susceptible mosquitoes could be measured because fresh mosquitoes were used. This definition allowed us to determine the association between metabolic enzyme activities and resistance with little bias because the resistant and susceptible mosquitoes were exposed to the insecticide in the same manner and our analysis computed the ratio of metabolic enzymes in the resistant mosquitoes to the susceptible mosquitoes. A total of 1,103 female adult mosquitoes were used for bioassay in the study. Metabolic enzyme activity assays Three metabolic enzymes were analyzed: cytochrome P450 monooxygenases (P450s), glutathione S-transferases (GSTs), and carboxylesterases (COEs). We followed our previously published protocol to measure monooxygenase and GST activities [23]. Mean absorbance values for each tested mosquito and enzyme were converted into enzyme activity and standardized based on the total protein amount. Total protein was measured for each mosquito using the method of Bradford [35]. All measurements were done in duplicate. COE activity was measured following the method of Hosokawa and Satoh [36]. Briefly, 900 µl of p-nitrophenyl acetate solution (1 mM) was transferred to 1.5-ml test tubes and incubated at 30°C for 5 min, then 100 µl of mosquito homogenates was added and vortexed for 5 sec. The reaction mixture was transferred to 1.0-ml semimicro cuvettes, and the release of p-nitrophenol was measured using a UV/VIS spectrophotometer at 405 nm for 2 min. Spontaneous hydrolysis was used as the blank. COE activity was calculated as µmol of p-nitrophenol formed per min per mg protein, using the formula (Δabsorbance/min – Δblank/min) ×1.0/16.4×0.05× protein (mg/ml). An absorption coefficient of 16,400 M−1·cm−1 was used [37]. For each mosquito population and each insecticide, 100 female adult mosquitoes were tested. Mosquito DNA extraction and molecular identification of mutation at the target sites One leg of each mosquito was used for DNA extraction for subsequent PCR-based mosquito species confirmation and mutation detection in kdr and ace-1 genes. DNA extraction was done with the SYBR Green Extract-N-Amp™ Tissue PCR Kit (SIGMA) following the manufacturer's protocol. Extracted DNA was stored at 4°C or used immediately. Molecular identifications of An. sinensis species were done by using species-specific primers and amplification of the ITS2 and 28S rDNA regions (D1 and D2) [38]. A total of 100 mosquitoes per site were randomly selected and tested molecularly, and all of them identified as An. sinensis. Detection of point mutation of the kdr gene at codon 1014 was done by using the allele-specific PCR (AS-PCR) methods developed by Zhong et al [23]. A PCR-RFLP method was developed to rapidly determine point mutation of the ace-1 gene at codon 119 following the method used in An. gambiae [39]. Briefly, we designed a pair of primers (Forward primer 467F: GTGCGACCATGTGGAACC, Reverse primer 660R: ACCACGATCACGTTCTCCTC) based on the An. gambiae ace-1 gene sequence (GenBank accession: BN000066) to amplify a 193-bp fragment that flanks the target codon position 119 in the ace-1 gene (ace-1R). The PCR products of 20 individuals from each population were sequenced in both forward and reverse directions (GenBank accession: KF697669- KF697683, KF709027-KF709034). The PCR product was digested by AluI restriction enzyme, which results in 118-bp and 75-bp fragments when there is a homozygous G119S mutation. A total of 577 and 414 mosquitoes were tested for kdr and ace-1 mutations, respectively. Genotype frequencies were calculated and deviation from Hardy-Weinberg equilibrium (HWE) was analyzed using the web-based program ‘GENEPOP’ [40]. Insecticide use and sales survey Agricultural activity is particularly intense in the two study sites. Insecticides are commonly used for agricultural pest control. An insecticide usage survey was conducted following a standardized questionnaire that included questions on crops harvested and insecticides used, including brand name, time and operation dosage for crop treatment and for human health protection. For each site, questionnaire surveys on 20 households were administered. Residual insecticide analysis in water and soil samples Soil and water samples were collected from four mosquito sampling sites in Anhui Province to determine residual insecticide concentrations for deltamethrin (pyrethroid) and chlorpyrifos (organophosphate) in July 2012. For each sampling site, water samples were collected at four equidistant points in 250-ml aliquots, 5 cm from the water's surface. The aliquots were combined in 1-L amber glass bottles and analyzed in duplicate. Soil samples were extracted as 10-cm plugs at four points in each sampling site. The samples were combined and manually blended until homogeneous. Water and soil samples were chilled (4°C for water and −20°C for soil) until analysis. A negative water and soil samples for controls were collected from an abandoned cornfield that has not been planted or sprayed with insecticides for at least two years. A positive control sample was prepared by adding diluted deltamethrin and chlorpyrifos to the negative water and soil samples at a concentration in ppm. Each water sample was directly extracted in a separatory funnel with methylene chloride. The organic fractions were combined, dried with anhydrous sodium sulfate, and filtered. The solvent was stripped in vacuo before a final dilution in hexane for analysis using a GC-MS equipped with an electron impact ion source. Soil samples were prepared by mixing 5.0 g (dry weight) sample with anhydrous sodium sulfate. The sample was extracted with a 1∶1 (v/v) methylene chloride:acetone solution under ultrasonicating conditions. The organic layers were combined and dried with sodium sulfate, and the solvent was evaporated in vacuo prior to the addition of activated copper to remove sulfur contamination. The solution was filtered and evaporated to dryness. The residue was taken up in 9∶1 hexane:acetone and eluted through a plug of silica conditioned with 9∶1 hexane:acetone. The sample was eluted and dried, and the residue was reconstituted in 9∶1 hexane:acetone for analysis using a GS-MS equipped with an electron-impact ion source in selective-ion monitoring mode. Sample chemical analysis was conducted by the National Center of Agricultural Standardization and Supervision (Anhui) under the China National Center for Quality Supervision and Testing of Agricultural-Avocation Processed Food. Statistical analysis Mosquito mortality rates after a 24-hr recovery period were calculated for each insecticide. If control mortality was greater than 5% but less than 20%, then the observed mortality was corrected according to the mortality rates of the respective control groups (control paper) using Abbott's formula following the WHO test procedures [41]. If the control mortality was below 5%, it was ignored and no correction was necessary. If the control mortality was above 20%, the tests were discarded. We classified mosquito resistance status according to WHO criteria [4]—i.e., resistant if mortality is 98%. Univariate analysis of variance (ANOVA) was conducted using the arcsin transformation of the mosquito mortality rate to determine among-population differences in mosquito mortality rates in the insecticide susceptibility bioassay. One-tailed Mann-Whitney tests were used to compare the enzyme activities in the two field populations and the lab susceptible strains. To determine the role of target site mutation and metabolic detoxification enzymes on phenotypic resistance, we conducted the following three analyses. First, the kdr and ace-1 allele frequency was calculated in each population. The odds ratio (OR) of kdr and ace-1 gene mutation on resistance (survival or death in resistance bioassay) was calculated, and the statistical significance was determined using the Chi-Square (χ2) test. Second, the mean enzymatic activity was calculated for mosquitoes that survived the bioassay (resistant) and those that died in the bioassay (susceptible) for each insecticide tested, and the relative enzyme activity ratio of resistant individuals to susceptible individuals was presented. A t-test was used to determine whether this ratio value was significantly different from the null expectation of 1 (same enzyme activities between resistant and susceptible individuals). Third, we used the CART method to determine the relative contributions of target site mutations (kdr and ace-1 genes) and metabolic detoxification enzymes (P450s, GSTs and COEs) to phenotypic resistance. The CART method is a nonparametric statistical method that recursively partitions the multidimensional space defined by the explanatory factors into subsets as homogeneous as possible [42]. In the CART analysis, the dependent variable was resistant or susceptible status of a mosquito, and factors analyzed were kdr or ace-1 mutation (binomial variables), and P450, GST and COE enzyme activities (continuous variables). We used the Gini impurity criterion to determine variable splits and identified optimal trees from repeated cross-validations to find the smallest trees whose model errors fell within 1 standard error of the minimum error [43]. The relative importance of each variable is measured by the predictor importance score. A raw variable importance score is constructed by locating every node split by a variable and summing up all the improvement scores generated by the variable at those nodes (if the variable acted as a surrogate, add up all those improvement scores as well). The raw importance score is rescaled so that the best score is always 100 and all other variables are scaled down proportionately [44]. The CART v6.0 software (Salford Systems, Inc) was used to construct classification and regression trees [44]–[46]. Accession numbers An. sinensis kdr haplotypes. Yunnan: KF697669-KF697673; Anhui: KF697674-KF697683. An. sinensis ace-1 haplotypes. Yunnan: KF709027-KF709030; Anhui: KF709031-KF709034. Results Insecticide susceptibility bioassay The standard WHO resistance tube bioassay found that the mortality rate of the mosquitoes against the various control papers was generally 98%, probable resistant if mortality rate ranges 90–98%, resistant if mortality rate 0.05). Interestingly, no kdr mutation was detected in the Yunnan population despite high levels of phenotypic resistance (Table 1). No kdr mutation was detected in the lab susceptible strain. 10.1371/journal.pntd.0002889.t001 Table 1 kdr mutation frequency of the study populations and association with resistance to pyrethroid and organochlorine insecticides. Population Insecticide Status N Frequency OR[95% CI] L1014F L1014C L1014 L1014F L1014C Anhui Deltamethrin Alive 93 79.0 19.4 1.6 5.44*[1.31,22.54] 5.14*[1.12,23.45] Dead 37 72.9 18.9 8.2 Permethrin Alive 57 83.3 12.3 4.4 0.39[0.02,7.08] 0.41[0.02,9.56] Dead 15 70.0 26.7 3.3 DDT Alive 67 81.3 12.7 6.0 0.90[0.10,8.15] 0.35[0.03,3.54] Dead 9 88.9 11.1 0 Yunnan Deltamethrin Alive 75 0 0 100 - - Dead 26 0 0 100 Permethrin Alive 69 0 0 100 - - Dead 28 0 0 100 DDT Alive 40 0 0 100 - - Dead 61 0 0 100 Note. The laboratory susceptible strain showed 100% mortality for the three insecticides and no kdr mutation was detected. N is the number of individuals tested. L1014F represents a mutated allele from leucine to phenylalanine at codon 1014 of the para sodium ion channel gene, L1014C is another mutated allele from leucine to cysteine, and L1014 is the wildtype allele. OR (odds ratio) tests the association between a particular mutation and resistance. *, P 90% kdr mutation frequency in Hunan, Hubei and Jiangsu Provinces, China [23]. Tan et al [60] reported a 95–100% kdr mutation frequency in an An. sinensis population from Jiangsu Province in central China. In addition to the predominant L1014F kdr allele, we found L1014C allele with considerable frequency. Further, we detected a significant positive association between L1014C mutation and resistance to deltamethrin, but not to DDT and permethrin resistance. The role of L1014C mutation on insecticide resistance should be further investigated by increasing the number of sample sites. It is not clear what caused the lack of kdr mutation in the Yunnan population. One interesting possibility is that the lack of gene flow between central China and the mountainous Yunnan Province prevents kdr mutation from being spread to the population in Yunnan. We are currently examining the An. sinensis population genetic structure in China to determine the role of gene flow on the spread of kdr mutation. The high level and multiple insecticide resistance of An. sinensis in China may result from prolonged and extensive use of insecticide for agricultural pest control and public health disease vector control. The detected insecticide residues of organophosphates (chlorpyrifos) in soil in Anhui site further suggest that insecticide residues in the larval environment of mosquitoes through agricultural pest control spray may be an important factor that selected for insecticide resistance. It is possible selection pressure from larval environment may be very strong as mosquito larvae are confined to the aquatic habitats with residual insecticides and constantly exposed to insecticides in the aquatic habitats. Adult mosquitoes are mobile and may exhibit behavioral avoidance to the insecticide [61], [62]. Whether selection pressure from larval exposure to insecticides favors metabolic resistance more than mutational target site resistance is an interesting question for future research. Resistance to multiple classes of insecticides is becoming a common problem in various disease vector species. Reported multiple resistance in mosquito vectors includes An. gambiae [47]-[49], [63], An. arabiensis [64], An. funestus [65], Culex quinquefasciatus [47], Aedes aegypti and Ae. albopictus [66] in Africa, and An. culicifacies, An. subpictus, An. nigerrimus, An. peditaeniatus [56] and Cx. quinquefasciatus [67], [68] in Asia, and Ae. Aegypti in South America [69]. Multiple insecticide resistance impedes the current front-line vector-borne disease control programs, which are primarily based on the use of pyrethroids. The present study suggests that long-term use of various classes of insecticides, in rotation or combination, will eventually select vector populations resistant to the major classes of insecticides. Our results have important implications for Anopheles and other mosquito vector control strategies. Organophosphate and carbamate insecticides may have limited applications in disease vector control, and rotation or combinational use with these insecticides may not be effective as the mosquito populations are already highly resistant. Adding appropriate synergists to the IRS formulation may help improve the effectiveness of the insecticides. Developing and implementing alternative efficient vector control methods that are not reliant on pyrethroids, organophosphate and carbamates—such as home improvement [70], odor-baited traps [71], larval resource reduction [72] and biological control [73], microbial insecticides and new classes of insecticides — presents an urgent challenge. Supporting Information Table S1 Relative importance value of variables used in the classification and regression trees (CART) analysis. Variable importance, for a particular predictor, is the sum, across all nodes, of the improvement scores that a predictor has when it acts as a splitter. The most important variable is expressed as 100%. (DOCX) Click here for additional data file. Table S2 Survey of insecticide usage in Anhui and Yunan study sites in China for agricultural pest and public health vector control. (DOC) Click here for additional data file. Table S3 Analysis of insecticide residues in water and soil samples in the Anhui study site. (DOC) Click here for additional data file.
