Zika virus (ZIKV) is a mosquito-transmitted virus in the family Flaviviridae and genus Flavivirus. It was initially isolated in 1947 from blood of a febrile sentinel rhesus monkey during a yellow fever study in the Zika forest of Uganda ( 1 ). The virus was subsequently isolated from a pool of Aedes africanus mosquitoes collected in 1948 from the same region of the Zika forest; a serologic survey conducted at that time showed that 6.1% of the residents in nearby regions of Uganda had specific antibodies to ZIKV ( 1 , 2 ). Over the next 20 years, several ZIKV isolates were obtained from Aedes spp. in Africa (Ae. africanus) and Malaysia (Ae. aegypti), implicating these species as likely epidemic or enzootic vectors ( 3 – 5 ). Several ZIKV human isolates were also obtained in the 1960s and 1970s from East and West Africa during routine arbovirus surveillance studies in the absence of epidemics ( 6 – 8 ). Additional serologic studies in the 1950s and 1960s detected ZIKV infections among humans in Egypt, Nigeria, Uganda, India, Malaysia, Indonesia, Pakistan, Thailand, North Vietnam, and the Philippines ( 5 ). These data strongly suggest widespread occurrence of ZIKV from Africa to Southeast Asia west and north of the Wallace line. In 1977, ZIKV infection was confirmed among 7 patients in central Java, Indonesia, during an acute fever study ( 9 ). Data on these 7 ZIKV cases and several previously reported human infections indicated that clinical characteristics of infection with ZIKV included fever, headache, malaise, stomach ache, dizziness, anorexia, and maculopapular rash; in all cases infection appeared relatively mild, self-limiting, and nonlethal ( 6 , 8 – 10 ). In April 2007, an epidemic of rash, conjunctivitis, and arthralgia was noted by physicians in Yap State, Federated States of Micronesia ( 11 ). Laboratory testing with a rapid assay suggested that a dengue virus (DENV) was the causative agent. In June 2007, samples were sent for confirmatory testing to the Arbovirus Diagnostic Laboratory at the Centers for Disease Control and Prevention (CDC, Fort Collins, CO, USA). Serologic testing by immunoglobulin (Ig) M–capture ELISA with DENV antigen confirmed recent flavivirus infection in several patients. Testing by reverse transcription–PCR (RT-PCR) with flavivirus consensus primers generated DNA fragments, which when subjected to nucleic acid sequencing, demonstrated ≈90% nucleotide identity with ZIKV. These findings indicated that ZIKV was the causative agent of the Yap epidemic. We report serologic parameters of the immune response among ZIKV-infected humans, data on estimated levels of viremia, and the complete coding region nucleic acid sequence of ZIKV associated with this epidemic. Methods Analysis of Patient Samples Details of the epidemic, including clinical and laboratory findings for all patients, will be reported elsewhere (M.R. Duffy et al., unpub. data). A subset of ZIKV-infected patients for whom acute- and convalescent-phase paired serum specimens had been collected was analyzed by using several serologic assays to evaluate the extent of cross-reactivity to several related flaviviruses. Patients were classified as primary flavivirus/ZIKV infected or secondary flavivirus/ZIKV probable infected. Primary flavivirus/ZIKV–infected patients were those in whom acute-phase serum specimens ( 1 heterologous flaviviruses in their acute-phase specimen and were also IgM positive for ZIKV in their acute-phase specimen, or IgM and IgG positive for ZIKV in their convalescent-phase specimen. The designation “ZIKV probable” was used because secondary flavivirus infections demonstrate extensive cross-reactivity with other flaviviruses, and in some cases, higher serologic reactivity to the original infecting flavivirus (“original antigenic sin” phenomenon). Thus, in secondary flavivirus infections shown in Tables 1 and 2, serologic data alone is insufficient to confirm ZIKV as the recently infecting flavivirus. However, these secondary flavivirus/ZIKV probable infections were likely recent ZIKV infections because ZIKV was the only virus detected during the epidemic in Yap, a relatively small and isolated island ( 11 ). Table 1 IgG and IgM testing with heterologous flaviviruses of patients infected with ZIKV, Yap State, Micronesia, 2007* Patient Days after onset IgG IgM ZIKV ZIKV DENV YFV JEV MVEV WNV Primary flavivirus ZIKV 822a 5 1.5 23.2 1.3 1.4 1.7 1.1 – 822b 10 1.2 39.5 1.2 1.0 2.4 1.2 – 822c 24 3.3 13.1 2.7 0.63 1.8 1.3 – 830a 2 1.1 1.3 4.4 0.48 4.4 2.9 – 830b 21 1.8 16.3 1.9 0.63 1.3 1.6 – 849a 3 1.5 4.5 0.92 0.95 1.2 0.66 – 849b 18 3.0 18.2 2.2 1.0 2.7 1.5 – 862a 6 1.9 25.4 1.7 1.1 1.8 1.0 – 862b 20 2.6 15.4 2 1.1 2.3 1.1 Eq Secondary flavivirus ZIKV (probable) 817a 1 5.9 1.4 1.7 0.8 1.7 0.7 – 817b 19 5.7 8.1 5.1 2.1 1.7 1.0 – 833a 1 3.4 1.7 3.7 1.0 2.8 1.3 – 833b 19 8.2 3.1 2.3 0.9 2.5 1.3 – 844a 2 3.8 3.8 6.8 2.0 21.5 0.7 – 844b 16 8.5 12.7 14.9 7.0 42.9 1.6 – 955a 1 5.0 1.8 3.7 1.0 3.4 2.4 Eq 955b 14 26.6 10.9 3.4 0.8 1.7 4.0 Eq 968a 1 4.0 1.7 1.3 0.6 1.2 1.2 – 968b 3 12.3 20.4 2.9 0.8 0.9 2.0 – 839a 3 1 0.92 3.4 0.7 2.7 2.1 – 839b 20 4.9 17.2 2.2 2.1 1.9 1.8 – 847a 5 0.9 0.94 4.1 4.1 2.3 1.3 – 847b 8 14.1 21.5 1.4 3.3 1.1 2.6 – *Ig, immunoglobulin; ZIKV, Zika virus; DENV, dengue virus type 1–4 mixture; YFV, yellow fever virus; JEV, Japanese encephalitis virus; MVEV, Murray Valley encephalitis virus; WNV, West Nile virus; –, negative. Eq, result in equivocal range of the assay. IgG and IgM testing was conducted by ELISA except for WNV, which was tested by microsphere assay; ELISA values are patient optical densities divided by negative control optical densities; 3 positive. Table 2 Neutralization testing with heterologous flaviviruses of patients infected with ZIKV, Yap State, Micronesia, 2007* Patient Days after onset PRNT90 titer ZIKV DENV1 DENV2 DENV3 DENV4 JEV YFV WNV SLEV MVEV Primary flavivirus ZIKV 822a 5 320 3 were considered positive, and values 2–3 were considered equivocal. Neutralizing antibody titers were determined by using a PRNT with a 90% cut-off value ( 15 ). Real-Time RT-PCR Two real-time primer/probe sets specific for the ZIKV 2007 strain were designed by using ZIKV 2007 nucleotide sequence data in the PrimerExpress software package (Applied Biosystems, Foster City, CA, USA). Primers were synthesized by Operon Biotechnologies (Huntsville, AL, USA) with 5-FAM as the reporter dye for the probe (Table 3). All real-time assays were performed by using the QuantiTect Probe RT-PCR Kit (QIAGEN, Valencia, CA, USA) with amplification in the iCycler instrument (Bio-Rad, Hercules, CA, USA) following the manufacturer’s protocol. Specificity of the ZIKV primers was evaluated by testing the following viral RNAs, all of which yielded negative results: DENV-1, DENV-2, DENV-3, DENV-4, WNV, St. Louis encephalitis virus, YFV, Powassan virus, Semliki Forest virus, o’nyong-nyong virus, chikungunya virus, and Spondweni virus (SPOV). Table 3 Description and performance characteristics of Zika virus real-time RT-PCR primer/probe sets* Primer Genome position† Sequence (5′ → 3′) Sensitivity, no. copies Specificity‡ ZIKV 835 835–857 TTGGTCATGATACTGCTGATTGC ZIKV 911c 911–890 CCTTCCACAAAGTCCCTATTGC 100 ZIKV ZIKV 860-FAM 860–886 CGGCATACAGCATCAGGTGCATAGGAG ZIKV 1086 1086–1102 CCGCTGCCCAACACAAG ZIKV 1162c 1162–1139 CCACTAACGTTCTTTTGCAGACAT 25 ZIKV ZIKV 1107-FAM 1107–1137 AGCCTACCTTGACAAGCAGTCAGACACTCAA *RT-PCR, reverse transcription–PCR; ZIKV, Zika virus.
†Based on ZIKV MR 766 GenBank accession no. AY632535.
‡ZIKV specificity indicates a positive result with ZIKV only and no reactivity with dengue virus-1 (DENV-1), DENV-2, DENV-3, DENV-4, West Nile virus, St. Louis encephalitis virus, yellow fever virus, Powassan virus, Semliki Forest virus, o’nyong-nyong virus, chikungunya virus, and Spondweni virus. Sensitivity of the ZIKV real-time assay was evaluated by testing dilutions of known copy numbers of an RNA transcript copy of the ZIKV 2007 sequence. Copy numbers of RNA were determined by using the Ribogreen RNA-specific Quantitiation Kit (Invitrogen) and the TBE-380 mini-fluorometer (Turner Biosystems, Sunnyvale, CA, USA). RNA transcripts ranging from 16,000 to 0.2 copies were tested in quadruplicate to determine the sensitivity limit and to construct a standard curve for estimating the genome copy number of ZIKV in patient samples. All serum samples obtained during the epidemic were tested for ZIKV RNA by using this newly designed real-time RT-PCR. Concentration of viral RNA (copies/milliliter) was estimated in ZIKV-positive patients by using the standard curve calculated by the iCycler instrument (Table 4). All RT-PCR–positive specimens were placed on monolayers of Vero, LLC-MK2, and C6/36 cells to isolate virus; no specimens showed virus replication. Table 4 Results of quantitative real-time RT-PCR of samples from ZIKV-positive patients, Yap State, Micronesia, 2007* Patient Days after onset ZIKV real-time RT-PCR Ct-860† Ct-1107† Result Estimated copies/mL‡ 824 1 34.3 34.7 + 11,647 939 2 32.0 32.4 + 67,817 947 2 34.3 33.9 + 21,495 949 2 35.1 35.1 + 8,573 969 1 29.4 29.3 + 728,800 037 1 32.1 32.5 + 62,816 830a 2 30.7 30.0 + 426,325 847a 5 34.8 34.7 + 11,647 950a 0 32.2 32.7 + 53,894 943 3 37.6 35.6 + 5,845 952 1 29.3 29.5 + 625,280 958 11 29.9 30.3 + 338,797 970 1 35.5 34.8 + 10,788 42 0 32.9 33.6 + 27,048 941 3 31.1 38.0 + 930 964 0 38.3 37.6 + 1,263 063a 2 37.5 38.0 + 930 *RT-PCR, reverse transcription–PCR; ZIKV, Zika virus; Ct, crossing threshold; +, positive.
†Ct values with primer set 835/911c/860-FAM or 1086/1162c/1107-FAM. Values 1 of the heterologous flaviviruses tested, and all demonstrated low levels of cross-reactive IgM as shown by a P/N value in the equivocal range. PRNT90 results showed that among secondary flavivirus/ZIKV–probable patients, the neutralizing antibody response was higher to ZIKV and more cross-reactive, a finding commonly observed among secondary flavivirus infections. A >4-fold PRNT90 titer between ZIKV and heterologous flaviviruses was observed in only 3 of the 7 patients. In all other cases, the PRNT difference between ZIKV and other flaviviruses tested was 38.5, which suggests either a false-positive result or a sample with low levels of ZIKV RNA below the defined cut-off of the assay. Table 4 shows estimated viral concentrations of the 17 ZIKV-positive specimens. The viral RNA concentrations were ≈900–729,000 copies/mL. Most (15 of 17) of the ZIKV-positive samples were from specimens collected 2 patients; in these overlap regions the sequence identity between different patients was ≈100%. Only 2-nt differences between patients were noted within the overlapping regions, strongly suggesting that 1 ZIKV strain circulated during the epidemic. Percentage identity over the entire coding region of ZIKV 2007 EC sequence, when compared with the prototype ZIKV (MR 766, isolated in 1947), was 88.9% and 96.5% at the nucleotide and amino acid levels, respectively. Phylogenetic trees constructed from the complete coding region of all available flaviviruses generated by a variety of methods (neighbor-joining, maximum-parsimony, or minimum-evolution) showed the same overall topology, with the ZIKV prototype and 2007 EC virus placed in a unique clade (clade 10) within the mosquito-borne flavivirus cluster previously described by Kuno et al. ( 16 ). Alignment with phylogenetic tree construction by neighbor-joining, maximum-parsimony, or minimum-evolution algorithms was also performed for the NS5 region of all available flaviviruses because extensive sequencing and phylogenetic analysis have been conducted for this region ( 16 ). Three additional ZIKV strains isolated from Senegal in 1984 and sequenced in this study were also included in a tree. This NS5 tree demonstrated similar topology to the complete coding region tree, with all ZIKVs placed within a unique clade (clade 10) along with SPOV. Figure 1 shows the NS5 tree with only mosquito-borne flaviviruses (cluster) displayed. This NS5 tree also shows that within the Zika/Spondweni clade there appear to be 3 branches among ZIKVs: Nigerian ZIKVs, prototype MR766, and 2007 Yap virus. Percentage identity among these ZIKVs confirms the tree topology, in which ZIKV 2007 EC is most distally related to East and West African ZIKV strains (data not shown). The predicted amino acid sequence of ZIKV 2007 EC contains the Asn-X-Ser/Thr glycosylation motif at position 154 in the envelope glycoprotein, found in many flaviviruses, yet absent by deletion in the prototype ZIKV MR 766. This region of the prototype virus, along with 3 ZIKVs isolated from Senegal in 1984, was sequenced (Figure 2). Included in this alignment is a ZIKV isolate from GenBank (accession no. AF372422). Sequencing confirmed that prototype ZIKV MR766 has a 4-aa (12-nt) deletion when compared with ZIKV 2007 EC virus and ZIKVs from Senegal. Figure 2 Alignment of nucleotide and amino acid sequences adjacent to the envelope (ENV)–154 glycosylation site of Zika virus strains. Dashes indicate deletions. EC, epidemic consensus. Discussion Historically, ZIKV has rarely been associated with human disease, with only 1 small cluster of human cases in Indonesia reported ( 9 ). We report a widespread epidemic of human disease associated with ZIKV in Yap State in 2007. ZIKV epidemics may have occurred but been misdiagnosed as dengue because of similar clinical symptoms and serologic cross-reactivity with DENVs. Our serologic data indicate that ZIKV-infected patients can be positive in an IgM assay for DENVs, particularly if ZIKV is a secondary flavivirus infection. If ZIKV is the first flavivirus encountered, our data indicate that cross-reactivity is minimal. However, when ZIKV infection occurs after a flavivirus infection, our data indicate that the extent of cross-reactivity in the IgM assay is greater. Therefore, if ZIKV infections occur in a population with DENV (or other flavivirus) background immunity, our data suggest that extensive cross-reactivity in the dengue IgM assay will occur, which could lead to the erroneous conclusion that dengue caused the epidemic. Whether this cross-reactivity has occurred is open to speculation. However, reexamination of specimens from dengue epidemics may provide an answer. In addition, use of virus isolation or RT-PCR for laboratory diagnosis of dengue infections would also prevent this misinterpretation. Therefore, use of virus detection assays in dengue epidemics should be a component of laboratory testing algorithms. Levels of viremia among ZIKV-infected patients were relatively low. Unfortunately, measurement of concentration of infectious ZIKV was not possible because a virus isolate was not obtained from any patient during the epidemic. Absence of a ZIKV 2007 isolate also precluded use of a ZIKV 2007 isolate to generate a standard curve in the RT-PCR, which in turn could have estimated the concentration of infectious virus within patients. An estimation of the number of genome copies circulating in ZIKV-infected patients was calculated by using an RNA transcript and provides some indication of infectious virus concentration in ZIKV-infected patients. If one assumes a ratio range of 200–500 genome copies per infectious virus particle, a range reported for several flaviviruses, then the copies/milliliter values in Table 4 would be in the range of ≈2–3,500 infectious virus particles/mL, with only 4 specimens in which ZIKV exceeded 1,000 infectious units/mL ( 18 , 19 ). These findings may partially explain why ZIKV was not isolated, especially if one considers that shipping samples to our laboratory took ≈1 week, and shipping conditions were not conducive to virus isolation. These concentration estimates are also consistent with those of a study in which a ZIKV-infected human volunteer showed low viremia; virus was isolated only on day 4, and the volunteer was unable to infect Ae. aegypti mosquitoes that fed on the patient during the acute stage of disease ( 10 ). Although generation of a complete coding region nucleic acid sequence by using a combination of patient samples from the epidemic is an unconventional approach, it was performed out of necessity because of limited volumes of patient samples. However, the extent of agreement among overlapping regions confirms that the sequence obtained accurately represents the virus associated with the epidemic. Nucleic acid sequence of ZIKV 2007 showed divergence (11%) from the prototype strain (MR766) isolated in 1947. However, the predicted amino acid sequence is fairly conserved (96%), which is likely the result of the selective pressure maintained on the virus because replication occurs in vertebrate hosts and arthropod vectors. Phylogenetic trees based on the complete coding region or the NS5 region confirm results of a study in which ZIKV was classified in a unique clade among the mosquito-borne flaviviruses and most closely related to SPOV ( 16 ). The NS5 mosquito-borne flavivirus tree (Figure 1), which includes additional ZIKV isolates, confirms these relationships and suggests that there are 3 subclades among ZIKV isolates that reflect geographic origin. Senegal ZIKVs and prototype virus from Uganda may represent West and East African lineages, respectively. The 2007 ZIKV is distantly related to these 2 African subclades and may represent divergence from a common ancestor with spread throughout Southeast Asia and the Pacific. Human ZIKV cases were detected in peninsular Malaysia in 1980, which confirms that ZIKV was active in this region before 2007 ( 9 ). Additional sequence analysis of other temporally and geographically distinct ZIKV strains is needed to further elucidate relationships among these viruses. Of particular interest is an additional 12 nt in the envelope gene (corresponding to 4 aa) in our ZIKV isolate that were not present in the ZIKV prototype virus (Figure 2). This difference is noteworthy because these 4 aa correspond to the envelope protein 154 glycosylation motif found in many flaviviruses and associated in some instances with virulence. This glycosylation motif is also absent because of a 6-aa deletion in the ZIKV isolate obtained from GenBank (accession no. AF372422); however, the geographic and temporal origins of this virus were not available. Loss of the envelope protein 154 glycoslyation site has been observed in some flaviviruses, and in the case of Kunjin virus has been shown to occur during passage. However, with Kunjin virus, the glycosylation site motif was lost because of a 1-base mutation, rather than a deletion, that altered the N-X-S/T sequon ( 20 ). Loss of this glycosylation site by a 4-aa deletion has also been observed in several lineage-2 WNV strains when compared with all other WNV strains ( 21 ). The glycoslyation motif in WNV may be lost during extensive mouse brain passage; however, no direct evidence exists to support this hypothesis ( 21 ). This process may occur in ZIKV; the glycoslyation motif in MR 766 may have been present in earlier passages of prototype MR766 and lost during extensive mouse brain passage. However, earlier passage strains of MR766 were not available for investigating this hypothesis. Alternatively, the presence or absence of this glycosylation motif may represent an ancient evolutionary event with subsequent divergence of 2 ZIKV types with or without the E-154 glycosylation site amino acids. Sequence data derived from 3 additional ZIKV isolates from Senegal showed that glycosylation is intact in these isolates, which suggests evolutionary divergence. More extensive sequence analysis of available ZIKV strains of various temporal, geographic, and passage histories may provide some insight into this issue.
