- Record: found
- Abstract: found
- Article: found
Mechanistic insights into the effect of humidity on airborne influenza virus survival, transmission and incidence
review-article
Publication date (Electronic):
16 January 2019
Publisher:
The Royal Society
Read this article at
There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.
Abstract
Influenza incidence and seasonality, along with virus survival and transmission, appear to depend at least partly on humidity, and recent studies have suggested that absolute humidity (AH) is more important than relative humidity (RH) in modulating observed patterns. In this perspective article, we re-evaluate studies of influenza virus survival in aerosols, transmission in animal models and influenza incidence to show that the combination of temperature and RH is equally valid as AH as a predictor. Collinearity must be considered, as higher levels of AH are only possible at higher temperatures, where it is well established that virus decay is more rapid. In studies of incidence that employ meteorological data, outdoor AH may be serving as a proxy for indoor RH in temperate regions during the wintertime heating season. Finally, we present a mechanistic explanation based on droplet evaporation and its impact on droplet physics and chemistry for why RH is more likely than AH to modulate virus survival and transmission.
Related collections
Most cited references61
- Record: found
- Abstract: found
- Article: not found
The National Human Activity Pattern Survey (NHAPS): a resource for assessing exposure to environmental pollutants.
N E Klepeis, W C Nelson, W R Ott … (2001)
Because human activities impact the timing, location, and degree of pollutant exposure, they play a key role in explaining exposure variation. This fact has motivated the collection of activity pattern data for their specific use in exposure assessments. The largest of these recent efforts is the National Human Activity Pattern Survey (NHAPS), a 2-year probability-based telephone survey (n=9386) of exposure-related human activities in the United States (U.S.) sponsored by the U.S. Environmental Protection Agency (EPA). The primary purpose of NHAPS was to provide comprehensive and current exposure information over broad geographical and temporal scales, particularly for use in probabilistic population exposure models. NHAPS was conducted on a virtually daily basis from late September 1992 through September 1994 by the University of Maryland's Survey Research Center using a computer-assisted telephone interview instrument (CATI) to collect 24-h retrospective diaries and answers to a number of personal and exposure-related questions from each respondent. The resulting diary records contain beginning and ending times for each distinct combination of location and activity occurring on the diary day (i.e., each microenvironment). Between 340 and 1713 respondents of all ages were interviewed in each of the 10 EPA regions across the 48 contiguous states. Interviews were completed in 63% of the households contacted. NHAPS respondents reported spending an average of 87% of their time in enclosed buildings and about 6% of their time in enclosed vehicles. These proportions are fairly constant across the various regions of the U.S. and Canada and for the California population between the late 1980s, when the California Air Resources Board (CARB) sponsored a state-wide activity pattern study, and the mid-1990s, when NHAPS was conducted. However, the number of people exposed to environmental tobacco smoke (ETS) in California seems to have decreased over the same time period, where exposure is determined by the reported time spent with a smoker. In both California and the entire nation, the most time spent exposed to ETS was reported to take place in residential locations.
- Record: found
- Abstract: found
- Article: not found
Influenza Virus Transmission Is Dependent on Relative Humidity and Temperature
Anice C. Lowen, Samira Mubareka, John Steel … (2007)
Introduction Influenza A virus, of the family Orthomyxoviridae, carries an RNA genome consisting of eight segments of negative-stranded RNA. This genome encodes one or two non-structural proteins and nine structural proteins, which, together with a host cell–derived lipid envelope, comprise the influenza virus particle. Influenza virus causes widespread morbidity and mortality among human populations worldwide: in the United States alone, an average of 41,400 deaths and 1.68 million hospitalizations [1] are attributed to influenza each year. In temperate regions like the United States, this impact is felt predominantly during the winter months; that is, epidemics recur with a highly predictable seasonal pattern. In northern latitudes, influenza viruses circulate from November to March, while in the southern hemisphere influenza occurs primarily from May to September [2]. Tropical regions, by contrast, experience influenza throughout the year, although increased incidence has been correlated with rainy seasons [2,3]. Despite extensive documentation of the seasonal cycles of influenza and curiosity as to their causes, little concrete data is available to indicate why influenza virus infections peak in the wintertime. Theories to explain the seasonal variation of influenza have therefore proliferated over the years (reviewed in [4]). Current hypotheses include fluctuations in host immune competence mediated by seasonal factors such as melatonin [5] and vitamin D [6] levels; seasonal changes in host behavior, such as school attendance, air travel [7], and indoor crowding during cold or rainy weather; and environmental factors, including temperature [8], relative humidity (RH), and the direction of air movement in the upper atmosphere [9]. In early studies using mouse-adapted strains of influenza virus, experiments performed in the winter months yielded a transmission rate of 58.2%; in contrast, a rate of only 34.1% was observed in the summer months [10]. While these data suggested that the seasonal influences acting on humans also affect laboratory mice, no mechanism to explain the observations was identified. Herein, we directly tested the hypotheses that ambient air temperature and RH impact the efficiency with which influenza virus is spread. As a mammalian animal model we used Hartley strain guinea pigs, which we have recently shown to be highly susceptible to infection with human influenza viruses [11]. Importantly, we also found that naïve guinea pigs readily become infected when exposed to inoculated guinea pigs, unlike mice, which do not efficiently transmit influenza virus [11]. Thus, by housing infected and naïve guinea pigs together in an environmental chamber, we were able to assess the efficiency of transmission under conditions of controlled RH and temperature. Our data show that both RH and temperature do indeed affect the frequency of influenza virus transmission among guinea pigs, although via apparently differing mechanisms. Results Twenty replicate experiments were performed in which all factors remained constant except for the RH and/or temperature inside the environmental chamber. Each experiment involved eight guinea pigs, and transmission under each set of conditions was assessed in duplicate. The arrangement of animals in the environmental chamber is illustrated in Figure 1. Virus contained in nasal wash samples collected on alternating days post-inoculation (p.i.) was titrated by plaque assay to determine the infection status of each animal. Serum samples were collected from each animal prior to infection and on day 17 p.i., and seroconversion was assessed by hemagglutination inhibition assay (results in Table S1). Figure 1 Arrangement of Infected and Exposed Guinea Pigs in Environmental Chamber In each experiment, eight animals were housed in a Caron 6030 environmental chamber. Each guinea pig was placed in its own cage, and two cages were positioned on each shelf. Naïve animals were placed behind infected animals, such that the direction of airflow was toward the naïve animals. The cages used were open to airflow through the top and one side, both of which were covered by wire mesh. Although infected and exposed guinea pigs were placed in pairs, air flowed freely between shelves, allowing transmission to occur from any infected to any naïve animal. In general, the behavior (level of activity, food and water consumption, symptoms of infection) of guinea pigs was not observed to change with the ambient relative humidity. Likewise, animals housed at 5 °C behaved in a similar manner to those housed at 20 °C. Guinea pigs kept at 30 °C consumed more water than those housed under cooler conditions, and appeared lethargic. Consistent with our previous observations [11], influenza virus–infected guinea pigs did not display detectable symptoms of disease (e.g., weight loss, fever, sneezing, coughing) during the experiments described. Transmission Efficiency Is Dependent on Relative Humidity The results of transmission experiments performed at 20 °C and five different RHs (20%, 35%, 50%, 65%, and 80%) indicated that the efficiency of aerosol spread of influenza virus varied with RH. Transmission was highly efficient (occurred to three or four of four exposed guinea pigs) at low RH values of 20% or 35%. At an intermediate RH of 50%, however, only one of four naïve animals contracted infection. Three of four exposed guinea pigs were infected at 65% RH, while no transmission was observed at a high RH of 80% (Figure 2). Where transmission was observed, the kinetics with which infection was detected in each exposed animal varied between and within experiments. To an extent, we believe this variation is due to the stochastic nature of infection. However, while most infection events were the product of primary transmission from an inoculated animal, others could be the result of secondary transmission from a previously infected, exposed guinea pig. With the exception of the lack of transmission at 80% RH, the observed relationship between transmission and RH is similar to that between influenza virus stability in an aerosol and RH [12], suggesting that at 20 °C the sensitivity of transmission to humidity is due largely to virus stability. Figure 2 Transmission of Influenza Virus from Guinea Pig to Guinea Pig Is Dependent on Relative Humidity Titers of influenza virus in nasal wash samples are plotted as a function of day p.i. Overall transmission rate and the RH and temperature conditions of each experiment are stated underneath the graph. Titers from intranasally inoculated guinea pigs are represented as dashed lines; titers from exposed guinea pigs are shown with solid lines. Virus titrations were performed by plaque assay on Madin Darby canine kidney cells. Transmission Efficiency Is Inversely Correlated with Temperature To test whether cold temperatures would increase transmission, the ambient temperature in the chamber was lowered to 5 °C and experiments were performed at 35%–80% RH. Overall, transmission was more efficient at 5 °C: 75%–100% transmission occurred at 35% and 50% RH, and 50% transmission was observed at 65% and 80% RH (Figure 3A–3H). The statistical significance of differences in transmission rates at 5 °C compared to 20 °C was assessed using the Fisher's exact test. While at 35% and 65% RH the difference was not found to be significant, at both 50% and 80% RH, transmissibility at 5 °C was found to be greater than that at 20 °C (p 20 °C) and either intermediate (50%) or high (80%) RHs. Materials and Methods Virus. Influenza A/Panama/2007/99 virus (Pan/99; H3N2) was kindly supplied by Adolfo García-Sastre and was propagated in Madin Darby canine kidney cells. Animals. Female Hartley strain guinea pigs weighing 300–350 g were obtained from Charles River Laboratories. Animals were allowed free access to food and water and kept on a 12-h light/dark cycle. Guinea pigs were anesthetized for the collection of blood and of nasal wash samples, using a mixture of ketamine (30 mg/kg) and xylazine (2 mg/kg), administered intramuscularly. All procedures were performed in accordance with the Institutional Animal Care and Used Committee guidelines. During guinea pig transmission experiments, strict measures were followed to prevent aberrant cross-contamination between cages: sentinel animals were handled before inoculated animals, gloves were changed between cages, and work surfaces were sanitized between guinea pigs. Transmission experiments. The term “aerosol” is used herein to describe respiratory droplets of all sizes. The term “droplet nuclei” is used to refer to droplets that remain airborne (typically less than 5 μm in diameter). Each transmission experiment involved eight guinea pigs. On day 0, four of the eight guinea pigs were inoculated intranasally with 103 PFU of influenza A/Panama/2007/99 virus (150 μl per nostril in phosphate buffered saline [PBS] supplemented with 0.3% bovine serum albumin [BSA]) and housed in a separate room from the remaining animals. At 24 h p.i., each of the eight guinea pigs was placed in a “transmission cage”, a standard rat cage (Ancare R20 series) with an open wire top, which has been modified by replacing one side panel with a wire grid. The transmission cages were then placed into the environmental chamber (Caron model 6030) with two cages per shelf, such that the wire grids opposed each other (Figure 1). In this arrangement, the guinea pigs cannot come into physical contact with each other. Each infected animal was paired on a shelf with a naïve animal. The guinea pigs were housed in this way for 7 d, after which they were removed from the chamber and separated. On day 2 p.i. (day 1 post-exposure) and every second day thereafter up to day 12 p.i., nasal wash samples were collected from anesthetized guinea pigs by instilling 1 ml of PBS-BSA into the nostrils and collecting the wash in a Petri dish. Titers in nasal wash samples were determined by plaque assay of 10-fold serial dilutions on Madin Darby canine kidney cells. Serum samples were collected from each animal prior to infection and on day 17 post-infection, and seroconversion was assessed by hemagglutination inhibition assay. All transmission experiments reported herein were performed between September 2006 and April 2007. Analysis of expression levels of mediators of innate immunity. Guinea pigs were inoculated with 103 PFU of Pan/99 virus intranasally and immediately housed under the appropriate conditions (5 °C or 20 °C and 35% RH). At days 1, 2, 3, 5, and 7 post-infection, three guinea pigs were killed and their nasal turbinates removed. Tissues were placed immediately in RNAlater reagent (Qiagen), and stored at 4 °C for 1 to 5 d. RNA was extracted from equivalent masses of tissue using the RNAeasy Protect Mini kit (Qiagen) and subjected to DNAse treatment (Qiagen). One microgram of RNA was subjected to reverse transcription using MMLV reverse transcriptase (Roche). One microlitre of the resultant product was used as the template in a SYBR green (Invitrogen) real-time PCR assay (Roche Light Cycler 480) with Ampli-taq Gold polymerase (Perkin-Elmer). Primers used were as follows: β-actin f AAACTGGAACGGTGAAGGTG; β-actin r CTTCCTCTGTGGAGGAGTGG; Mx1 f CATCCCYTTGrTCATCCAGT; Mx1 r CATCCCyTTGRTCATCCAGT; MDA-5 f GAGCCAGAGCTGATGARAGC; MDA-5 r TCTTATGWGCATACTCCTCTGG; IL-1β f GAAGAAGAGCCCATCGTCTG; IL-1β r CATGGGTCAGACAACACCAG; RANTES f GCAATGCTAGCAGCTTCTCC; RANTES r TTGCCTTGAAAGATGTGCTG; TLR3 f TAACCACGCACTCTGTTTGC; TLR3 r ACAGTATTGCGGGATCCAAG; TNFα f TTCCGGGCAGATCTACTTTG; TNFα r TGAACCAGGAGAAGGTGAGG; MCP-1 f ATTGCCAAACTGGACCAGAG; MCP-1 r CTACGGTTCTTGGGGTCTTG; MCP-3 f TCATTGCAGTCCTTCTGTGC; MCP-3 r TAGTCTCTGCACCCGAATCC; IFNγ f GACCTGAGCAAGACCCTGAG; IFNγ r TGGCTCAGAATGCAGAGATG; STAT1 f AAGGGGCCATCACATTCAC; STAT1 r GCTTCCTTTGGCCTGGAG; TBK1 f CAAGAAACTyTGCCwCAGAAA; TBK1 r AGGCCACCATCCAykGTTA; IRF5 f CAAACCCCGaGAGAAGAAG; IRF5 r CTGCTGGGACtGCCAGA; IRF7 f TGCAAGGTGTACTGGGAGGT; IRF7 r TCACCAGGATCAGGGTCTTC (where R = A or G, Y = C or T, W = A or T, K = T or G). Primer sequences were based either on guinea pig mRNA sequences available in GenBank (MCP1, MCP3, IL-1b, IFNγ, RANTES, TLR3, TNFα, and β-actin), or on the consensus sequence of all species available in GenBank (Mx1, MDA-5, IRF5, IRF7, STAT1, and TBK1). Sequencing of each PCR product indicated that all primer pairs were specific for the expected transcript. Reactions were performed in duplicate and normalized by dividing the mean value of the cycle threshold (Ct) of β-actin expressed as an exponent of 2 (2Ct) by the mean value of 2Ct for the target gene. The fold-induction over the mock-infected was then calculated by dividing the normalized value by the normalized mock value. Data is represented in Figure 5 as the mean of three like samples (nasal turbinates harvested on the same day p.i. from three guinea pigs) ± standard deviation. Statistical analyses. Statistical analyses were performed using GraphPad Prism 5 software. Supporting Information Table S1 Seroconversion of Inoculated and Exposed Guinea Pigs Results of hemagglutination inhibition tests for each transmission experiment are shown. (58 KB DOC) Click here for additional data file. Accession Numbers The GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html) accession numbers of guinea pig genes used for primer design are as follows: β-actin (AF508792.1); IFNγ (AY151287.1); IL-1β (AF119622); MCP-1 (L04985); MCP-3 (AB014340); RANTES (CPU77037); TLR3 (DQ415679.1); and TNFα (CPU77036).
- Record: found
- Abstract: found
- Article: found
Review of Aerosol Transmission of Influenza A Virus
Raymond Tellier (2006)
Concerns about the likely occurrence of an influenza pandemic in the near future are increasing. The highly pathogenic strains of influenza A (H5N1) virus circulating in Asia, Europe, and Africa have become the most feared candidates for giving rise to a pandemic strain. Several authors have stated that large-droplet transmission is the predominant mode by which influenza virus infection is acquired ( 1 – 3 ). As a consequence of this opinion, protection against infectious aerosols is often ignored for influenza, including in the context of influenza pandemic preparedness. For example, the Canadian Pandemic Influenza Plan and the US Department of Health and Human Services Pandemic Influenza Plan ( 4 , 5 ) recommend surgical masks, not N95 respirators, as part of personal protective equipment (PPE) for routine patient care. This position contradicts the knowledge on influenza virus transmission accumulated in the past several decades. Indeed, the relevant chapters of many reference books, written by recognized authorities, refer to aerosols as an important mode of transmission for influenza ( 6 – 9 ). In preparation for a possible pandemic caused by a highly lethal virus such as influenza A (H5N1), making the assumption that the role of aerosols in transmission of this virus will be similar to their role in the transmission of known human influenza viruses would seem rational. Because infection with influenza A (H5N1) virus is associated with high death rates and because healthcare workers cannot as yet be protected by vaccination, recommending an enhanced level of protection, including the use of N95 respirators as part of PPE, is important. Following are a brief review of the relevant published findings that support the importance of aerosol transmission of influenza and a brief discussion on the implications of these findings on pandemic preparedness. Influenza Virus Aerosols By definition, aerosols are suspensions in air (or in a gas) of solid or liquid particles, small enough that they remain airborne for prolonged periods because of their low settling velocity. For spherical particles of unit density, settling times (for a 3-m fall) for specific diameters are 10 s for 100 μm, 4 min for 20 μm, 17 min for 10 μm, and 62 min for 5 μm; particles with a diameter 6-μm diameter are trapped increasingly in the upper respiratory tract ( 12 ); no substantial deposition in the lower respiratory tract occurs at >20 μm ( 11 , 12 ). Many authors adopt a size cutoff of 10–20 μm will settle rapidly, will not be deposited in the lower respiratory tract, and are referred to as large droplets ( 10 – 12 ). Coughing or sneezing generates a substantial quantity of particles, a large number of which are 40%. The increased survival of influenza virus in aerosols at low relative humidity has been suggested as a factor that accounts for the seasonality of influenza ( 15 , 16 ). The sharply increased decay of infectivity at high humidity has also been observed for other enveloped viruses (e.g., measles virus); in contrast, exactly the opposite relationship has been shown for some nonenveloped viruses (e.g., poliovirus) ( 11 , 15 , 16 ). Experimental Influenza Infection Experimental infection studies permit the clear separation of the aerosol route of transmission from transmission by large droplets. Laboratory preparation of homogeneous small particle aerosols free of large droplets is readily achieved ( 13 , 18 ). Conversely, transmission by large droplets without accompanying aerosols can be achieved by intranasal drop inoculation ( 13 ). Influenza infection has been documented by aerosol exposure in the mouse model, the squirrel monkey model, and human volunteers ( 12 , 13 , 17 – 19 ). Observations made during experimental infections with human volunteers are particularly interesting and relevant. In studies conducted by Alford and colleagues ( 18 ), volunteers were exposed to carefully titrated aerosolized influenza virus suspensions by inhaling 10 L of aerosol through a face mask. The diameter of the aerosol particles was 1 μm–3 μm. Demonstration of infection in participants in the study was achieved by recovery of infectious viruses from throat swabs, taken daily, or by seroconversion, i.e., development of neutralizing antibodies. The use of carefully titrated viral stocks enabled the determination of the minimal infectious dose by aerosol inoculation. For volunteers who lacked detectable neutralizing antibodies at the onset, the 50% human infectious dose (HID50) was 0.6–3.0 TCID50, if one assumes a retention of 60% of the inhaled particles (18). In contrast, the HID50 measured when inoculation was performed by intranasal drops was 127–320 TCID50 ( 13 ). Additional data from experiments conducted with aerosolized influenza virus (average diameter 1.5 μm) showed that when a dose of 3 TCID50 was inhaled, ≈1 TCID50 only was deposited in the nose ( 12 ). Since the dose deposited in the nose is largely below the minimal dose required by intranasal inoculation, this would indicate that the preferred site of infection initiation during aerosol inoculation is the lower respiratory tract. Another relevant observation is that whereas the clinical symptoms initiated by aerosol inoculation covered the spectrum of symptoms seen in natural infections, the disease observed in study participants infected experimentally by intranasal drops was milder, with a longer incubation time and usually no involvement of the lower respiratory tract ( 13 , 20 ). For safety reasons, this finding led to the adoption of intranasal drop inoculation as the standard procedure in human experimental infections with influenza virus ( 13 ). Additional support for the view that the lower respiratory tract (which is most efficiently reached by the aerosol route) is the preferred site of infection is provided by studies on the use of zanamivir for prophylaxis. In experimental settings, intranasal zanamivir was protective against experimental inoculation with influenza virus in intranasal drops ( 21 ). However, in studies on prophylaxis of natural infection, intranasally applied zanamivir was not protective ( 22 ), whereas inhaled zanamivir was protective in one study ( 23 ) and a protective effect approached statistical significance in another study ( 22 ). These experiments and observations strongly support the view that many, possibly most, natural influenza infections occur by the aerosol route and that the lower respiratory tract may be the preferred site of initiation of the infection. Epidemiologic Observations In natural infections, the postulated modes of transmission have included aerosols, large droplets, and direct contact with secretions or fomites because the virus can remain infectious on nonporous dry surfaces for >(January 2006) recommends FFP2 respirators (equivalent to N95 respirators) (http://www.splf.org/s/IMG/pdf/plan-grip-janvier06.pdf). Given the scientific evidence that supports the occurrence of aerosol transmission of influenza, carefully reexamining current recommendations for PPE equipment would appear necessary.
Author and article information
Journal
Journal ID (nlm-ta): J R Soc Interface
Journal ID (iso-abbrev): J R Soc Interface
Journal ID (publisher-id): RSIF
Journal ID (hwp): royinterface
Title:
Journal of the Royal Society Interface
Publisher:
The Royal Society
ISSN
(Print):
1742-5689
ISSN
(Electronic):
1742-5662
Publication date
(Print):
January
2019
Publication date
(Electronic):
16
January
2019
Publication date PMC-release: 16
January
2019
Volume: 16
Issue: 150
Electronic Location Identifier: 20180298
Affiliations
Author notes
e-mail:
lmarr@
123456vt.edu
Electronic supplementary material is available online at https://dx.doi.org/10.6084/m9.figshare.c.4351247.
Author information
Linsey C. Marr
http://orcid.org/0000-0003-3628-6891
Article
Publisher ID: rsif20180298DOI: 10.1098/rsif.2018.0298
PMC ID: 6364647
PubMed ID: 30958176
SO-VID: 738713a7-554e-4b32-abe1-004abbab0446
Copyright © © 2019 The Authors.
License:
Published by the Royal Society under the terms of the Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, which permits unrestricted use, provided the original author and source are credited.
History
Date
received
: 2
May
2018
Date
accepted
: 20
December
2018
Funding
Funded by: Division of Chemical, Bioengineering, Environmental, and Transport Systems, http://dx.doi.org/10.13039/100000146;
Award ID: 1438103
Funded by: NIH Office of the Director, http://dx.doi.org/10.13039/100000052;
Award ID: 1-DP2-A1112243
Categories
Subject:
1004
Subject:
27
Subject:
Review Articles
Subject:
Review Article
Custom metadata
cover-date January, 2019
ScienceOpen disciplines: Life sciences