5
views
0
recommends
+1 Recommend
0 collections
    0
    shares
      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      Evaluation of Human Exposure to Aedes Bites in Rubber and Palm Cultivations Using an Immunoepidemiological Biomarker

      research-article

      Read this article at

      Bookmark
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          Arbovirus infections, mainly transmitted by Aedes mosquito, are emerging in Africa. Efficient vector control requires an understanding of ecological factors which could impact on the risk of transmission, such as environmental changes linked to agricultural practices. The present study aims to assess the level of human exposure to Aedes mosquito bites in different agroecosystem area, using an immunological tool which quantifies human IgG antibody response to one Ae. aegypti salivary peptide. Specific IgG responses were assessed during dry and rainy seasons, in children living in different villages in Côte d'Ivoire: N'Zikro (rubber and oil palm exploitations), Ehania-V5 (oil palm), and Ayébo (without intensive agricultural activities). In the dry season, specific IgG levels were significantly lower in Ayébo compared to Ehania-V5 and N'Zikro and, interestingly, were similarly high in both villages with cultivations. In the rainy season, no difference of specific IgG was observed between villages. Specific IgG responses remained therefore high during both seasons in villages associated with intensive agricultural. The rubber and oil palm cultivations could maintain a high level of human exposure to Aedes mosquito bites during both dry and rainy seasons. These agricultural activities could represent a permanent risk factor of the transmission of arboviruses.

          Related collections

          Most cited references33

          • Record: found
          • Abstract: found
          • Article: found
          Is Open Access

          Zika Virus in Gabon (Central Africa) – 2007: A New Threat from Aedes albopictus?

          Introduction Zika virus (ZIKV) is a mosquito-borne flavivirus phylogenetically related to dengue viruses. Following its first isolation in 1947 from a sentinel monkey placed in the Zika forest in Uganda [1], serological surveys and viral isolations (reviewed in [2]) suggested that ZIKV (i) ranged widely throughout Africa and Asia, and (ii) circulated according to a zoonotic cycle involving non-human primates and a broad spectrum of potential mosquito vector species. In Africa, ZIKV has been isolated from humans in western and central countries such as Senegal, Nigeria, Central African Republic and Uganda [3]–[7]. Serological surveys (reviewed in [2]) suggested that its geographic range might extend not only to other West and Central African countries (Sierra Leone, Cameroon, Gabon), but also to eastern (Ethiopia, Kenya, Tanzania and Somalia) and northern Africa (Egypt). ZIKV has also been isolated from mosquitoes collected in Senegal, Ivory Coast, Burkina Faso, Central African Republic and Uganda [1], [6], [8], [9]. These mosquitoes mainly belonged to sylvan or rural species of the genus Aedes, and more precisely to the Aedimorphus, Diceromyia and Stegomyia subgenera. The virus has also been isolated in West Africa (Burkina Faso, Senegal and Ivory Coast) [6], [9] and Asia [10] from Aedes aegypti, a species being considered the main ZIKV epidemic vector outside Africa [11]. Moreover, Ae. aegypti was shown experimentally to be an efficient ZIKV vector [12]–[14]. Despite its apparent broad geographic distribution in Africa and Asia, only sporadic cases of human ZIKV infection have been reported. This virus received little attention until its sudden emergence in Yap Island (Micronesia) in 2007, which involved about 5000 persons [15], [16], revealing its epidemic capacity. Patients develop a mild dengue-like syndrome, including fever, headache, rash, arthralgia and conjunctivitis. This clinical similarity with other, more commonly diagnosed arboviral infections such as chikungunya (CHIKV) and dengue (DENV), might delay the diagnosis and/or lead to underestimation of ZIKV infections. Here, we report the first direct evidence of ZIKV epidemic activity in Central Africa, and its occurrence in an urban environment during concomitant CHIKV/DENV outbreaks in Libreville, the capital of Gabon, in 2007. We also report the first detection of ZIKV in the Asian tiger mosquito, Ae. albopictus. These findings, together with the global geographic expansion of this invasive species and its increasing importance as epidemic vector of arboviruses as exemplified by CHIKV adaptation, suggest that the prerequisites for the emergence and global spread of Zika virus may soon be satisfied. Materials and Methods Study In 2007 and 2010, Gabon recorded simultaneous outbreaks of CHIKV (genus Alphavirus) and DENV (genus Flavivirus) infections. The 2007 outbreaks primarily affected Libreville, the capital of Gabon, and subsequently extended northwards to several other towns [17], while the 2010 outbreaks occurred in the south-eastern provinces [18]. To detect other circulating arboviruses, we conducted a retrospective study based on molecular screening of 4312 sera from symptomatic patients presenting to healthcare centers; 24.7% of the samples were obtained during the 2007 outbreaks, 9.7% during the inter-epidemic period, and 65.5% during the 2010 outbreaks (data not shown). We also analyzed a collection of 4665 mosquitoes captured during the same period and split into 247 pools according to the species, date and sampling site (Table 1, see [18] and [19] for the details of the methodology used for mosquito trapping). 10.1371/journal.pntd.0002681.t001 Table 1 Mosquito collections screened for Zika virus. Libreville 2007 Franceville 2010 Total Species Pools Mos. Id. (No.) ZIKV CHIKV DENV Libreville suburb Pools Mos. Pools (%) Mos. Aedes albopictus 91 2130 T64 (21) + + − Nzeng-Ayong 46 571 137 (55.4) 2701 T713 (25) + + − Alenkiri T707 (25) − − + Alenkiri T717 (25) − − + Alenkiri T723 (25) − − + Alenkiri T724 (6) − + − Alenkiri T21 (25) − + − Avorembam T22 (25) − + − Avorembam T280 (1) − + − Bel-Air Aedes aegypti * 40 853 5 28 45 (18.2) 881 Aedes simpsoni complex 10 52 5 36 15 (6.1) 88 Anopheles gambiae * 8 72 8 (3.2) 72 Mansonia africana 6 86 6 (2.4) 86 Mansonia uniformis * 4 99 4 (1.6) 99 Culex quinquefasciatus 29 690 29 (11.7) 690 Culex spp. 1 22 1 (0.4) 22 Eretmapodites quinquevittatus * 2 26 2 (0.8) 26 Total 189 4004 58 661 247 4665 * Species in which Zika virus has previously been detected. (%) The percentage of each mosquito species in the collection is indicated in brackets. Mos.: Number of mosquitoes included in a pool. Id. (No.): Mosquito pool positive for ZIKV, CHIKV or DENV, followed by the total number of included mosquitoes in the pool indicated in brackets. Ethics statement The Centre International de Recherches Médicales de Franceville (CIRMF) and the Gabonese Ministry of Health cooperated in the 2007 and 2010 outbreak response and management, that included blood sampling for laboratory diagnostic and epidemiological survey. The study was approved by our Institutional review board (Conseil scientifique du CIRMF). Symptomatic patients presented to health care centers for medical examination. All patients were informed that blood sampling was required for laboratory diagnosis of suspected acute infections, such as malaria, dengue or chikungunya fever. During the two outbreaks, given the urgency of diagnosis, only oral consent was obtained for blood sampling and was approved by the institutional review board. However during the active surveillance study that was performed between the two outbreaks (described in reference [18]), written consent could be obtained. Virus identification and characterization Primary molecular screening was based on hemi-nested reverse-transcription PCR (hnRT-PCR) with the generic primers PF1S/PF2Rbis/PF3S targeting highly conserved motifs in the flavivirus polymerase (NS5) gene (280-bp) [20]. Yellow fever virus RNA (vaccinal strain 17D) was used as a positive control. A second screening was performed with a ZIKV-specific real-time PCR method using the primers-probe system ZIKV-1086/ZIKV-1162c/ZIKV-1107-FAM [16], also targeting a short sequence (160 bp) of the NS5 gene. Virus isolation was attempted on the Vero and C6/36 cell lines but was unsuccessful, presumably because of low viral titers (despite two patients presenting only 1 and 4 days after symptom onset), and unsuitable initial storage conditions. To further characterize the Gabonese ZIKV strains, partial envelope (E) (841 bp) and NS3 (772 bp) gene sequences were amplified by conventional nested RT-PCR with specific primers derived from published ZIKV sequences. The primer pairs targeting the E gene were ZIK-ES1 (TGGGGAAAYGGDTGTGGACTYTTTGG)/ZIK-ER1 (CCYCCRACTGATCCRAARTCCCA) and ZIK-ES2 (GGGAGYYTGGTGACATGYGCYAAGTT)/ZIK-ER2 (CCRATGGTGCTRCCACTCCTRTGCCA). The primer pairs for NS3 amplification were ZIK-NS3FS (GGRGTCTTCCACACYATGTGGCACGTYACA)/ZIK-NS3FR (TTCCTGCCTATRCGYCCYCTCCTCTGRGCAGC) and ZIK-X1 (AGAGTGATAGGACTCTATGG)/ZIK-X2 (GTTGGCRCCCATCTCTGARATGTCAGT). Phylogenetic analysis The E and NS3 sequences obtained from one Gabonese patient were concatenated and analyzed using a set of previously published ZIKV sequences. Phylogenetic relationships were reconstructed with the maximum likelihood algorithm implemented in PhyML [21] (available at http://www.atgc-montpellier.fr/phyml/) with best of NNI (Nearest Neighbor Interchange) and SPR (Subtree Pruning and Regrafting) criteria for tree topology searching, and the GTR model of nucleotide substitutions. The Gamma distribution of rate heterogeneity was set to 4 categories, with a proportion of invariable sites and an alpha parameter estimated from the dataset. Branch support was assessed from 100 bootstrap replicates. Tree reconstructions were also performed by Bayesian inference with MrBayes v3.2 [22] under the GTR+I+G model of nucleotide substitutions, and with the distance neighbor-joining method [23] implemented in MEGA5 [24] with confidence levels estimated for 1000 replicates. To test for phylogenetic discrepancies, tree reconstructions were also performed independently from the envelope dataset and the NS3 dataset with PhyML according to the parameters described above. The resulting trees were visualized with the FigTree software (Available at: http://tree.bio.ed.ac.uk/software/figtree/), and rooted on midpoint for clarity. The Genbank accession numbers for the Gabonese ZIKV strain are KF270886 (envelope) and KF270887 (NS3). Results Molecular screening The NS5 PCR products were sequenced, resulting in the first ZIKV RNA detection in a human sample (Cocobeach) and in two Ae. albopictus pools (Libreville) collected during the 2007 outbreaks. Real-time PCR was then performed, leading to the detection of four additional positive human samples, collected in 2007 in four suburbs of Libreville (Diba-Diba, Nzeng-Ayong, PK8, PK9) (Figure 1). No ZIKV was detected during the inter-epidemic period or during the 2010 outbreaks. 10.1371/journal.pntd.0002681.g001 Figure 1 Geographic distribution of Zika and chikungunya and/or dengue viruses infections in Gabon in 2007. The left-hand panel indicates Gabonese CHIKV and/or DENV cases in green circles and ZIKV cases in purple circles. The right-hand panel shows the location of Libreville suburbs where ZIKV-positive human sera (H) and mosquito pools (M) were detected. Clinical description Clinical information was available for only one ZIKV-positive patient, who had mild arthralgia, subjective fever, headache, rash, mild asthenia, myalgia, diarrhea and vomiting. No information was available on this patient's outcome. Cycle threshold values for human blood samples were high (>37 cycles), suggesting low viral loads (data not shown). Vector involvement Aedes albopictus was the predominant species collected, accounting for 55.4% of the mosquito pools, while Aedes aegypti accounted for 18.2% (Table 1). The other mosquito species consisted of members of the Aedes simpsoni complex, Anopheles gambiae, Mansonia africana, Mansonia uniformis, Culex quinquefasciatus, Eretmapodites quinquevittatus and unidentified Culex species. Positive mosquito pools were captured from two suburbs (Nzeng-Ayong and Alenkiri) where Aedes albopictus was the predominant species (Figure 1, Table 1). Sequences analysis As isolation on the Vero and C6/36 cell lines failed, the Gabonese ZIKV strain was further characterized by partial sequencing of the E and NS3 genes. Phylogenetic analysis was performed on concatenated E and NS3 sequences from one Cocobeach serum sample. The resulting tree topology (Figure 2) was similar to that previously obtained from the complete coding sequences, corroborating Asian and African distinct lineages [2]. The African lineage was further split into two groups, one containing the genetic variants of the MR766 strain (Uganda, 1947) and the second including West African strains (Nigeria, 1968; Senegal, 1984) and the new ZIKV sequence from Gabon, at a basal position. Phylogenetic trees derived from the E and NS3 partial sequences resulted in a similar topology, apart from the weakly supported branching pattern for the MR766 variant DQ859059, oscillating between the two African sister groups (Supporting Figure S1). The deletions in potential glycosylation sites previously reported for the Nigerian ZIKV strain and two variants of the Ugandan strain MR766 (sequences AY632535 and DQ859059) [2] were absent from the Gabonese ZIKV sequence. 10.1371/journal.pntd.0002681.g002 Figure 2 Phylogenetic relationships between concatenated sequences of the Zika virus envelope and NS3 genes. The tree was constructed with the maximum likelihood algorithm implemented in PhyML and rooted on midpoint. Bootstrap values are shown at the respective nodes, followed by bootstrap values resulting from NJ analysis and, finally, the posterior probability resulting from Bayesian analysis. The scale bar indicates the number of substitutions per site. The GenBank accession numbers for the 2007 Gabonese ZIKV isolate are KF270886 (envelope) and KF270887 (NS3). Discussion Evidence of human ZIKV infections in Central Africa is limited to one isolate from RCA in 1991 [6] and two serological surveys performed 50 years ago in Gabon [25], [26]. No report of human ZIKV infections was made in other countries of the Congo basin forest block, despite probable circulation through a sylvan natural cycle. We provide here the first direct evidence of human ZIKV infections in Gabon, as well as its occurrence in an urban transmission cycle, and the probable role of Ae. albopictus as an epidemic vector. Our phylogenetic results are in agreement with the tree topology previously obtained with complete coding sequences of ZIKV strains, showing an African lineage and an Asian lineage [2]. The branching pattern obtained here suggests that ZIKV emergence in Gabon did not result from strain importation but rather from the diversification and spread of an ancestral strain belonging to the African lineage. The identification of ZIKV in two different localities of Gabon (Cocobeach and Libreville) suggests that the virus was widespread rather than restricted to a single epidemic focus. The simultaneous occurrence of human and mosquito infections in Libreville also suggests that the virus circulated in 2007 in an epidemic cycle rather than as isolated cases introduced from sylvan cycles. Of note, ZIKV transmission occurred here in a previously undocumented urban cycle, supporting the potential for urbanization suggested in 2010 by Weaver and Reisen [27]. While some mosquito species (including Ae. aegypti) previously found to be associated with ZIKV, were captured and tested here, only Ae. albopictus pools were positive for this virus. Moreover, this species largely outnumbered Ae. aegypti in the suburbs of Libreville where human cases were detected, suggesting that Ae. albopictus played a major role in ZIKV transmission in Libreville. The ratio of ZIKV-positive Ae. albopictus pools is similar to that reported for DENV-positive pools, suggesting that these two viruses infect similar proportions of mosquitoes. The small number of recorded human ZIKV cases, by comparison with DENV cases, may be due to the occurrence of subclinical forms of ZIKV infections that did not required medical attention. Thus, an underlying ZIKV epidemic transmission might have been masked by concomitant CHIKV/DENV outbreaks. The natural histories of CHIKV and ZIKV display several similarities. Before the large Indian Ocean outbreaks in 2005–2007, chikungunya fever was a neglected arboviral disease. Both viruses are phylogenetically closely related to African viruses [28]–[30] suggesting they probably originated in Africa, where they circulated in an enzootic sylvan cycle involving non-human primates and a wide variety of mosquito species, human outbreaks presumably being mediated by Ae. aegypti [5], [31]. In Asia, both viruses are thought to circulate mainly in a human-mosquito cycle involving Ae. aegypti [11], [14], [31]. Together with the recent Yap Island outbreak, this prompted some researchers to re-examine the susceptibility of Ae. aegypti to ZIKV infection [14]. However, it must be noted that the vector of the Yap Island outbreak was not definitely identified since the predominant potential vector species Aedes hensilli remained negative [15], and that ZIKV has been isolated only once from Ae. aegypti in Asia [10], so that its vector status in natura is not confirmed. Additionally, a ZIKV enzootic transmission cycle involving non-human primates in Asia and sylvatic vectors cannot be ruled out as suggested by serologic studies carried on orangutang [32], [33]. Finally both CHIKV and ZIKV have shown their ability to adapt to a new vector, Ae. albopictus, upon introduction in an environment where their primary vector was outnumbered. This mosquito species being native to South-East Asia, our findings may help to explain human ZIKV transmission in Asia. Aedes albopictus was first introduced in Africa in 1991 [34] and detected in Gabon in 2007, where its invasion likely contributed to the emergence of CHIKV and DENV in this country [17]–[19], [35]. Multiple lines of evidence supporting its increasing impact as an arboviral vector have also been obtained during CHIKV outbreaks in the Indian Ocean region (2005–2007) and in Italy (2007) [36], [37] through viral evolutionary convergence of Ae. albopictus adaptive mutations [38]–[41]. Whether or not the transmission of ZIKV in Central Africa was also link to such an adaptative mutation of ZIKV to Ae. albopictus cannot be answered at this stage. Wong and colleagues [42] have just demonstrated experimentally that Ae. albopictus strains from Singapore were orally receptive to the Ugandan strain of ZIKV sampled in 1947, suggesting that this virus-vector association in Africa may have been previously prevented because the required ecological conditions did not yet exist. However, given the relatively low ZIKV viral loads previously reported in patients - with an order of magnitude of 105 copies/ml compared to 107 to 109 copies/ml for CHIKV [16], [18], [40] - the oral infectivity for Ae. albopictus may seem at least as critical as it was for CHIKV in establishing this new human-mosquito cycle. Why ZIKV has not yet been detected in the areas where DENV and CHIKV have already spread via Ae. albopictus is unclear, but it may be an ongoing process which we are just starting to detect. The spread of CHIKV reflects the ability of arboviruses to adapt to alternative hosts, and the resulting public health concerns in both developed and developing countries. Is ZIKV the next virus to succeed CHIKV as an emerging global threat? The increasing geographic range of Ae. albopictus in Africa, Europe, and the Americas [34], [36], [43], [44], together with the ongoing ZIKV outbreak in French Polynesia at the time of writing [45] suggest this possibility should be seriously considered. Analysis of sylvan and urban transmission cycles, together with viral genetics and vector competence studies, are now required to assess (i) how ZIKV is able to establish a sustainable transmission cycle involving this new vector in Central Africa, (ii) vector(s)-virus relationships in Asia, and (iii) the risk of importation and spread to new areas where Ae. albopictus occurs as well. Supporting Information Figure S1 Phylogenetic trees reconstructed from the E and NS3 datasets. Analyses were performed with the maximum likelihood algorythm implemented in PhyML and parameters set as described in the Methods section. Trees are rooted on midpoint. (TIF) Click here for additional data file.
            Bookmark
            • Record: found
            • Abstract: found
            • Article: found
            Is Open Access

            Urbanization Increases Aedes albopictus Larval Habitats and Accelerates Mosquito Development and Survivorship

            Introduction Aedes albopictus (Skuse) (Diptera: Culicidae), the Asian tiger mosquito, is an aggressive, strongly anthropophilic, exophagic, and exophilic mosquito. As an important vector of dengue fever, chikungunya disease, and yellow fever, Ae. albopictus has emerged as a global public health threat [1]–[3]. Ae. albopictus is indigenous to both tropical and temperate regions of Southeast Asia and islands of the western Pacific and Indian Oceans, but it has recently expanded its range to every continent except Antarctica [4], [5]. Unlike wetland mosquito species that oviposit and develop in habitats that are large, predictable, and easy to identify, Ae. albopictus is difficult to locate and control because this species utilizes small, different types of habitats including small containers and spare tires [6]–[8]. Ae. albopictus originated at the edges of forests and bred in natural habitats (e.g., tree holes, bamboo stumps, and bromeliads) and was previously considered a rural vector [9]. However, this species has adapted well to urban environments with larvae now breeding in artificial containers (e.g., tires, cemetery urns, and water storage containers) and has become the most important and sometimes sole vector in urban areas [8], [10], [11]. Ae. albopictus is found almost everywhere, especially in urban areas in southern and southwestern China [12]–[15]. The frequent outbreaks of dengue fever in the cities in southern (mainly Guangdong province) and southeastern coastal (mainly Fujian and Zhejiang provinces) China in the past few decades have caused serious public health concerns [16]–[18]. Although Aedes albopictus is described as a minor vector of dengue and possibly chikungunya in the world, it is emerging as a major dengue vector in China and was responsible for most outbreaks of dengue in China [19], [20] and chikungunya in 2010 in Guangdong, China [21]. Similar to other mosquito vectors, Ae. albopictus needs aquatic habitats to breed and develop, and therefore, it is sensitive to environmental changes [8], [22], [23]. Destruction of breeding habitats is an important strategy to reduce the Aedes mosquito population; eliminating suitable breeding habitats reduces larval development and thus the adult mosquito population. Equally importantly, environmental changes, such as changes in temperature, affect habitat productivity, larval and adult development times, and survival, which in turn directly and indirectly affect disease transmissibility [24]–[32]. Urbanization refers to the increasing population of urban areas. Urbanization predominantly results in the physical growth of urban areas, leading to environmental changes. Urbanization is a global trend that results from economic development. Asian countries including China and India, countries in Southeast Asia, and African countries such as Nigeria are the fastest growing areas in the world, and the unprecedented movement of people into these areas is predicted to intensify in the future [33]. Many problems have emerged as a result of urbanization, including environmental pollution, crowding, and the destruction of natural ecology. The socioeconomic effects of urbanization have been extensively studied by socio-ecologists [34]–[36]; however, the ecological effects and their impact on vector biology and vector-borne infectious disease transmission remain unclear. Most dengue fever outbreaks occur in the urban areas of China, and these outbreaks have become more frequent over the past decade [18], [20], [37]. There is an accelerating trend of urbanization in China; will this process of urbanization accelerate dengue fever outbreaks? Changes in environmental conditions as a result of urbanization may directly and/or indirectly affect the ecology of mosquitoes, e.g., larval habitat availability and suitability, development, and survivorship. Because Ae. albopictus has invaded Europe (e.g., Italy and France) and the Americas (e.g., USA), which increases the global vulnerability to dengue fever outbreak, therefore, it is crucial to evaluate its adaptations to urban environments. We hypothesized that urbanization increases Ae. albopictus larval habitats and survivorship and accelerates the development of larvae and adults. This study explored the ecology of Ae. albopictus in different settings (urban, suburban, and rural) in the Great Guangzhou area, China. Field surveys of larval habitat availability, larval development and adult mosquito life-table experiments were conducted in semi-natural conditions to test the hypothesis. Materials and Methods Study areas The field surveys of larval habitat availability and semi-natural condition larval development and adult mosquito life-table experiments were carried out in Guangzhou, the capital city of Guangdong province, China. Guangzhou is the largest city in southern China, and it is located in the Pearl River Delta, where numerous cities form a Canton-Macao-Hong Kong economic development zone. The annual average temperature in Guangzhou is 21.6°C, and its annual rainfall is approximately 1,980 mm. This climate is ideal for the development and reproduction of Ae. albopictus. The city has experienced rapid expansion during the recent regional economic development. Several major dengue fever outbreaks have occurred in this area since 1980, and Ae. albopictus is the sole dengue vector [13], [38], [39]. Therefore, Great Guangzhou is an ideal place to study the impacts of urbanization on Ae. albopictus. The study was conducted in three areas that represented urban, suburban, and rural settings in Guangzhou (Figure 1 and Figure S1). Each study area was approximately 1.8 km2. The distance between each area was approximately 24 km. Tonghe (113°19′E, 23°11′N, 31 m above sea level (a.s.l.)) is an urban area with a population density of >3,000 people/km2. The land use types are primarily residential and commercial buildings and public services such as schools and hospitals, filled with trees and grasses. Liangtian (113°23′E, 23°21′N, 25 m a.s.l.) is a suburban area with a population density of approximately 1,000 people/km2, and land use includes a mixture of residential, manufacturing, and farmland. Dengcun (113°33′E, 23°30′N, 42 m a.s.l.) is a rural area and has a population density of 80%. The number of larvae and pupa were counted and the larval stages identified daily. Emerged adult mosquitoes were counted daily, and their sexes were determined. The experiments began in October and were conducted simultaneously in all study sites. Adult mosquito life tables Mosquitoes used for adult life-table experiments were all F0 individuals who originated from different habitats in the study areas. Newly emerged ( 0.05). 10.1371/journal.pntd.0003301.g003 Figure 3 Mean density of adult Aedes albopictus (adults/trap/night) in the three study sites from July to November. Square root transformed data were used, and the 95% confidence interval is shown as a bar. Life table analysis of immature Ae. albopictus Ae. albopictus adult emergence rates were significantly different among urban, suburban, and rural areas regardless of in natural habitats or with food supplement groups (χ2-test, all P 0.05) (Figure 4B). 10.1371/journal.pntd.0003301.g004 Figure 4 Survival rate and development time of Aedes albopictus larvae in urban, suburban and rural areas. A and B: survival rate; A: natural habitat; B: food supplement. C and D: development time; C: natural habitat; D: food supplement. Values are the mean ±95%CI. For the natural habitat group, larval development time in urban areas was significantly shorter than that in both the suburban and rural areas (male F = 19.0, d.f. = 2, 92, P 50% shorter in control groups than it was in natural habitat groups in all study sites (Figure 4, Table S1). The larval stage-specific development time were shown in Figure 5. Young larval (1st and 2nd instar) and pupa developed significantly faster in urban areas than that in suburban and rural areas (Tukey HSD test, all P 0.05) (Figure 5). 10.1371/journal.pntd.0003301.g005 Figure 5 Stage survival rate and stage development time of Aedes albopictus larvae in urban, suburban and rural areas. A and B: stage survival rate; A: natural habitat; B: food supplement. C and D: stage development time; C: natural habitat; D: food supplement. Values are the mean ±95%CI. Life table analysis of adult Ae. albopictus From August to September, the life span of female adult mosquito was significantly longer in urban areas than that in suburban and rural areas, but the difference in median survival time between suburban and rural areas was insignificant (Figure 6, Table S2). Adult male mosquito survival time was significantly different among study sites (χ2 = 17.4, d.f. = 2, P 0.05) (Table S2). Survival curves were similar in females between urban and suburban areas but different from those in rural areas (Figure 6C and 6D). 10.1371/journal.pntd.0003301.g006 Figure 6 Survivorship curve of adult Aedes albopictus in different seasons. The left panel is for August to September, and the right panel is for October and November. The top panel (A and B) is for male, and the bottom panel (C and D) is for female. From October to November, the median survival of adult female mosquitoes in urban and suburban areas was significantly longer than in rural areas but the difference between urban and suburban areas was insignificant (Figure 6, Table S2). The median survival of males was significantly different among the three sites (χ2 = 181.1, d.f. = 2, P<0.001), with the longest and shortest survival times in urban and suburban areas, respectively (Figure 6, Table S2). The average outdoor temperature in urban areas (24.8±2.6°C) was significantly higher than that in suburban (22.8±3.6°C) and rural areas (21.9±2.4°C), and there was no difference in temperature between suburban and rural areas (Table S2). There was no significant difference in the relative humidity among the three areas. (F = 1.9, d.f. = 2, 134, P = 0.15). Mean daily survival rates were similar in all study sites but differed between males and females (Figure 6, Table S2). Survival curves were similar in females between rural and suburban areas but very different in those from urban areas, which showed prolonged survivorship (Figure 6D). Factors influencing the presence of immature Aedes albopictus Stepwise logistic regression revealed that six factors were significantly associated with the presence of immature mosquitoes in the study sites (Table 3). Habitat Ae. albopictus larval presence rate was significantly greater in the urban area than in suburban and rural areas (OR = 1.71, P<0.001), and the suburban area was significantly higher than the rural area (OR = 1.67, P<0.001). The presence of Ae. albopictus larvae was significantly in negative correlation with habitat water depth (OR = 0.03, P<0.001); whereas, it showed positive correlation with habitat water surface area (OR = 3.95, P<0.001). The presence of Aedes larvae was significantly greater in clean water than that in tinted or polluted water (OR = 1.889, P<0.001), and greater in tinted water than polluted water (OR = 1.78, P = 0.034). Shading (regard less of fully shaded or half-shaded), compare to open area, was positively affecting the presence of Aedes larvae (OR = 2.29, P<0.001). The presence of Ae. albopictus larvae was also positively correlated with habitats that have leaves on water surfaces (OR = 2.25, P<0.001), and with habitats that have soil and moss substrates (OR = 1.71, P<0.001). 10.1371/journal.pntd.0003301.t003 Table 3 Factors that were significantly associated with the presence of immature Aedes albopictus. Term Sub-term Estimate Chi-square P Odds ratio (95% CI) Intercept - 0.80 109.10 <.0001 Surface area (m2) - 0.14 17.70 <.0001 3.95 [2.11, 7.60] Water depth (m) - −0.04 108.54 <.0001 0.03 [0.01, 0.05] Study area Urban vs. Suburban and Rural 0.27 89.94 <.0001 1.71 [1.53, 1.91] Suburban vs. Rural 0.25 47.55 <.0001 1.66 [1.44, 1.92] Water clearance Clear vs. tinted and polluted 0.32 20.75 <.0001 1.88 [1.44, 2.48] Tinted vs. polluted 0.29 4.51 0.0338 1.77 [1.05, 3.03] Surface type Leaf vs. no substrate, soil, moss, and sand 0.41 189.44 <.0001 2.25 [2.01, 2.53] Soil and moss vs. no substrate and sand 0.27 57.19 <.0001 1.71 [1.49, 1.97] Canopy cover Full shade vs. full sun and partial shade 0.41 178.50 <.0001 2.29 [2.02, 2.58] Full shade vs. partial shade 0.30 69.75 <.0001 1.81 [1.57, 2.07] Note: A stepwise logistic regression was used. The presence of immature Aedes albopictus was used as the dependent variable, and variables that were insignificant at the 0.05 level are not included in the table. Discussion Outbreaks of dengue fever in China were reported in Hainan province and southern Guangdong province in the 1980s and have been reported in Zhejiang province in 2004, illustrating a 2,000 km expansion from subtropical to temperate areas over 30 years [16]. Among these outbreaks, Ae. albopictus was the only vector reported [13], [20], [44]. Although the causes of dengue fever outbreaks are multi-factorial, environmental changes such as urbanization may be one of the leading factors. We found that in urban areas, there are more Ae. albopictus habitats. In addition, urban areas promoted faster larval and pupal development, and higher larval-to-adult survival rate compared to rural areas. Ae. albopictus mosquito is strongly anthropophilic and has a higher blood-feeding rate in urban areas, where human population density is great, than that in rural areas [29], making it a more susceptible vector in urban areas. Because there is no effective drug therapy or vaccine for dengue fever, vector population control is by far the only effective method for reducing dengue virus transmission. In this context, understanding the vector ecology and biology is essential for developing dengue control strategies. Unfortunately, it is unclear how urbanization impacts the ecology of Ae. albopictus, and the lack of this key knowledge hinders disease control efforts. We found that, in the similar sampling area, the total number of potential habitats and the number of Aedes-positive habitats were significantly higher in urban areas than in suburban and rural areas. Urban areas have 10-fold higher human population density and more frequent human activities than do suburban and rural areas, leading to a larger number of artificial containers such as abandoned tires, disposable food tins, and flowerpots, which are all favorable breeding habitats for Ae. albopictus [7], [23], [45]. Larger size and higher density of human populations also mean more opportunities for Ae. albopictus blood feeding. Previous study found that Ae. albopictus has a higher blood-feeding rate in urban areas than in rural areas, most likely due to host availability [29]. Additionally, the existence of stable and abundant artificial containers produced by human activities serve as larval development sites, facilitating large mosquito densities in urban areas [11]. Urbanization shifts mosquito breeding sites from natural habitats to artificial habitats. These artificial habitats are usually small containers such as used tires and disposable containers, and they are often directly exposed to sunlight. Therefore, the water temperature in these habitats is higher than in rural areas. In our study sites, the average water temperature of urban habitats was 5°C higher than in suburban and rural areas. Similarly, vegetation changes and land use changes in urban areas may affect the radiation budget and energy balance of the land surface and thus may modify the microenvironments, e.g., food sources that enhance larval survival. These changes facilitate the development of immature Ae. albopictus, i.e., shorten the larval-to-adult development time and enhance the larva survival rate. Our findings are consistent with other studies conducted in different countries and for different mosquito species [24], [30], [46]–[48]. Compared with the food supplemental group, we found that added food sources significantly affect the developmental time and survival rate of immature mosquitoes, which implies that the habitat types in different areas may affect larval development differently due to the difference in availability of nutrients. However, the effects were more pronounced in urban areas than in suburban and rural areas, implying that other factor such as water temperature may play a more important role than food supply in urban areas. These results demonstrated that larvae develop and survive better in urbanized areas, in other words, Aedes larvae is better adapted to urban environment. Similar to a study conducted in the United States [49], the urban area had a higher pupal and larval density than other two areas; thus, the urban habitats had a higher capacity to support larval development. The reason might be that urban areas had less predators, more nutrition from a “dirtier” environment, or even less drift from agricultural insecticides. Pupal productivity is a good indicator of the abundance of adult mosquitoes [50]–[52]. The surveillance of adult mosquitoes in this study supports this conclusion, i.e., urbanization leads to a higher population density of adult Ae. albopictus. Higher mosquito density does not necessarily lead to increased disease transmission if adult mosquitoes have a very short life span. We found that both male and female mosquitoes in urban areas had the longest life spans. This result may be due to environmental factors such as air temperature and humidity. The average temperature in urban areas is higher than in suburban and rural areas. Longer adult life spans may enhance disease transmission, although the exact correlation between vector capacity and adult life span needs to be further explored. In this study we fed the adult mosquito with 10% sugar solution without blood, which might have led to exerted stress on the females during multiple gonotrophic cycles and affected the longevity of the female mosquitoes. We observed that the mortality of adult mosquitoes in rural area changed dramatically around day 15, because the air temperature in rural area showed a 5.7°C increase from day 11 to day 15 compared to the first 11 days. This drastic increase in temperature might have influenced the mortality rate of the adult mosquito. In our survey, we found that the distribution of immature Ae. albopictus was not random. Habitat surface area, canopy coverage, water turbidity, water depth, and substrate type were all important factors influencing habitat selection. These findings confirmed other studies reporting preferences for urban areas [11], [49], shaded containers [49], clean water [53], water with foliage [49], and larger surface area [49], [54]. These results illustrated the complex ecology of Ae. albopictus, which makes controlling this mosquito species difficult in light of its recent global expansion. In conclusion, the results of this study indicated that urbanization has a significant impact on the ecology of Aedes albopictus. In the urbanizing and urbanized area, the changed environment became more suitable for the growth and development of Ae. albopictus, the condensed population produced more kinds of containers for larval habitats and more blood sources for adult replication. This might be the reason for quick adaptation of Ae. albopictus in urban areas. The epidemic of dengue is largely dependent on vector population. Developing countries such as China and other Southeastern Asian countries experiencing rapid urbanization are under sustained risk of dengue outbreaks. Supporting Information Figure S1 Landscape of study areas in Guangzhou, Guangdong province, China. A and B: Urban; C and D: Suburban; E and F: Rural. (TIF) Click here for additional data file. Figure S2 Weekly temperature, humidity, and half-month precipitation data in urban, suburban and rural areas in 2013. A: Temperature; B: Relative humidity; C: Precipitation in one half month. A and B: Values are the mean ± standard error. (TIF) Click here for additional data file. Figure S3 The most abundant Aedes albopictus breeding habitats in the three study sites. Urban area: (1) aquatic plant, (2) plastic bucket, (3) disposable food tin, (4) gutter, (5) tire; suburban area: (6) tire, (7) disposal food tin, (8) clay pottery, (9) plastic bucket, (10) plastic basin; rural area: (11) clay pottery, (12) plastic bucket, (13) disposal food tin, (14) plastic basin, (15) building tool. (TIF) Click here for additional data file. Table S1 Development of Ae. albopictus larvae. Note: Values are the mean ± standard deviation. Values in the same column within the same experimental group connected with the same letter indicate a significant difference at the 5% level. (DOCX) Click here for additional data file. Table S2 Life table analysis of Ae. albopictus adults. Note: Values are the mean ± standard deviation. Values in the same column connected with the same letter indicate a significant difference at the 5% level within the same experimental group. (DOCX) Click here for additional data file. File S1 Original data of the manuscript. Data used for making the figures and tables for the manuscript. (RAR) Click here for additional data file.
              Bookmark
              • Record: found
              • Abstract: found
              • Article: not found

              Pupal survey: an epidemiologically significant surveillance method for Aedes aegypti: an example using data from Trinidad.

              This report documents the results of a country-wide pupal survey of Aedes aegypti (L.) conducted in Trinidad. The survey was designed to identify the important Ae. aegypti-producing containers, importance being a function of a container's abundance and its productivity. Results are summarized on a country-wide basis and by county: urban versus rural comparisons are also made. Numerically, the most common water-filled containers positive for the larvae or pupae of Ae. aegypti (foci) were outdoor drums, water storage tanks and buckets, laundry tubs, discarded tires, and small miscellaneous containers such as drink bottles and cans. The island-wide average number of foci per hectare was 287 and ranged between 65 and 499. The average standing crop per container of Ae. aegypti pupae was 9.5 and ranged 12-fold, the most and least productive being the flower pot (> 30) and the small indoor vase ( 90% of all Ae. aegypti pupae: the remaining seven types were responsible for 80% of Ae. aegypti production in the country. In our survey, the traditional Stegomyia indices used to document the density of Ae. aegypti and predict the threat of dengue transmission, the House, Container, and Breteau indices, were seen to have virtually no correspondence with the actual number of pupae per hectare or per person. We conclude that pupal survey is more appropriate for assessing risk and directing control operations.
                Bookmark

                Author and article information

                Contributors
                Journal
                Biomed Res Int
                Biomed Res Int
                BMRI
                BioMed Research International
                Hindawi
                2314-6133
                2314-6141
                2018
                9 August 2018
                : 2018
                : 3572696
                Affiliations
                1Institut Pierre Richet (IPR), Institut Nationale de la Santé Publique (INSP), 01 BP 1500, Bouaké 01, Côte d'Ivoire
                2Université Nangui Abrogoua, 02 BP 801, Abidjan 02, Côte d'Ivoire
                3Laboratoire de Zoologie et de Biologie Animale, UFR Biosciences, Université Félix Houphouët Boigny, 22 BP 582, Abidjan 22, Côte d'Ivoire
                4Institut de Recherche pour le Développement (IRD), Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution et Contrôle (MIVEGEC), UMR IRD 224-CNRS.5290, University of Montpellier, Montpellier, France
                5Liverpool School of Tropical Medicine, Pembroke place, Liverpool L3 5QA, UK
                Author notes

                Academic Editor: Stephen Munga

                Author information
                http://orcid.org/0000-0003-3220-5660
                Article
                10.1155/2018/3572696
                6106716
                830e691e-01bc-4e03-bb46-a46ac2af93b1
                Copyright © 2018 Céline Mabot Yobo et al.

                This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                History
                : 27 February 2018
                : 25 July 2018
                Categories
                Research Article

                Comments

                Comment on this article