11
views
0
recommends
+1 Recommend
2 collections
    0
    shares

      To submit your manuscript, please click here

      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      Prevalence of Antibiotic-Resistant Pathogenic Bacteria and Level of Antibiotic Residues in Hospital Effluents in Selangor, Malaysia: Protocol for a Cross-sectional Study

      research-article

      Read this article at

      ScienceOpenPublisherPMC
      Bookmark
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          Background

          Antimicrobial resistance (AMR) has emerged as a major global public health challenge due to the overuse and misuse of antibiotics for humans and animals. Hospitals are among the major users of antibiotics, thereby having a large contribution to AMR.

          Objective

          The aim of this study is to determine the prevalence of antibiotic-resistant pathogenic bacteria and the level of antibiotic residues in the hospital effluents in Selangor, Malaysia.

          Methods

          A cross-sectional study will be performed in the state of Selangor, Malaysia. Tertiary hospitals will be identified based on the inclusion and exclusion criteria. The methods are divided into three phases: sample collection, microbiological analysis, and chemical analysis. Microbiological analyses will include the isolation of bacteria from hospital effluents by culturing on selective media. Antibiotic sensitivity testing will be performed on the isolated bacteria against ceftriaxone, ciprofloxacin, meropenem, vancomycin, colistin, and piperacillin/tazobactam. The identification of bacteria will be confirmed using 16S RNA polymerase chain reaction (PCR) and multiplex PCR will be performed to detect resistance genes ( ermB, mecA, bla NDM-L , bla CTX-M , bla OXA-48 , bla SHV , VanA, VanB, VanC1, mcr-1, mcr-2, mcr-3, Intl1, Intl2, and qnrA). Finally, the level of antibiotic residues will be measured using ultrahigh-performance liquid chromatography.

          Results

          The expected outcomes will be the prevalence of antibiotic-resistant Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter (ESKAPE) bacterial species from the hospital effluents, the occurrence of antibiotic resistance genes (ARGs) from the isolated ESKAPE bacteria, and the level of antibiotic residues that may be detected from the effluent. Sampling has been conducted in three hospitals. Data analysis from one hospital showed that as of July 2022, 80% (8/10) of E. faecium isolates were resistant to vancomycin and 10% (1/10) were resistant to ciprofloxacin. Further analysis will be conducted to determine if the isolates harbor any ARGs and effluent samples are being analyzed to detect antibiotic residues. Sampling activities will be resumed after being suspended due to the COVID-19 pandemic and are scheduled to end by December 2022.

          Conclusions

          This study will provide the first baseline information to elucidate the current status of AMR of highly pathogenic bacteria present in hospital effluents in Malaysia.

          International Registered Report Identifier (IRRID)

          DERR1-10.2196/39022

          Related collections

          Most cited references58

          • Record: found
          • Abstract: found
          • Article: found
          Is Open Access

          Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis

          (2022)
          Summary Background Antimicrobial resistance (AMR) poses a major threat to human health around the world. Previous publications have estimated the effect of AMR on incidence, deaths, hospital length of stay, and health-care costs for specific pathogen–drug combinations in select locations. To our knowledge, this study presents the most comprehensive estimates of AMR burden to date. Methods We estimated deaths and disability-adjusted life-years (DALYs) attributable to and associated with bacterial AMR for 23 pathogens and 88 pathogen–drug combinations in 204 countries and territories in 2019. We obtained data from systematic literature reviews, hospital systems, surveillance systems, and other sources, covering 471 million individual records or isolates and 7585 study-location-years. We used predictive statistical modelling to produce estimates of AMR burden for all locations, including for locations with no data. Our approach can be divided into five broad components: number of deaths where infection played a role, proportion of infectious deaths attributable to a given infectious syndrome, proportion of infectious syndrome deaths attributable to a given pathogen, the percentage of a given pathogen resistant to an antibiotic of interest, and the excess risk of death or duration of an infection associated with this resistance. Using these components, we estimated disease burden based on two counterfactuals: deaths attributable to AMR (based on an alternative scenario in which all drug-resistant infections were replaced by drug-susceptible infections), and deaths associated with AMR (based on an alternative scenario in which all drug-resistant infections were replaced by no infection). We generated 95% uncertainty intervals (UIs) for final estimates as the 25th and 975th ordered values across 1000 posterior draws, and models were cross-validated for out-of-sample predictive validity. We present final estimates aggregated to the global and regional level. Findings On the basis of our predictive statistical models, there were an estimated 4·95 million (3·62–6·57) deaths associated with bacterial AMR in 2019, including 1·27 million (95% UI 0·911–1·71) deaths attributable to bacterial AMR. At the regional level, we estimated the all-age death rate attributable to resistance to be highest in western sub-Saharan Africa, at 27·3 deaths per 100 000 (20·9–35·3), and lowest in Australasia, at 6·5 deaths (4·3–9·4) per 100 000. Lower respiratory infections accounted for more than 1·5 million deaths associated with resistance in 2019, making it the most burdensome infectious syndrome. The six leading pathogens for deaths associated with resistance (Escherichia coli, followed by Staphylococcus aureus, Klebsiella pneumoniae, Streptococcus pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa) were responsible for 929 000 (660 000–1 270 000) deaths attributable to AMR and 3·57 million (2·62–4·78) deaths associated with AMR in 2019. One pathogen–drug combination, meticillin-resistant S aureus, caused more than 100 000 deaths attributable to AMR in 2019, while six more each caused 50 000–100 000 deaths: multidrug-resistant excluding extensively drug-resistant tuberculosis, third-generation cephalosporin-resistant E coli, carbapenem-resistant A baumannii, fluoroquinolone-resistant E coli, carbapenem-resistant K pneumoniae, and third-generation cephalosporin-resistant K pneumoniae. Interpretation To our knowledge, this study provides the first comprehensive assessment of the global burden of AMR, as well as an evaluation of the availability of data. AMR is a leading cause of death around the world, with the highest burdens in low-resource settings. Understanding the burden of AMR and the leading pathogen–drug combinations contributing to it is crucial to making informed and location-specific policy decisions, particularly about infection prevention and control programmes, access to essential antibiotics, and research and development of new vaccines and antibiotics. There are serious data gaps in many low-income settings, emphasising the need to expand microbiology laboratory capacity and data collection systems to improve our understanding of this important human health threat. Funding Bill & Melinda Gates Foundation, Wellcome Trust, and Department of Health and Social Care using UK aid funding managed by the Fleming Fund.
            Bookmark
            • Record: found
            • Abstract: found
            • Article: found
            Is Open Access

            Global Spread of Carbapenemase-producing Enterobacteriaceae

            Enterobacteriaceae are inhabitants of the intestinal flora and are among the most common human pathogens, causing infections such as cystitis and pyelonephritis with fever, septicemia, pneumonia, peritonitis, meningitis, and device-associated infections. Enterobacteriaceae are the source of community- and hospital-acquired infections. They have the propensity to spread easily between humans (hand carriage, contaminated food and water) and to acquire genetic material through horizontal gene transfer, mediated mostly by plasmids and transposons. Since 2000, spread of community-acquired enterobacterial isolates (Escherichia coli) that produce extended-spectrum β-lactamases (ESBLs) capable of hydrolyzing almost all cephalosporins except carbapenems has been reported worldwide ( 1 ). It is therefore mandatory to maintain the clinical efficacy of carbapenems (imipenem, ertapenem, meropenem, doripenem), which have become antimicrobial drugs of last resort. These agents are crucial for preventing and treating life-threatening nosocomial infections, which are often associated with techniques developed in modern medicine (transplantation, hospitalization in an intensive care unit, highly technical surgery). Carbapenem-resistant Enterobacteriaceae have been reported worldwide as a consequence largely of acquisition of carbapenemase genes ( 2 ). The first carbapenemase producer in Enterobacteriaceae (NmcA) was identified in 1993 ( 3 ). Since then, a large variety of carbapenemases has been identified in Enterobacteriaceae belonging to 3 classes of β-lactamases: the Ambler class A, B, and D β-lactamases ( 2 ). In addition, rare chromosome-encoded cephalosporinases (Ambler class C) produced by Enterobacteriaceae may possess slight extended activity toward carbapenems, but their clinical role remains unknown ( 2 , 4 ). Class A Carbapenemases A variety of class A carbapenemases have been described; some are chromosome encoded (NmcA, Sme, IMI-1, SFC-1), and others are plasmid encoded (Klebsiella pneumoniae carbapenemases [KPC], IMI-2, GES, derivatives), but all effectively hydrolyze carbapenems and are partially inhibited by clavulanic acid ( 2 ). KPCs are the most clinically common enzymes in this group. The first KPC producer (KPC-2 in K. pneumoniae) was identified in 1996 in the eastern United States ( 5 ).Within a few years, KPC producers had spread globally and have been described across the contiguous United States (still mostly in eastern coast states) and, in particular, in Puerto Rico, Colombia, Greece, Israel, and the People’s Republic of China ( 6 , 7 ) (Figure 1). Outbreaks of KPC producers also have been reported in many European countries and in South America ( 6 , 7 ) (Figure 1). Figure 1 A) Worldwide geographic distribution of Klebsiella pneumoniae carbapenemase (KPC) producers. Gray shading indicates regions shown separately: B) distribution in the United States; C) distribution in Europe; D) distribution in China. KPC producers have been reported, mostly from nosocomial K. pneumoniae isolates and to a much lesser extent from E. coli (especially in Israel) and from other enterobacterial species ( 6 ). A single K. pneumoniae clone (sequence type [ST]-258) was identified extensively worldwide, indicating that it may have contributed to the spread of the bla KPC genes ( 8 ).Within a given geographic location, several KPC clones are disseminating that differ by multilocus sequence type; additional β-lactamase content; and by size, number, and structure of plasmids, but the bla KPC genes are associated with a single genetic element (transposon Tn4401) ( 8 ). Although community-acquired KPC producers have been reported, they are rare, with the exception of isolates from Israel a few years ago ( 6 ).The level of resistance to carbapenems of KPC producers may vary markedly; ertapenem is the carbapenem that has the lowest activity ( 5 – 7 ), (Table 1). KPC producers are usually multidrug resistant (especially to all β-lactams), and therapeutic options for treating KPC-related infections remain limited ( 6 ) (Figure 2, panel A). Death rates attributed to infections with KPC producers are high (>50%) ( 9 – 11 ). Table 1 MIC range of carbapenems for Enterobacteriaceae that produce several types of carbapenemases* Carbapenemase MIC, mg/L Imipenem Meropenem Ertapenem KPC 0.5–>64 1–>64 0.5–>64 Metallo β-lactamases† 0.5–>64 0.25–>64 0.5–>64 OXA-48 type 1–>64 0.5–>64 0.25–>64 *KPC, Klebsiella pneumoniae carbapenemase; OXA-48, oxacillinase-48.
†Including New Delhi metallo-β-lactamase-1. Figure 2 Disk diffusion antibacterial drug susceptibility testing of A) Klebsiella pneumoniae carbapenemase-2 (KPC-2)–, B) New Delhi metallo-β-lactamase-1 (NDM-1)–, and C) oxacillinase-48 (OXA-48)–producing K. pneumoniae clinical isolates. Clinical isolates producing KPC-2 and OXA-48 do not co-produce other extended-spectrum β-lactamase, but the isolate producing NDM-1 co-produces the extended-spectrum β-lactamase CTX-M-15. Wild-type susceptibility to β-lactams of K. pneumoniae includes resistance to amoxicillin, ticarcillin, and reduced susceptibility to piperacillin and cefalotin (data not shown).TZP, piperacillin/tazobactam; PIP, piperacillin; TIC, ticarcillin; AMX, amoxicillin; ETP, ertapenem; TCC, ticarcillin/clavulanic acid; CAZ, ceftazidime; CF, cefalotin; FOX, cefoxitin; IMP, imipenem; AMC, amoxicillin/clavulanic acid; CTX, cefotaxime; CXM, cefuroxime; MEM, meropenem; ATM, aztreonam; FEP, cefepime; CIP, ciprofloxacin; CS, colistin; NET, netilmicin; RA, rifampin; OFX, ofloxacin; TE, tetracycline; C, chloramphenicol; TM, tobramycin; NOR, norfloxacin; TGC, tigecycline; SXT, sulfamethoxazole/trimethoprim; AN, amikacin; FT, nitrofurantoin; FOS, fosfomycin; SSS, sulfamethoxazole; GM gentamicin. Class B Metallo-β-Lactamases Class B metallo-β-lactamases (MBLs) are mostly of the Verona integron–encoded metallo-β-lactamase (VIM) and IMP types and, more recently, of the New Delhi metallo-β-lactamase-1 (NDM-1) type ( 2 , 12 ).The first acquired MBL, IMP-1, was reported in Serratia marcescens in Japan in 1991 ( 13 ). Since then, MBLs have been described worldwide ( 2 , 12 ) (Figure 3). Endemicity of VIM- and IMP-type enzymes has been reported in Greece, Taiwan, and Japan ( 2 , 12 ), although outbreaks and single reports of VIM and IMP producers have been reported in many other countries (Figure 3). These enzymes hydrolyze all β-lactams except aztreonam ( 12 ).Their activity is inhibited by EDTA but not by clavulanic acid ( 12 ). Most MBL producers are hospital acquired and multidrug-resistant K. pneumoniae ( 2 , 12 ). Resistance levels to carbapenems of MBL producers may vary (Table 1). Death rates associated with MBL producers range from 18% to 67% ( 14 ). Figure 3 Worldwide (A) and European (B) geographic distribution of Verona integron–encoded metallo-β-lactamase (VIM) and IMP enterobacterial producers. Discovered in 2008 in Sweden from an Indian patient hospitalized previously in New Delhi ( 15 ), NDM-1–positive Enterobacteriaceae are now the focus of worldwide attention ( 15 – 17 ). Since mid-August 2010, NDM-1 producers have been identified on all continents except in Central and South America with, in most of the cases, a direct link with the Indian subcontinent ( 17 ) (Figure 4). Few cases have been reported from the United States and Canada ( 17 ). Recent findings suggest that the Balkan states and the Middle East may act as secondary reservoirs of NDM-1 producers ( 17 ) (Figure 4). Figure 4 Geographic distribution of New Delhi metallo-β-lactamase-1 producers, July 15, 2011. Star size indicates number of cases reported. Red stars indicate infections traced back to India, Pakistan, or Bangladesh, green stars indicate infections traced back to the Balkan states or the Middle East, and black stars indicate contaminations of unknown origin. (Most of the information corresponds to published data; other data are from P. Nordmann.) In contrast to several other carbapenemase genes, the bla NDM-1 gene is not associated with a single clone but rather with nonclonally related isolates and species ( 16 , 17 ). It has been identified mostly in E. coli and K. pneumoniae and to a lesser extent in other enterobacterial species ( 16 , 17 ). The level of resistance to carbapenems of NDM-1 producers may vary (Table 1). Plasmids carrying the bla NDM-1 gene are diverse and can harbor a high number of resistance genes associated with other carbapenemase genes (oxacillinase-48 [OXA-48] types, VIM types), plasmid-mediated cephalosporinase genes, ESBL genes, aminoglycoside resistance genes (16S RNA methylases), macrolide resistance genes (esterase), rifampin (rifampin-modifying enzymes) and sulfamethoxazole resistance genes as a source of multidrug resistance and pandrug resistance ( 16 , 17 ) (Figure 2, panel B). The association of such a high number of resistance genes in single isolates has been rarely observed, even among the other carbapenemase producers. Many NDM-1 producers remain susceptible only to tigecycline, colistin (Figure 2, panel B), and to a lesser extent fosfomycin ( 16 , 17 ). Compared with other carbapenemases, NDM-1 has several characteristics that are deeply disconcerting for public health worldwide. These characteristics are 1) occurrence of the bla NDM-1 gene not in a single species but in many unrelated species and its spread in the environment, at least in the Indian subcontinent ( 18 ); 2) frequent acquisition by K. pneumoniae, a typical nosocomial pathogen, but also by E. coli that is by far the main (community-acquired) human pathogen; and 3) size of the reservoir—the Indian subcontinent has >1.4 billion persons. In certain areas in Pakistan, 1 1 Imipenem 8 4 Meropenem 8 4 *EUCAST, European Committee on Antimicrobial Susceptibility Testing (www.eucast.org/clinical_breakpoints); CLSI, Clinical and Laboratory Standards Institute; S, sensitive; R, resistant. However, low-level resistance and even susceptibility to carbapenems have been observed for producers of any type of carbapenemases (Table 1). We believe, as do others ( 30 ), that the search for carbapenemase producers should be made for any enterobacterial isolates with decreased susceptibility to carbapenems. Our opinion is based on the paucity of clinical experience for treating infections caused by carbapenemase producers, on the unknown level of carbapenemase production in the site of the infection in vivo, and on the possibility of selecting in vivo for strains with increased levels of resistance to carbapenems and additional mechanisms of carbapenem resistance (carbapenemase, outer-membrane permeability defects). Specific tests may help identify phenotypically a carbapenemase activity. The modified Hodge test based on in vivo production of carbapenemase has been suggested for detecting carbapenemase producers ( 29 , 31 , 32 ). However, this test is time consuming and may lack specificity (high-level AmpC producers) and sensitivity (weak detection of NDM producers) ( 27 , 29 ). This test may be useful for detecting KPC and OXA-48 producers (P. Nordmann, unpub. data). Boronic acid–based inhibition testing is reported to be specific for KPC detection in K. pneumoniae when performed with imipenem or meropenem but not with ertapenem if corresponding isolates co-produce a plasmid-mediated AmpC β-lactamase ( 29 , 30 ). The Etest MBL strip (bioMérieux, Solna, Sweden) is one of the methods advocated for detecting MBL producers on the basis of inhibition of MBL activity by EDTA ( 12 ). The Etest MBL, using imipenem and imipenem/EDTA, is efficient for detection of MBL producers with high resistance ( 12 ), but may be deficient for detecting MBL producers with low resistance to imipenem. No inhibition test is available for detection of OXA-48/OXA-181 producers. Spectrophotometric assay is needed for detecting carbapenemase activity. However, this assay is time consuming, requires specific training, and does not easily discriminate between different types of carbapenemases. The standard for identification of carbapenemases is based on use of molecular techniques, mostly PCR ( 29 , 33 ). A list of primers of the most prevalent carbapenemase genes identified in Enterobacteriaceae is shown in Table 3 ( 34 ). Standard conditions may be used for PCR-based detection ( 34 ). PCR performed on colonies may give results within 4–6 hours with excellent sensibility and specificity. Similarly, other molecular techniques, such as the Check-Points DNA technology, are useful for this purpose ( 35 ). Sequencing of PCR products may be of interest mostly for epidemiologic purposes. The main disadvantages of molecular-based technologies for detection of carbapenemases are their cost, the requirement of trained personal, and the absence of detection of any novel carbapenemase gene. Thus, there is an urgent need for an inexpensive, rapid, sensitive, and specific test for detection of carbapenemase activity. Table 3 Oligonucleotides used for screening of main carbapenemase genes in Enterobacteriaceae* Primer Sequence, 5′ → 3′ Gene Product size, bp IMP-F GGAATAGAGTGGCTTAAYTC bla IMP 232 IMP-R TCGGTTTAAYAAAACAACCACC VIM-F GATGGTGTTTGGTCGCATA bla VIM 390 VIM-R CGAATGCGCAGCACCAG OXA-48-F GCGTGGTTAAGGATGAACAC bla OXA-48 438 OXA-48-R CATCAAGTTCAACCCAACCG NDM-F GGTTTGGCGATCTGGTTTTC bla NDM 621 NDM-R CGGAATGGCTCATCACGATC KPC-Fm CGTCTAGTTCTGCTGTCTTG bla KPC 798 KPC-Rm CTTGTCATCCTTGTTAGGCG *A detailed technique for PCR amplification has been reported by Poirel et al. ( 34 ). VIM, Verona integron–encoded metallo-β-lactamase; OXA, oxacillinase; NDM, New Delhi metallo-β-lactamase-1; KPC, Klebsiella pneumoniae carbapenemase. The prevention of spread of carbapenemase producers relies on early detection of carriers ( 29 , 33 ). Patients who undergo screening should include patients who were hospitalized while abroad and then transferred to another country, and patients at risk (e.g., patients in intensive care units, transplant patients, immunocompromised patients). Screened patients should be kept in strict isolation before obtaining results of the screening (at least 24–48 hours). Because the reservoir of carbapenemase producers remains the intestinal flora, fecal and rectal swab specimens are adequate for performing this screening. Those specimens may be plated directly on screening media. There is no universal screening medium able to detect all types of carbapenemase producers with high sensitivity and high specificity, however. Agar plates containing imipenem at a concentration of 1 mg/L have been proposed for screening only KPC producers ( 36 ). We have demonstrated that a culture medium designed to screen for ESBL producers (ChromID ESBL; bioMérieux, La-Balme-Les-Grotte, France) may be used also for screening carbapenemase producers. Although this medium may lack specificity (co-detection of ESBL producers), its sensitivity is higher than a culture medium designed to screen for carbapenemase producers (CHROMagar KPC; CHROMagar, Paris, France) ( 33 , 37 ). The main problem remains detection of OXA-48 producers that are susceptible to cephalosporins and have low-level resistance to carbapenems when not co-producing an ESBL (Figure 2, panel C) ( 37 ). None of these culture media detect those OXA-48 producers ( 37 ). After this screening procedure, carbapenemase producers may be identified according to the techniques described above (antibacterial drug susceptibility testing, molecular techniques). Recently, PCR-based techniques performed directly on fecal specimens have been proposed for detection of KPC and NDM-1 producers. Conclusions Carbapenemase producers in Enterobacteriaceae are not the source of specific types of clinical infections. The role of these bacteria is related to the difficult-to-treat infections rather than to expression of specific virulence traits. We believe we are now at the edge of 2 concomitant epidemics of carbapenemase producers worldwide. The first epidemic will be caused mainly by carbapenemase producers in E. coli as a source of community-acquired infections. These carbapenemases are thus far primarily of the NDM and of the OXA-48 types. A few published reports of community-acquired infections caused by carbapenemase producers are available, but it is more likely that the numbers of cases in disease-endemic areas are already high. The example of the spread of ESBL producers in the community within the past 10 years shows us that a high rate of carbapenemase producers in E. coli may be reached rapidly worldwide. As opposed to a viral epidemic, such as pandemic (H1N1) 2009, the epidemic of carbapenemase producers cannot stop spontaneously. Such community-based outbreaks will be difficult to control. Modulation of the factors that enhance spread of carbapenemase producers in the community is difficult because these factors are multiple and are associated with lack of hygiene, overuse and over-the-counter use of antibacterial drugs, and increased worldwide travel. In addition, many carbapenemase producers carry unrelated drug-resistance determinants. Therefore, selection pressure with structurally unrelated antibacterial drugs (not only β-lactams) may contribute to their spread. We cannot predict either the speed of diffusion of those carbapenemase producers in the community or their prevalence at a steady state (5%–50%?). The actual prevalence of carbapenemase producers is still unknown because many countries that are likely to be their main reservoirs have not established any search protocol for their detection. The prevalence may substantially differ, depending on the country, as known with the current prevalence rate of ESBL producers in E. coli. The prevalence is estimated to be 3%–5% in France and >80% in India ( 38 ). The second epidemic will likely be caused mainly by nosocomial carbapenemase producers in K. pneumoniae of all types (KPC, IMP, VIM, NDM, and OXA-48). It is likely that in certain countries high rates of different types of carbapenemase producers may already exist, for example, in Greece (VIM and KPC) and in the Indian subcontinent (NDM, KPC, OXA-181). K. pneumoniae will play a major role because it has been repeatedly identified to be the most common enterobacterial species for spreading ESBL genes in health care facilities during the past 30 years. It may play the same role for spreading carbapenemase producers in patients with identical risk factors (patients receiving broad-spectrum antibiotherapy, patients in intensive care units, immunocompromised patients, transplant patients, surgical patients). Early identification of carbapenemase producers in clinical infections, at the carriage state, or both, is therefore mandatory to prevent development of those hospital-based outbreaks. We believe we still can efficiently prevent emergence of hospital-based outbreaks of carbapenemase producers. A similar strategy has been implemented in northern European countries for containment of hospital-acquired methicillin-resistant Staphylococcus aureus, which has been useful. The dearth of novel antibacterial drugs in the pipeline means that we must conserve the efficacy of existing antibacterial drugs as much as possible. Carbapenemase producers in Enterobacteriaceae are different from other multidrug-resistant bacteria in that they are susceptible to few (if any) antibacterial drugs ( 39 ). No vaccines are readily available for preventing infections with carbapenemase producers. This finding is particularly true for E. coli, which is part of the human intestinal flora. Therefore, everything must be done to prevent infections as common as pyelonephritis from becoming life threatening because of the lack of any effective treatment.
              Bookmark
              • Record: found
              • Abstract: not found
              • Article: not found

              Federal funding for the study of antimicrobial resistance in nosocomial pathogens: no ESKAPE.

                Bookmark

                Author and article information

                Contributors
                Journal
                JMIR Res Protoc
                JMIR Res Protoc
                ResProt
                JMIR Research Protocols
                JMIR Publications (Toronto, Canada )
                1929-0748
                2023
                29 May 2023
                : 12
                : e39022
                Affiliations
                [1 ] Environmental Health Research Centre Institute for Medical Research National Institutes of Health, Ministry of Health Malaysia Shah Alam Malaysia
                [2 ] Nutritional, Metabolic and Cardiovascular Research Centre Institute for Medical Research National Institutes of Health, Ministry of Health Malaysia Shah Alam Malaysia
                [3 ] Pharmacy Practice and Development Division Ministry of Health Malaysia Petaling Jaya Malaysia
                [4 ] Engineering Service Division Ministry of Health Malaysia Putrajaya Malaysia
                [5 ] Infectious Disease Research Centre Institute for Medical Research National Institutes of Health, Ministry of Health Malaysia Shah Alam Malaysia
                [6 ] Evidence Based Unit National Institutes of Health, Ministry of Health Malaysia Shah Alam Malaysia
                Author notes
                Corresponding Author: Sophia Karen Bakon sophia.karen@ 123456moh.gov.my
                Author information
                https://orcid.org/0000-0002-5088-3310
                https://orcid.org/0000-0003-1450-0260
                https://orcid.org/0000-0003-3776-4365
                https://orcid.org/0000-0002-5709-3119
                https://orcid.org/0000-0002-3666-0241
                https://orcid.org/0000-0002-8811-5843
                https://orcid.org/0000-0002-8727-4172
                https://orcid.org/0000-0002-7772-2103
                Article
                v12i1e39022
                10.2196/39022
                10263467
                37247207
                898ef559-68e4-48a2-8e58-8bc14d1187c7
                ©Sophia Karen Bakon, Zuraifah Asrah Mohamad, Mohd Azerulazree Jamilan, Hazimah Hashim, Mohamed Yazid Kuman, Rafiza Shaharudin, Norazah Ahmad, Nor Asiah Muhamad. Originally published in JMIR Research Protocols (https://www.researchprotocols.org), 29.05.2023.

                This is an open-access article distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work, first published in JMIR Research Protocols, is properly cited. The complete bibliographic information, a link to the original publication on https://www.researchprotocols.org, as well as this copyright and license information must be included.

                History
                : 29 August 2022
                : 30 September 2022
                : 24 February 2023
                : 28 February 2023
                Categories
                Protocol
                Protocol

                eskape,antimicrobial resistance,hospital effluent,antibiotics,health care,antibiotic resistance,antimicrobial,hospital setting,antibiotic residues,wastewater

                Comments

                Comment on this article