Correction: A rapid multiplex PCR assay for presumptive species identification of rhinoceros horns and its implementation in Vietnam

Abstract

There are errors in Table 1. The amplicon lengths for primers RID_FWD/RID_REV and Mac_FWD/Mac_REV do not include primer regions. Please see the corrected Table 1 here. 10.1371/journal.pone.0202433.t001 Table 1 Cytochrome b markers and their corresponding primers. Genetic marker for: Primer name: Primer sequence (5’–3’): Annealing temperature (°C): Amplicon length* (bp): Reference: Diceros bicornis (black rhino) Rh_BR_FWD (forward) AATCTGCCTAATCCTACAAATC 60 222 This study Rh_BR_REV (reverse) GGTTTCTAGGAAGGTGTAGG Ceratotherium simum (white rhino) Rh_WR_FWD (forward) CCACTCATTCATCGATCTGC 60 266 This study Rh_WR_REV (reverse) TAATAGATACCGCGTCCTAC Rhinoceros unicornis (Indian rhino) Rh_IR_FWD (forward) TCTCACCCACTAGTTAAAATCA 60 310 This study Rh_IR_REV (reverse) AGGAAGGTGTAAGATCCATAG All rhino species RID_FWD (forward) AACATCCGTAAATCYCACCCA 55 274 [6] RID_REV (reverse) GGCAGATRAARAATATGGATGCT All rhino species Mac_FWD (forward CAYTATACACCAGACACAACAAC 55 226 This study Mac_REV (reverse) TGAAYGCDGTGGCTATTAGRG *Amplicon lengths are inclusive of primer regions.