Biliary cirrhosis caused by Campula spp. in a dolphin and four porpoises

Foxp3+ regulatory T (Treg) cells are key immune regulators during helminth infections, and identifying the mechanisms governing their induction is of principal importance for the design of treatments for helminth infections, allergies and autoimmunity. Little is yet known regarding the co-stimulatory environment that favours the development of Foxp3+ Treg-cell responses during helminth infections. As recent evidence implicates the co-stimulatory receptor ICOS in defining Foxp3+ Treg-cell functions, we investigated the role of ICOS in helminth-induced Foxp3+ Treg-cell responses. Infection of ICOS−/− mice with Heligmosomoides polygyrus or Schistosoma mansoni led to a reduced expansion and maintenance of Foxp3+ Treg cells. Moreover, during H. polygyrus infection, ICOS deficiency resulted in increased Foxp3+ Treg-cell apoptosis, a Foxp3+ Treg-cell specific impairment in IL-10 production, and a failure to mount putatively adaptive Helios−Foxp3+ Treg-cell responses within the intestinal lamina propria. Impaired lamina propria Foxp3+ Treg-cell responses were associated with increased production of IL-4 and IL-13 by CD4+ T cells, demonstrating that ICOS dominantly downregulates Type 2 responses at the infection site, sharply contrasting with its Type 2-promoting effects within lymphoid tissue. Thus, ICOS regulates Type 2 immunity in a tissue-specific manner, and plays a key role in driving Foxp3+ Treg-cell expansion and function during helminth infections.

Introduction Schistosomiasis is an important parasitic helminth disease afflicting more than 200 million people, causing approximately 280 thousand deaths annually, with a further estimated 700 million at risk of infection [1], [2]. In the case of Schistosoma mansoni, infections are typically chronic (>10 years) and the majority (>90%) give rise to an intestinal form of disease [3] caused by the deposition of parasite eggs in the intestinal mesenteries (mainly of the colon and terminal ileum) and the subsequent development of Th2-associated granulomatous infiltrates rich in macrophages and eosinophils [4]. Such infections lead to diarrhoea, pseudopolyposis, microulceration, bleeding and fibrosis [5]. Recent re-appraisal of Disability-Associated Life Years (DALYs) attributable to schistosomiasis, where more subtle disease manifestations such as intestinal schistosomiasis have been included, raises the disease burden caused by this infection as much as 40-fold, putting schistosomiasis on a par with malaria as a global public health problem [6]. Variation in granuloma size in the colon between patients is positively associated with peripheral blood mononuclear cell (PBMC) reactivity to soluble egg antigens (SEA) [7]. Thus, changes in lymphocyte responsiveness appear to be related to the size of granulomas in the intestine and by implication, the severity of pathologies in patients with intestinal disease. In order to investigate the phenomenon of Th2-associated colonic inflammation and possible mechanisms underlying its regulation, we utilized a murine model of infection with S. mansoni which provides a well accepted permissive experimental host. In the murine model, myeloid antigen presenting cells, including dendritic cells [8], [9], and basophils [10], are primed to induce potent anti-egg Th2 CD4+ lymphocyte responses. Th2 activation appears necessary to protect the host from lethal hepatic and intestinal damage during acute infection [11] and to keep Th1 inflammatory immunopathology in check [12]. However, survival to the chronic stage of infection, representative of human disease, is dependent on modulation of the Th2 granulomatous response in order to subvert IL-4/IL-13-driven morbidity [13]. ‘Naturally occurring’ (n)Tregs bearing the IL-2 receptor α chain molecule (CD25) and expressing the transcription factor forkhead box P3 (FoxP3) have been demonstrated to play a role in the regulation of Th2 anti-egg hepatic inflammation in an IL-10-independent manner [14], [15], although their role in regulating intestinal inflammation induced by egg deposition has not been determined. Our data presented herein support a role for CD4+CD25+FoxP3+Tregs in regulating colonic inflammation by modulating both anti-egg Th2 responses within the mesenteric lymph nodes (mLN) and granulomatous, pro-fibrotic Th2 responses within the colon. Thus, our study implicates CD4+CD25+FoxP3+Tregs as a source of regulatory pressure during chronic intestinal schistosomiasis and in the wider context, as suppressors of Th2-driven pathology in the colon. Materials and Methods Ethics statement All experiments were carried out in accordance with UK Animal's Scientific Procedures Act 1986 and with the approval of The University of York Ethics Committee. Experimental infection and parasitological readout C57BL/6 (B.6) and hCD2-VaDsRed-B.6 mice were maintained within the University of York under specific pathogen-free conditions. hCD2-DsRed-B6 mice, were a gift of D. Kioussis and A. Patel (National Institute for Medical Research, London) and express fluorescent DSRed T cells (>90% CD3+) to facilitate in situ detection of T cells by multiphoton microscopy (see below). Eight to ten-week female mice were infected percutaneously via the abdomen with 25 S. mansoni cercariae, and infections allowed to mature for either 8 or 14 weeks representing the acute and chronic phases of infection respectively. Adoptive transfer recipients were infected with 100 cercariae. Egg burdens in the 5 cm of colon proximal to the cecum were enumerated following digestion in 4% KOH. Eggs in faecal material were enumerated following dispersion in PBS, filtration through 100 µm pore mesh, and concentration. Colonic granulomas were isolated as previously described [16]. Volumes were calculated by measuring the longest and widest points and extrapolating volume using standard formulae for sphere or cylinder, depending on individual granuloma shape. Histology and confocal microscopy Colonic tissue were fixed in 4% formaldehyde and embedded in wax. Transverse cross-sections (5 µm) were stained with H&E, or haemotoxylin and Van Geison (Department of Veterinary Pathology, University of Liverpool). Digital photomicrographs were analysed using AxioVision software (Zeiss). For multiphoton imaging, proximal colon segments were mounted within 10 mm depression slides, and granulomas imaged from the serosal surface to egg mid-point using a 510 NLO laser-scanning microscope (LSM, Zeiss) with multi-photon laser (Coherent) tuned to 872 nm. 3D projections of ‘half-granulomas’ were rendered from z stacks using Volocity 4 software (Improvision). Quantification of Ds-Red+ lymphocytes, granuloma and collagen volumes were performed using “ROI” and “RGB” measurement tools within Volocity. For immunofluorescent staining, frozen tissues were cryosectioned at 8 µm intervals, fixed with 10% methanol, permeabilised with 0.5% saponin (Sigma), and blocked with 5% rabbit serum / 1% FCS. Sections were labelled with anti-CD4 AF488 and anti-FoxP3 AF647 (both eBioscience) and fluorescence captured using the 510 NLO LSM. Settings for acute and chronic fluorescence images are matched both with respect to laser scanning settings at the time of image capture and post-image digital enhancement. Baseline laser scanning settings were undertaken on isotype controls and resultant negative control images contain undetectable fluorescent signal. Anti-CD25 mAb treatment Three doses of anti-CD25 mAb (50 µg; clone PC61, a gift from F. Powrie, University of Oxford), or purified rat IgG2a, were delivered intraperitoneally to infected mice at 9, 11, and 13 weeks. Treg cell purification, adoptive transfer and in vitro culture Tregs from the mLN were purified by depletion of non-CD4+ cells followed by isolation of CD25+ cells using antibodies conjugated to magnetic beads (Miltenyi Biotec). For adoptive transfer, 2.5×106 CD4+CD25+Tregs (>90% purity) were injected via the lateral tail vein. Total mLN cells (2×106/ml), sorted CD4+CD25− effector cells (1×106/ml), and CD4+CD25+Tregs (0.5×106/ml) from infected mice cultured in complete RPMI-1640 medium (containing 10% FCS, 50 µg/ml penicillin/streptomycin), in combination with naïve mLN CD4−CD25− cells (0.1×106/ml) as a source of APC. Cells were stimulated with plate-bound anti-CD3 mAb (1 µg; Becton Dickinson), or SEA (50 µg/ml) [16]. Cells were cultured for 72 h and supernatants retained for cytokine analysis. Proliferation was measured from 72 to 96 h by 3H-thymidine incorporation and scintillation counting. Cytokine and collagen quantifications ELISAs were used to quantify IL-4, IL-5 and IFNγ [17], while IL-10 and IL-13 were measured by Cytoset (Invitrogen) or DuoSet (R&D Systems) kits respectively. A TGFβ-sensitive, mink lung epithelial cell bio-assay (MLEC transfected with firefly luciferase; gift from Daniel Rifkin, NY Medical Center) was used to determine levels of bio-active TGFβ1 [18]. As the bio-assay was not compatible with tissue extracts, a TGFβ1 ELISA (R&D Systems) was employed. In order to determine cytokine levels in the colon, frozen tissues were first homogenised in proprietary tissue extraction buffer containing detergent and protease inhibitors (Thermo Scientific) and then incubated/rotated overnight at 4°C and the soluble fractions isolated by centrifugation prior analysis by ELISA. Salt-soluble collagen was quantified using colorimetric assay (Sircol, Biocolor). Quantitative Real Time PCR Total colonic mRNA was used to generate cDNA using Superscript III DNA polymerase (Invitrogen) and foxp3 transcript analysed by qRT-PCR (ABI PRISM 7000; Applied Biosystems) using Taqman probes (Sigma-Aldrich). The relative expression of foxp3 was normalised to values obtained for cd3. Primer pairs and probes were; foxp3 5′-GCAGTGTGGACCGTAGATGA, 5′-CACAGCCTCAGTCTCATGGT, Probe 5′-ACAAGTGCTCCAATCCCTGCCCTT and cd3 5′-GAGCACCCTGCTACTCCTTG, 5′- ATGTCCCAGCACTGGCTACT, Probe 5′- TGCTCTTCAGCCTCCTGGTGAACAC. Flow Cytometry Cells were blocked with anti-CD16/CD32 (eBioscience) at 0.5 µg / 1×106 cells, then labelled with anti-CD4-Pacific Blue, anti-CD25-APC (PC-61), anti-CD103-PE (all eBioscience), anti-CD25-FITC (7D4), anti-CTLA-4-FITC, or anti-CCR5-biotin (BD Bioscience) for 30 minutes. Biotinylated antibodies were sequentially detected with streptavidin-PE-Cy7 (eBioscience). For intracellular staining of FoxP3, cells were fixed in 1% formalin, re-suspended in permeablisation buffer (Becton Dickinson) prior to labelling with anti-FoxP3-PE or -AF647 (eBioscience). Cells were analysed using a Cyan flow cytometer with Summit software (Beckman Coulter). Statistical analyses Significant differences between two experimental groups were determined by unpaired Student's T test, and between three or more groups by 1-way ANOVA with Tukey post-hoc tests using Prism software (GraphPad). Because colonic egg counts were skewed, analysis was undertaken after Log10 transformation. All data are representative of a minimum of two independent experiments. Significance is indicated ***P 0.05), figures are intentionally left blank. Results Colonic granuloma size and anti-egg Th2 responses decline with chronicity of infection Egg deposition and anti-egg granulomatous responses in proximal colons were examined over a time-course of infection in B.6 mice. The numbers of eggs increased during infection from 292±121.8 (day 42) to 2339±863.5 (day 98) (Fig. 1A). Mean areas of isolated colonic granulomas declined from the acute to chronic time point visualised by H&E staining (Fig. 1B & C), supporting previous observations [16], [19]. Estimates of volumes of granulomas isolated from enzymatically digested colons (Fig. 1D) corroborated histological observation and showed a significant decrease in size between the acute and chronic stage of infection. In addition, the decrease in granuloma size at the chronic stage was accompanied by a decrease in collagen, indicative of fibrosis, as shown by Van-Geison stained sections (Fig. 1E). 10.1371/journal.pntd.0001269.g001 Figure 1 Colonic granuloma size and fibrosis is reduced in the chronic phase of schistosome infection. A). Accumulation of eggs /gram of colon tissue (n = 4 mice/time point); mean eggs (± SEM). B) Representative photomicrographs of the colon at the acute (8 wks) or chronic (14 wks) stage of infection stained with H&E. Scale bars are 200 µm: egg denoted ‘Sm’. C) Granuloma area at the acute or chronic stage; bars are mean / animal (n = 4) from three separate histological sections. D) Granuloma volumes calculated from isolated granulomas at the acute or chronic stage calculated from three separate granulomas per individual animal. E) Cross sections of colon at the acute (8 wks) or chronic (14 wks) stage of infection stained with haematoxylin / Van Geison (collagen fibres  =  pink). All scale bars are 200 µm. Parasite egg is denoted ‘Sm’. F) 3D images of multiphoton confocal stacks of colonic tissue from infected hCD2-VaDsRed-B.6 mice sampled in situ during acute or chronic infection. DsRed fluorescent cells are >90% CD3+; blue fluorescence is second harmonic generation of type 1 collagen; green/yellow auto-fluorescence are schistosome eggs. Grid squares are 63.9 µm2. Quantification of multiphoton confocal stacks from hCD2-VaDsRed-B.6 mice: G) granuloma half-volumes, H) DsRed+ cell counts and I) collagen half-volumes. Data calculated from four separate granulomas from individual animals (n = 4). J) Salt-soluble collagen from colonic tissues of naïve, acute, and chronic mice (n = 4). Data is mean (±SEM) collagen concn–/mg of tissue (left), or adjusted for numbers of eggs/mg (right). Multiphoton imaging of proximal colon derived from infected hCD2-VaDsRed-B.6 mice revealed further quantitative information on temporal granuloma modulation in situ (Fig. 1F, Videos S1 & S2) and analysis of 3D images showed granuloma volumes were significantly decreased at the chronic stage (Fig. 1G). Furthermore, numbers of granuloma-associated DsRed+ lymphocytes (Fig 1H; >90% CD3+T lymphocytes, data not shown), and granuloma-associated type-1 collagen deposition, revealed as second harmonic imaging (blue), was significantly also reduced (Fig. 1I). Although a significant increase in the recently synthesised (salt-soluble) collagen pool within the colon was apparent by the chronic phase, modulation of the egg-driven fibrotic response was demonstrable when adjusted for the increased numbers of eggs (as a surrogate for numbers of granulomas) in chronic infected colons (Fig. 1J). At the acute stage, anti-CD3 mAb and SEA-specific proliferation of mLN cells were significantly elevated and biased towards secreting Th2-type cytokines (Fig. 2A). However, by the chronic stage, SEA-induced cell proliferation and production of IL-4, IL-5 and IL-13 were significantly reduced (Fig. 2B). While the secretion of IL-10 in response to SEA was significantly lower during chronic compared to acute infection the production of bio-active TGFβ1 to SEA at the chronic stage was significantly elevated compared to naïve state (Fig. 2B). 10.1371/journal.pntd.0001269.g002 Figure 2 Egg antigen-specific Th2, but not TGF-β1 responses become down-modulated within the mLN and colon during chronic infection. A) Proliferative responses and B) cytokine release (pg/ml) by mLN cells from naïve, acute, or chronic mice (n = 4/group) to anti-CD3 mAb, or SEA. C) Cytokine levels within colonic tissues (pg/mg tissue) and D) adjusted for numbers of eggs / mg of tissue. Data are mean proliferative response / cytokine concentration ±SEM. It was not possible to obtain sufficient numbers of viable lymphocytes via enzymatic digestion of granulomatous colons due to the fibrotic nature of these intestinal granulomas but levels of IL-4 and IL-5 in whole colonic extracts were elevated at the acute phase (Fig. 2C), suggesting that tissue inflammatory responses in infected colons mirrored the Th2 response in the mLN. Surprisingly, levels of IL-10 significantly decreased in infected colonic tissue (Fig. 2C) but levels of bio-active colonic TGFβ1 were elevated during chronic disease. When adjusted for numbers of deposited eggs, production of colonic IL-4 and IL-5 was significantly diminished at the chronic phase (Fig. 2D). Thus, whilst local cytokine responses to egg deposition has both shared and distinct facets to those of the mLN, measurements indicate that colonic Th2 responses establish during the onset of egg deposition and subsequently diminish as chronicity proceeds. Increased numbers of CD4+FoxP3+Treg cells occur in the mLN and colonic granulomas as chronicity proceeds The proportion of CD4+ FoxP3+Tregs in the mLN as a proportion of total CD4+ cells, as determined by flow cytometry of cell suspensions, increased from 13.1±0.2% in naïve mice to 16.0±0.4% during acute infection (P 10 fold) proportional elevation in FoxP3+ cells compared with total number of T lymphocytes in gut tissue was corroborated by qRT-PCR of FoxP3 transcript normalised to CD3 transcript (Fig. 3F). Thus, during enteric S. mansoni infection, relative and absolute expansion in the numbers of CD4+FoxP3+ cells occurs preferentially within gut-associated lymphoid tissue (GALT). Furthermore, relative increases of CD4+FoxP3+ cells within colonic granulomas are apparent during chronic disease. CD103, the αE molecule of the αEβ7 mucosal integrin involved in homing of T cells to intestinal sites [20], increased on mLN CD4+FoxP3+Tregs at the chronic stage compared to naïve mice (31.0±2.3% cf. 62.4±3.1%, P 90% purity; Fig. 6A) from mice at the chronic stage of infection were administered to hCD2-VaDsRed-B.6 mice co-incident with the onset of egg deposition. Four weeks later (+9 weeks post-infection), the number of eggs in tissues or excreted from CD25+ cell recipients were not significantly different compared with controls (Table S1). This showed that immune cell transfers did not significantly affect adult worm development, fecundity, or egg transmission. Recipients of CD4+CD25+ cells had significantly smaller granuloma area and collagen deposits but Ds-Red+ T cell numbers within the colonic granulomas were not significantly altered (Fig. 6B &C; Videos S3 & S4). Recipients also had decreased levels of recently synthesised collagen and IL-4 in colonic extracts (Fig.6D) although simultaneous down-regulation of Th2 mLN responses were not observable in recipient mice (data not shown). Lower numbers of transferred cells (1×106) did not significantly alter acute-stage enteric granuloma formation (data not shown). Thus, CD4+CD25+Tregs cells, which expand within the mLN of chronically-infected mice, exert a suppressive effect on the development of acute-phase Th2 inflammation. 10.1371/journal.pntd.0001269.g006 Figure 6 Transfer of schistosome-expanded CD4 + CD25 + Tregs modulates the development of acute-stage granulomas. A) Isolated mLN CD4+CD25+Tregs from mice with chronic infection used for transfer. B) 3D images of multiphoton confocal stacks of colonic tissue viewed in situ at the acute stage of infection in hCD2-VaDsRed-B.6 control mice, or recipients of infection-expanded CD4+CD25+Tregs (2.5✕106). Grid squares are 63.9 µm2. C) Granuloma area (left), DsRed+ cell counts (middle), and collagen half-volume (right) taken from confocal stacks (as above). Data are from 5–6 separate granulomas per mouse. Bars are mean / group (n = 3). D) Soluble collagen and cytokine in colonic extracts from infected control mice, or recipients of CD4+CD25+ cells. Bars are means / group (n = 3). Data is mean pg/ml (± SEM) per group. Discussion Our data provides both in vitro and in vivo evidence that intestinal-associated CD4+CD25+FoxP3+Tregs expand during chronic, schistosome-induced colitic inflammation. They mediate significant levels of antigen-specific Th2 suppression in vivo including reduced IL-4 production, eosinophil recruitment, collagen production, and an overall reduction in the size of egg-induced granulomas in the large intestine. Thus, our data demonstrates experimentally, that CD4+CD25+ Tregs are capable of modulating Th2 inflammation and fibrosis associated with intestinal disorders. Whilst an expansion of gut-associated CD4+FoxP3+Tregs was observed following schistosome infection, this could be a product of proliferating, naturally occurring (n)Tregs in response to auto-antigens (e.g. arising from disrupted intestinal barrier), or comprise an induced population of FoxP3+Tregs recognising schistosome antigens. However, in a syngenic adoptive transfer model, numbers of nTregs did not expand relative to CD4+ effector cells within the mLN [24], suggesting that nTreg expansion does not fully account for the heightened ratio of FoxP3+CD4+ : CD4+ cells during chronic infection. The development of schistosome infection-induced Tregs is likely to be favoured by the constitutive production of intestinal signals such as TGFβ and retinoic acid [29], [30]. Intriguingly, SEA induces TGFβ1 secretion [31] and is critical for the development of auto-immune suppressing FoxP3+ Tregs following in vivo SEA injection [32]. Since we observed heightened bioactive TGFβ1 from mLN cells and within the colon at the chronic phase of infection, we speculate that TGFβ1 might have a role in the induction of gut-homing CD4+FoxP3+Tregs from naïve precursors. Both proportions and absolute numbers of CD4+FoxP3+Tregs significantly increased within the mLN during acute infection, when anti-egg Th2 responses are at their peak. Although inhibition of Treg induction by Th2 differentiation programs has been reported [33], our data would suggest that Th2 differentiation is insufficient to block outgrowth of a regulatory T cell phenotype during acute intestinal schistosomiasis. CD4+FoxP3+Tregs within the mLN of mice with a chronic infection expressed elevated levels of CD103 and CCR5, both of which are associated with homing to mucosal tissues during inflammation [20], [21]. However, infection status did not alter the in vitro suppressive ability on a per-cell basis of CD4+CD25+Tregs from the mLN, indicating that infection-expanded CD4+FoxP3+Tregs and those from naïve mice share a common mechanism of Th2-effector cell suppression. Therefore, it is likely that the increased regulatory activity of CD4+FoxP3+Tregs in vivo during chronic infection is a product of either increased numbers trafficking to the site of egg deposition, or greater survival/ retention in colonic granulomas. As recipients of schistosome-expanded CD4+CD25+ cells displayed selective suppression of Th2 activity at the enteric infection site versus the mLN, this may reflect a biased homing of Tregs in the colon that provides increased regulatory pressure on the local granulomatous response (i.e. collagen synthesis and eosinophil recruitment). Taken with the observation that ablation of CD4+CD25+ cells in vivo significantly restores the anti-egg IL-4 and proliferative mLN cell response, these data suggest that intestinal-associated, schistosome infection-expanded FoxP3+ Tregs exert layers of Th2 suppression both within gut-draining lymph nodes and within the colonic infection site. Our data are consistent with recent findings that CD4+FoxP3+Tregs constitute a partial component of the modulation of granuloma development in the liver [14], [24], [34]. We show that depletion of CD4+CD25+ cells in vivo does not fully reverse the Th2 hypo-responsiveness, nor do chronic enteric granulomas in treated mice fully recover the florid cellularity of the acute phase. The use of transgenic mice deficient for foxp3 [35] could help further investigation of this phenomenon. The development of other regulatory cells such as alternatively-activated macrophages [36], IL-10-secreting non-FoxP3 cells [14], and regulatory B cells [37], may explain the partial role of CD4+FoxP3+Tregs in our system. T cell intrinsic anergy, for instance mediated by GRAIL signalling [38], could also account for the remaining hypo-responsiveness after depletion of CD4+ CD25+ cells. However, because the micro-environment of the intestines is favourable towards the expansion of CD4+FoxP3+Tregs, it is possible that CD4+FoxP3+Treg-mediated suppression of enteric granulomas is more apparent compared with their hepatic counterparts. This could explain why colonic granulomas modulate more rapidly versus hepatic granulomas after the acute stage, and why hepatic granulomas retain a greater size and cellularity than enteric granulomas during chronic disease [19]. During experimental helminth infections, CD4+CD25+Treg-mediated suppression of Th2 effector responses confer a permissive state by stifling effective Th2-mediated worm attrition [23], [25], [26]. In the case of gut-helminths, this potentially operates by regulating Th2 cytokine signalling on smooth muscle contractility and epithelial cell turnover [39], [40]. Paradoxically, during S. mansoni infections, while Th2 granulomatous responses protect and aid survival of the host [11], [41], intact Th2 responses are also essential to propagate the parasite's life cycle, as egg transmission from the gut is impaired in the absence of T cells [42], [43], [44], IL-4 [41], or IL-4Rα signalling [45]. Nevertheless, transfer of CD4+CD25+ cells to acute stage recipients does not impinge on egg transmission in spite of a modulatory effect on IL-4 in the colon. In fact, during the chronic stage of infection, where Th2 inflammation in the colon becomes modulated, egg excretion rates are unaffected (our unpublished observations). How intestinal schistosome parasites mediate sustained, chronic egg transmission in the face of marked Th2 hypo-responsiveness remains to be identified. Enteric helminth infections, or products derived from helminths, are gaining prominence as potential therapies to reverse the effects of inflammatory bowel disease [46]. Some ameliorating capacities may be attributed to antagonism of Th1 processes by induction of IL-4-secreting cells within intestinal tissues rather than by induction of Tregs. Indeed, most experimental studies demonstrating the modulatory action of helminth infection used trinitrobenzene sulphate as a haptenizing agent to drive Th1 colitis reminiscent of Crohn's Disease [46]. Initiation of Th2/NKT colitis by oxazolone in conjunction with Th2-promoting helminth infection exacerbated pathology [47], further supporting that the mechanism of helminth suppression of colitis is based on Th2/Th1 antagonism. Thus, from a clinical perspective, helminth-based therapies might be considered inappropriate for ulcerative colitis or other intestinal disorders with Th2 aetiology. However, our data demonstrates that helminth infection-expanded FoxP3+ Tregs clearly regulate coincident pro-fibrotic Th2 processes in the colon. Indeed, distinct molecules released by schistosome eggs deliver triggers that polarize naïve CD4+ T cells towards Th2, or a regulatory phenotype [8], [9], [10], [48]. Potentially, the release of somatic molecules with regulatory potential from degrading eggs that fail to breach colonic tissues could favour Treg expansion during chronic disease in the context of a TGFβ-enriched microenvironment. Exploitation of such regulatory molecules may be of benefit in the treatment of intestinal schistosomiasis or other Th2-based intestinal disorders via the expansion of Tregs with bystander potential. Supporting Information Video S1 Acute colonic granuloma shown in Fig 1F . (MOV) Click here for additional data file. Video S2 Chronic colonic granuloma shown in Fig 1F . (MOV) Click here for additional data file. Video S3 Control recipient, colonic granuloma shown in Fig. 6B . (MOV) Click here for additional data file. Video S4 CD4 + CD25 + recipient, colonic granuloma shown in Fig. 6B . (MOV) Click here for additional data file. Table S1 Acute-stage schistosome egg tissue burdens and excretion following adoptive transfer of chronic infection-expanded CD4 + CD25 + cells. (DOC) Click here for additional data file.

Primary biliary cirrhosis (PBC) is an organ-specific autoimmune disease that predominantly affects women and is characterized by chronic progressive destruction of small intrahepatic bile ducts with portal inflammation and ultimately fibrosis. The serologic hallmark of PBC is the presence of antibodies to mitochondria, especially to the E2 component of the pyruvate dehydrogenase complex. The mechanisms by which (and if) such antibodies produce liver tissue injury are unknown. However, the presence of these antibodies has allowed detailed immunological definition of the antigenic epitopes, the nature of reactive autoantibodies and the characterization of T-cell responses. Several mechanisms may now be proposed regarding the immune-mediated bile duct damage in PBC, including the possible role of T-cell-mediated cytotoxicity and intracellular interaction between the IgA class of antimitochondrial antibodies and mitochondrial autoantigens. There are major questions which remain unanswered, including, of course, etiology, but also the reasons for female predominance, the absence of PBC in children, the relative ineffectiveness of immunosuppressive drugs, and the specific role of mitochondrial antigens. The data so far provide suggestive evidence that PBC is a mucosal disease; this thesis provides a basis for discussion of etiology via the enterohepatic circulation of toxins and/or infection.