Global risk model for vector-borne transmission of Zika virus reveals the role of El Niño 2015

There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

Abstract

Zika, a mosquito-borne viral disease that emerged in South America in 2015, was declared a Public Health Emergency of International Concern by the WHO in February of 2016. We developed a climate-driven R0 mathematical model for the transmission risk of Zika virus (ZIKV) that explicitly includes two key mosquito vector species: Aedes aegypti and Aedes albopictus The model was parameterized and calibrated using the most up to date information from the available literature. It was then driven by observed gridded temperature and rainfall datasets for the period 1950-2015. We find that the transmission risk in South America in 2015 was the highest since 1950. This maximum is related to favoring temperature conditions that caused the simulated biting rates to be largest and mosquito mortality rates and extrinsic incubation periods to be smallest in 2015. This event followed the suspected introduction of ZIKV in Brazil in 2013. The ZIKV outbreak in Latin America has very likely been fueled by the 2015-2016 El Niño climate phenomenon affecting the region. The highest transmission risk globally is in South America and tropical countries where Ae. aegypti is abundant. Transmission risk is strongly seasonal in temperate regions where Ae. albopictus is present, with significant risk of ZIKV transmission in the southeastern states of the United States, in southern China, and to a lesser extent, over southern Europe during the boreal summer season.

Related collections

Most cited references 45

Record: found
Abstract: found
Article: found

Is Open Access

Zika Virus Outside Africa

Edward B. Hayes (2009)

In April 2007, an outbreak of illness characterized by rash, arthralgia, and conjunctivitis was reported on Yap Island in the Federated States of Micronesia. Serum samples from patients in the acute phase of illness contained RNA of Zika virus (ZIKV), a flavivirus in the same family as yellow fever, dengue, West Nile, and Japanese encephalitis viruses. These findings show that ZIKV has spread outside its usual geographic range ( 1 , 2 ). Sixty years earlier, on April 18, 1947, fever developed in a rhesus monkey that had been placed in a cage on a tree platform in the Zika Forest of Uganda ( 3 ). The monkey, Rhesus 766, was a sentinel animal in the Rockefeller Foundation’s program for research on jungle yellow fever. Two days later, Rhesus 766, still febrile, was brought to the Foundation’s laboratory at Entebbe and its serum was inoculated into mice. After 10 days all mice that were inoculated intracerebrally were sick, and a filterable transmissible agent, later named Zika virus, was isolated from the mouse brains. In early 1948, ZIKV was also isolated from Aedes africanus mosquitoes trapped in the same forest ( 4 ). Serologic studies indicated that humans could also be infected ( 5 ). Transmission of ZIKV by artificially fed Ae. aegypti mosquitoes to mice and a monkey in a laboratory was reported in 1956 ( 6 ). ZIKV was isolated from humans in Nigeria during studies conducted in 1968 and during 1971–1975; in 1 study, 40% of the persons tested had neutralizing antibody to ZIKV ( 7 – 9 ). Human isolates were obtained from febrile children 10 months, 2 years (2 cases), and 3 years of age, all without other clinical details described, and from a 10 year-old boy with fever, headache, and body pains ( 7 , 8 ). From 1951 through 1981, serologic evidence of human ZIKV infection was reported from other African countries such as Uganda, Tanzania, Egypt, Central African Republic, Sierra Leone ( 10 ), and Gabon, and in parts of Asia including India, Malaysia, the Philippines, Thailand, Vietnam, and Indonesia ( 10 – 14 ). In additional investigations, the virus was isolated from Ae. aegypti mosquitoes in Malaysia, a human in Senegal, and mosquitoes in Côte d’Ivoire ( 15 – 17 ). In 1981 Olson et al. reported 7 people with serologic evidence of ZIKV illness in Indonesia ( 11 ). A subsequent serologic study indicated that 9/71 (13%) human volunteers in Lombok, Indonesia, had neutralizing antibody to ZIKV ( 18 ). The outbreak on Yap Island in 2007 shows that ZIKV illness has been detected outside of Africa and Asia (Figure 1). Figure 1 Approximate known distribution of Zika virus, 1947–2007. Red circle represents Yap Island. Yellow indicates human serologic evidence; red indicates virus isolated from humans; green represents mosquito isolates. Dynamics of Transmission ZIKV has been isolated from Ae. africanus, Ae. apicoargenteus, Ae. luteocephalus, Ae. aegypti, Ae vitattus, and Ae. furcifer mosquitoes ( 9 , 15 , 17 , 19 ). Ae. hensilii was the predominant mosquito species present on Yap during the ZIKV disease outbreak in 2007, but investigators were unable to detect ZIKV in any mosquitoes on the island during the outbreak ( 2 ). Dick noted that Ae. africanus mosquitoes, which were abundant and infected with ZIKV in the Zika Forest, were not likely to enter monkey cages such as the one containing Rhesus 766 ( 5 ) raising the doubt that the monkey might have acquired ZIKV from some other mosquito species or through some other mechanism. During the studies of yellow fever in the Zika Forest, investigators had to begin tethering monkeys in trees because caged monkeys did not acquire yellow fever virus when the virus was present in mosquitoes ( 5 ). Thus, despite finding ZIKV in Ae. Africanus mosquitoes, Dick was not sure whether or not these mosquitoes were actually the vector for enzootic ZIKV transmission to monkeys. Boorman and Porterfield subsequently demonstrated transmission of ZIKV to mice and monkeys by Ae. aegypti in a laboratory ( 6 ). Virus content in the mosquitoes was high on the day of artificial feeding, dropped to undetectable levels through day 10 after feeding, had increased by day 15, and remained high from days 20 through 60 ( 6 ). Their study suggests that the extrinsic incubation period for ZIKV in mosquitoes is ≈10 days. The authors cautioned that their results did not conclusively demonstrate that Ae. aegypti mosquitoes could transmit ZIKV at lower levels of viremia than what might occur among host animals in natural settings. Nevertheless, their results, along with the viral isolations from wild mosquitoes and monkeys and the phylogenetic proximity of ZIKV to other mosquito-borne flaviviruses, make it reasonable to conclude that ZIKV is transmitted through mosquito bites. There is to date no solid evidence of nonprimate reservoirs of ZIKV, but 1 study did find antibody to ZIKV in rodents ( 20 ). Further laboratory, field, and epidemiologic studies would be useful to better define vector competence for ZIKV, to determine if there are any other arthropod vectors or reservoir hosts, and to evaluate the possibility of congenital infection or transmission through blood transfusion. Virology and Pathogenesis ZIKV is an RNA virus containing 10,794 nucleotides encoding 3,419 amino acids. It is closely related to Spondweni virus; the 2 viruses are the only members of their clade within the mosquito-borne cluster of flaviviruses (Figure 2) ( 1 , 21 , 22 ). The next nearest relatives include Ilheus, Rocio, and St. Louis encephalitis viruses; yellow fever virus is the prototype of the family, which also includes dengue, Japanese encephalitis, and West Nile viruses ( 1 , 21 ). Studies in the Zika Forest suggested that ZIKV infection blunted the viremia caused by yellow fever virus in monkeys but did not block transmission of yellow fever virus ( 19 , 23 ). Figure 2 Phylogenetic relationship of Zika virus to other flaviviruses based on nucleic acid sequence of nonstructural viral protein 5, with permission from Dr Robert Lanciotti ( 1 ). Enc, encephalitis; ME, meningoencephalitis. Information regarding pathogenesis of ZIKV is scarce but mosquito-borne flaviviruses are thought to replicate initially in dendritic cells near the site of inoculation then spread to lymph nodes and the bloodstream ( 24 ). Although flaviviral replication is thought to occur in cellular cytoplasm, 1 study suggested that ZIKV antigens could be found in infected cell nuclei ( 25 ). To date, infectious ZIKV has been detected in human blood as early as the day of illness onset; viral nucleic acid has been detected as late as 11 days after onset ( 1 , 26 ). The virus was isolated from the serum of a monkey 9 days after experimental inoculation ( 5 ). ZIKV is killed by potassium permanganate, ether, and temperatures >60°C, but it is not effectively neutralized with 10% ethanol ( 5 ). Clinical Manifestations The first well-documented report of human ZIKV disease was in 1964 when Simpson described his own occupationally acquired ZIKV illness at age 28 ( 27 ). It began with mild headache. The next day, a maculopapular rash covered his face, neck, trunk, and upper arms, and spread to his palms and soles. Transient fever, malaise, and back pain developed. By the evening of the second day of illness he was afebrile, the rash was fading, and he felt better. By day three, he felt well and had only the rash, which disappeared over the next 2 days. ZIKV was isolated from serum collected while he was febrile. In 1973, Filipe et al. reported laboratory-acquired ZIKV illness in a man with acute onset of fever, headache, and joint pain but no rash ( 26 ). ZIKV was isolated from serum collected on the first day of symptoms; the man’s illness resolved in ≈1 week. Of the 7 ZIKV case-patients in Indonesia described by Olson et al. all had fever, but they were detected by hospital-based surveillance for febrile illness ( 11 ). Other manifestations included anorexia, diarrhea, constipation, abdominal pain, and dizziness. One patient had conjunctivitis but none had rash. The outbreak on Yap Island was characterized by rash, conjunctivitis, and arthralgia ( 1 , 2 ). Other less frequent manifestations included myalgia, headache, retroorbital pain, edema, and vomiting ( 2 ). Diagnosis Diagnostic tests for ZIKV infection include PCR tests on acute-phase serum samples, which detect viral RNA, and other tests to detect specific antibody against ZIKV in serum. An ELISA has been developed at the Arboviral Diagnostic and Reference Laboratory of the Centers for Disease Control and Prevention (Ft. Collins, CO, USA) to detect immunoglobulin (Ig) M to ZIKV ( 1 ). In the samples from Yap Island, cross-reactive results in sera from convalescent-phase patients occurred more frequently among patients with evidence of previous flavivirus infections than among those with apparent primary ZIKV infections ( 1 , 2 ). Cross-reactivity was more frequently noted with dengue virus than with yellow fever, Japanese encephalitis, Murray Valley encephalitis, or West Nile viruses, but there were too few samples tested to derive robust estimates of the sensitivity and specificity of the ELISA. IgM was detectable as early as 3 days after onset of illness in some persons; 1 person with evidence of previous flavivirus infection had not developed IgM at day 5 but did have it by day 8 ( 1 ). Neutralizing antibody developed as early as 5 days after illness onset. The plaque reduction neutralization assay generally has improved specificity over immunoassays, but may still yield cross-reactive results in secondary flavivirus infections. PCR tests can be conducted on samples obtained less than 10 days after illness onset; 1 patient from Yap Island still had detectable viral RNA on day 11 ( 1 ). In general, diagnostic testing for flavivirus infections should include an acute-phase serum sample collected as early as possible after onset of illness and a second sample collected 2 to 3 weeks after the first. Public Health Implications Because the virus has spread outside Africa and Asia, ZIKV should be considered an emerging pathogen. Fortunately, ZIKV illness to date has been mild and self-limited, but before West Nile virus caused large outbreaks of neuroinvasive disease in Romania and in North America, it was also considered to be a relatively innocuous pathogen ( 28 ). The discovery of ZIKV on the physically isolated community of Yap Island is testimony to the potential for travel or commerce to spread the virus across large distances. A medical volunteer who was on Yap Island during the ZIKV disease outbreak became ill and was likely viremic with ZIKV after her return to the United States ( 2 ). The competence of mosquitoes in the Americas for ZIKV is not known and this question should be addressed. Spread of ZIKV across the Pacific could be difficult to detect because of the cross-reactivity of diagnostic flavivirus antibody assays. ZIKV disease could easily be confused with dengue and might contribute to illness during dengue outbreaks. Recognition of the spread of ZIKV and of the impact of ZIKV on human health will require collaboration between clinicians, public health officials, and high-quality reference laboratories. Given that the epidemiology of ZIKV transmission on Yap Island appeared to be similar to that of dengue, strategies for prevention and control of ZIKV disease should include promoting the use of insect repellent and interventions to reduce the abundance of potential mosquito vectors. Officials responsible for public health surveillance in the Pacific region and the United States should be alert to the potential spread of ZIKV and keep in mind the possible diagnostic confusion between ZIKV illness and dengue.

0 comments Cited 319 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: found

Is Open Access

Differential Susceptibilities of Aedes aegypti and Aedes albopictus from the Americas to Zika Virus

Thais Chouin-Carneiro, Anubis Vega-Rúa, Marie Vazeille … (2016)

Background Since the major outbreak in 2007 in the Yap Island, Zika virus (ZIKV) causing dengue-like syndromes has affected multiple islands of the South Pacific region. In May 2015, the virus was detected in Brazil and then spread through South and Central America. In December 2015, ZIKV was detected in French Guiana and Martinique. The aim of the study was to evaluate the vector competence of the mosquito spp. Aedes aegypti and Aedes albopictus from the Caribbean (Martinique, Guadeloupe), North America (southern United States), South America (Brazil, French Guiana) for the currently circulating Asian genotype of ZIKV isolated from a patient in April 2014 in New Caledonia. Methodology/Principal Findings Mosquitoes were orally exposed to an Asian genotype of ZIKV (NC-2014-5132). Upon exposure, engorged mosquitoes were maintained at 28°±1°C, a 16h:8h light:dark cycle and 80% humidity. 25–30 mosquitoes were processed at 4, 7 and 14 days post-infection (dpi). Mosquito bodies (thorax and abdomen), heads and saliva were analyzed to measure infection, dissemination and transmission, respectively. High infection but lower disseminated infection and transmission rates were observed for both Ae. aegypti and Ae. albopictus. Ae. aegypti populations from Guadeloupe and French Guiana exhibited a higher dissemination of ZIKV than the other Ae. aegypti populations examined. Transmission of ZIKV was observed in both mosquito species at 14 dpi but at a low level. Conclusions/Significance This study suggests that although susceptible to infection, Ae. aegypti and Ae. albopictus were unexpectedly low competent vectors for ZIKV. This may suggest that other factors such as the large naïve population for ZIKV and the high densities of human-biting mosquitoes contribute to the rapid spread of ZIKV during the current outbreak.

0 comments Cited 279 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: found

Is Open Access

Zika Virus in Gabon (Central Africa) – 2007: A New Threat from Aedes albopictus?

Gilda Grard, Mélanie Caron, Illich Mombo … (2014)

Introduction Zika virus (ZIKV) is a mosquito-borne flavivirus phylogenetically related to dengue viruses. Following its first isolation in 1947 from a sentinel monkey placed in the Zika forest in Uganda [1], serological surveys and viral isolations (reviewed in [2]) suggested that ZIKV (i) ranged widely throughout Africa and Asia, and (ii) circulated according to a zoonotic cycle involving non-human primates and a broad spectrum of potential mosquito vector species. In Africa, ZIKV has been isolated from humans in western and central countries such as Senegal, Nigeria, Central African Republic and Uganda [3]–[7]. Serological surveys (reviewed in [2]) suggested that its geographic range might extend not only to other West and Central African countries (Sierra Leone, Cameroon, Gabon), but also to eastern (Ethiopia, Kenya, Tanzania and Somalia) and northern Africa (Egypt). ZIKV has also been isolated from mosquitoes collected in Senegal, Ivory Coast, Burkina Faso, Central African Republic and Uganda [1], [6], [8], [9]. These mosquitoes mainly belonged to sylvan or rural species of the genus Aedes, and more precisely to the Aedimorphus, Diceromyia and Stegomyia subgenera. The virus has also been isolated in West Africa (Burkina Faso, Senegal and Ivory Coast) [6], [9] and Asia [10] from Aedes aegypti, a species being considered the main ZIKV epidemic vector outside Africa [11]. Moreover, Ae. aegypti was shown experimentally to be an efficient ZIKV vector [12]–[14]. Despite its apparent broad geographic distribution in Africa and Asia, only sporadic cases of human ZIKV infection have been reported. This virus received little attention until its sudden emergence in Yap Island (Micronesia) in 2007, which involved about 5000 persons [15], [16], revealing its epidemic capacity. Patients develop a mild dengue-like syndrome, including fever, headache, rash, arthralgia and conjunctivitis. This clinical similarity with other, more commonly diagnosed arboviral infections such as chikungunya (CHIKV) and dengue (DENV), might delay the diagnosis and/or lead to underestimation of ZIKV infections. Here, we report the first direct evidence of ZIKV epidemic activity in Central Africa, and its occurrence in an urban environment during concomitant CHIKV/DENV outbreaks in Libreville, the capital of Gabon, in 2007. We also report the first detection of ZIKV in the Asian tiger mosquito, Ae. albopictus. These findings, together with the global geographic expansion of this invasive species and its increasing importance as epidemic vector of arboviruses as exemplified by CHIKV adaptation, suggest that the prerequisites for the emergence and global spread of Zika virus may soon be satisfied. Materials and Methods Study In 2007 and 2010, Gabon recorded simultaneous outbreaks of CHIKV (genus Alphavirus) and DENV (genus Flavivirus) infections. The 2007 outbreaks primarily affected Libreville, the capital of Gabon, and subsequently extended northwards to several other towns [17], while the 2010 outbreaks occurred in the south-eastern provinces [18]. To detect other circulating arboviruses, we conducted a retrospective study based on molecular screening of 4312 sera from symptomatic patients presenting to healthcare centers; 24.7% of the samples were obtained during the 2007 outbreaks, 9.7% during the inter-epidemic period, and 65.5% during the 2010 outbreaks (data not shown). We also analyzed a collection of 4665 mosquitoes captured during the same period and split into 247 pools according to the species, date and sampling site (Table 1, see [18] and [19] for the details of the methodology used for mosquito trapping). 10.1371/journal.pntd.0002681.t001 Table 1 Mosquito collections screened for Zika virus. Libreville 2007 Franceville 2010 Total Species Pools Mos. Id. (No.) ZIKV CHIKV DENV Libreville suburb Pools Mos. Pools (%) Mos. Aedes albopictus 91 2130 T64 (21) + + − Nzeng-Ayong 46 571 137 (55.4) 2701 T713 (25) + + − Alenkiri T707 (25) − − + Alenkiri T717 (25) − − + Alenkiri T723 (25) − − + Alenkiri T724 (6) − + − Alenkiri T21 (25) − + − Avorembam T22 (25) − + − Avorembam T280 (1) − + − Bel-Air Aedes aegypti * 40 853 5 28 45 (18.2) 881 Aedes simpsoni complex 10 52 5 36 15 (6.1) 88 Anopheles gambiae * 8 72 8 (3.2) 72 Mansonia africana 6 86 6 (2.4) 86 Mansonia uniformis * 4 99 4 (1.6) 99 Culex quinquefasciatus 29 690 29 (11.7) 690 Culex spp. 1 22 1 (0.4) 22 Eretmapodites quinquevittatus * 2 26 2 (0.8) 26 Total 189 4004 58 661 247 4665 * Species in which Zika virus has previously been detected. (%) The percentage of each mosquito species in the collection is indicated in brackets. Mos.: Number of mosquitoes included in a pool. Id. (No.): Mosquito pool positive for ZIKV, CHIKV or DENV, followed by the total number of included mosquitoes in the pool indicated in brackets. Ethics statement The Centre International de Recherches Médicales de Franceville (CIRMF) and the Gabonese Ministry of Health cooperated in the 2007 and 2010 outbreak response and management, that included blood sampling for laboratory diagnostic and epidemiological survey. The study was approved by our Institutional review board (Conseil scientifique du CIRMF). Symptomatic patients presented to health care centers for medical examination. All patients were informed that blood sampling was required for laboratory diagnosis of suspected acute infections, such as malaria, dengue or chikungunya fever. During the two outbreaks, given the urgency of diagnosis, only oral consent was obtained for blood sampling and was approved by the institutional review board. However during the active surveillance study that was performed between the two outbreaks (described in reference [18]), written consent could be obtained. Virus identification and characterization Primary molecular screening was based on hemi-nested reverse-transcription PCR (hnRT-PCR) with the generic primers PF1S/PF2Rbis/PF3S targeting highly conserved motifs in the flavivirus polymerase (NS5) gene (280-bp) [20]. Yellow fever virus RNA (vaccinal strain 17D) was used as a positive control. A second screening was performed with a ZIKV-specific real-time PCR method using the primers-probe system ZIKV-1086/ZIKV-1162c/ZIKV-1107-FAM [16], also targeting a short sequence (160 bp) of the NS5 gene. Virus isolation was attempted on the Vero and C6/36 cell lines but was unsuccessful, presumably because of low viral titers (despite two patients presenting only 1 and 4 days after symptom onset), and unsuitable initial storage conditions. To further characterize the Gabonese ZIKV strains, partial envelope (E) (841 bp) and NS3 (772 bp) gene sequences were amplified by conventional nested RT-PCR with specific primers derived from published ZIKV sequences. The primer pairs targeting the E gene were ZIK-ES1 (TGGGGAAAYGGDTGTGGACTYTTTGG)/ZIK-ER1 (CCYCCRACTGATCCRAARTCCCA) and ZIK-ES2 (GGGAGYYTGGTGACATGYGCYAAGTT)/ZIK-ER2 (CCRATGGTGCTRCCACTCCTRTGCCA). The primer pairs for NS3 amplification were ZIK-NS3FS (GGRGTCTTCCACACYATGTGGCACGTYACA)/ZIK-NS3FR (TTCCTGCCTATRCGYCCYCTCCTCTGRGCAGC) and ZIK-X1 (AGAGTGATAGGACTCTATGG)/ZIK-X2 (GTTGGCRCCCATCTCTGARATGTCAGT). Phylogenetic analysis The E and NS3 sequences obtained from one Gabonese patient were concatenated and analyzed using a set of previously published ZIKV sequences. Phylogenetic relationships were reconstructed with the maximum likelihood algorithm implemented in PhyML [21] (available at http://www.atgc-montpellier.fr/phyml/) with best of NNI (Nearest Neighbor Interchange) and SPR (Subtree Pruning and Regrafting) criteria for tree topology searching, and the GTR model of nucleotide substitutions. The Gamma distribution of rate heterogeneity was set to 4 categories, with a proportion of invariable sites and an alpha parameter estimated from the dataset. Branch support was assessed from 100 bootstrap replicates. Tree reconstructions were also performed by Bayesian inference with MrBayes v3.2 [22] under the GTR+I+G model of nucleotide substitutions, and with the distance neighbor-joining method [23] implemented in MEGA5 [24] with confidence levels estimated for 1000 replicates. To test for phylogenetic discrepancies, tree reconstructions were also performed independently from the envelope dataset and the NS3 dataset with PhyML according to the parameters described above. The resulting trees were visualized with the FigTree software (Available at: http://tree.bio.ed.ac.uk/software/figtree/), and rooted on midpoint for clarity. The Genbank accession numbers for the Gabonese ZIKV strain are KF270886 (envelope) and KF270887 (NS3). Results Molecular screening The NS5 PCR products were sequenced, resulting in the first ZIKV RNA detection in a human sample (Cocobeach) and in two Ae. albopictus pools (Libreville) collected during the 2007 outbreaks. Real-time PCR was then performed, leading to the detection of four additional positive human samples, collected in 2007 in four suburbs of Libreville (Diba-Diba, Nzeng-Ayong, PK8, PK9) (Figure 1). No ZIKV was detected during the inter-epidemic period or during the 2010 outbreaks. 10.1371/journal.pntd.0002681.g001 Figure 1 Geographic distribution of Zika and chikungunya and/or dengue viruses infections in Gabon in 2007. The left-hand panel indicates Gabonese CHIKV and/or DENV cases in green circles and ZIKV cases in purple circles. The right-hand panel shows the location of Libreville suburbs where ZIKV-positive human sera (H) and mosquito pools (M) were detected. Clinical description Clinical information was available for only one ZIKV-positive patient, who had mild arthralgia, subjective fever, headache, rash, mild asthenia, myalgia, diarrhea and vomiting. No information was available on this patient's outcome. Cycle threshold values for human blood samples were high (>37 cycles), suggesting low viral loads (data not shown). Vector involvement Aedes albopictus was the predominant species collected, accounting for 55.4% of the mosquito pools, while Aedes aegypti accounted for 18.2% (Table 1). The other mosquito species consisted of members of the Aedes simpsoni complex, Anopheles gambiae, Mansonia africana, Mansonia uniformis, Culex quinquefasciatus, Eretmapodites quinquevittatus and unidentified Culex species. Positive mosquito pools were captured from two suburbs (Nzeng-Ayong and Alenkiri) where Aedes albopictus was the predominant species (Figure 1, Table 1). Sequences analysis As isolation on the Vero and C6/36 cell lines failed, the Gabonese ZIKV strain was further characterized by partial sequencing of the E and NS3 genes. Phylogenetic analysis was performed on concatenated E and NS3 sequences from one Cocobeach serum sample. The resulting tree topology (Figure 2) was similar to that previously obtained from the complete coding sequences, corroborating Asian and African distinct lineages [2]. The African lineage was further split into two groups, one containing the genetic variants of the MR766 strain (Uganda, 1947) and the second including West African strains (Nigeria, 1968; Senegal, 1984) and the new ZIKV sequence from Gabon, at a basal position. Phylogenetic trees derived from the E and NS3 partial sequences resulted in a similar topology, apart from the weakly supported branching pattern for the MR766 variant DQ859059, oscillating between the two African sister groups (Supporting Figure S1). The deletions in potential glycosylation sites previously reported for the Nigerian ZIKV strain and two variants of the Ugandan strain MR766 (sequences AY632535 and DQ859059) [2] were absent from the Gabonese ZIKV sequence. 10.1371/journal.pntd.0002681.g002 Figure 2 Phylogenetic relationships between concatenated sequences of the Zika virus envelope and NS3 genes. The tree was constructed with the maximum likelihood algorithm implemented in PhyML and rooted on midpoint. Bootstrap values are shown at the respective nodes, followed by bootstrap values resulting from NJ analysis and, finally, the posterior probability resulting from Bayesian analysis. The scale bar indicates the number of substitutions per site. The GenBank accession numbers for the 2007 Gabonese ZIKV isolate are KF270886 (envelope) and KF270887 (NS3). Discussion Evidence of human ZIKV infections in Central Africa is limited to one isolate from RCA in 1991 [6] and two serological surveys performed 50 years ago in Gabon [25], [26]. No report of human ZIKV infections was made in other countries of the Congo basin forest block, despite probable circulation through a sylvan natural cycle. We provide here the first direct evidence of human ZIKV infections in Gabon, as well as its occurrence in an urban transmission cycle, and the probable role of Ae. albopictus as an epidemic vector. Our phylogenetic results are in agreement with the tree topology previously obtained with complete coding sequences of ZIKV strains, showing an African lineage and an Asian lineage [2]. The branching pattern obtained here suggests that ZIKV emergence in Gabon did not result from strain importation but rather from the diversification and spread of an ancestral strain belonging to the African lineage. The identification of ZIKV in two different localities of Gabon (Cocobeach and Libreville) suggests that the virus was widespread rather than restricted to a single epidemic focus. The simultaneous occurrence of human and mosquito infections in Libreville also suggests that the virus circulated in 2007 in an epidemic cycle rather than as isolated cases introduced from sylvan cycles. Of note, ZIKV transmission occurred here in a previously undocumented urban cycle, supporting the potential for urbanization suggested in 2010 by Weaver and Reisen [27]. While some mosquito species (including Ae. aegypti) previously found to be associated with ZIKV, were captured and tested here, only Ae. albopictus pools were positive for this virus. Moreover, this species largely outnumbered Ae. aegypti in the suburbs of Libreville where human cases were detected, suggesting that Ae. albopictus played a major role in ZIKV transmission in Libreville. The ratio of ZIKV-positive Ae. albopictus pools is similar to that reported for DENV-positive pools, suggesting that these two viruses infect similar proportions of mosquitoes. The small number of recorded human ZIKV cases, by comparison with DENV cases, may be due to the occurrence of subclinical forms of ZIKV infections that did not required medical attention. Thus, an underlying ZIKV epidemic transmission might have been masked by concomitant CHIKV/DENV outbreaks. The natural histories of CHIKV and ZIKV display several similarities. Before the large Indian Ocean outbreaks in 2005–2007, chikungunya fever was a neglected arboviral disease. Both viruses are phylogenetically closely related to African viruses [28]–[30] suggesting they probably originated in Africa, where they circulated in an enzootic sylvan cycle involving non-human primates and a wide variety of mosquito species, human outbreaks presumably being mediated by Ae. aegypti [5], [31]. In Asia, both viruses are thought to circulate mainly in a human-mosquito cycle involving Ae. aegypti [11], [14], [31]. Together with the recent Yap Island outbreak, this prompted some researchers to re-examine the susceptibility of Ae. aegypti to ZIKV infection [14]. However, it must be noted that the vector of the Yap Island outbreak was not definitely identified since the predominant potential vector species Aedes hensilli remained negative [15], and that ZIKV has been isolated only once from Ae. aegypti in Asia [10], so that its vector status in natura is not confirmed. Additionally, a ZIKV enzootic transmission cycle involving non-human primates in Asia and sylvatic vectors cannot be ruled out as suggested by serologic studies carried on orangutang [32], [33]. Finally both CHIKV and ZIKV have shown their ability to adapt to a new vector, Ae. albopictus, upon introduction in an environment where their primary vector was outnumbered. This mosquito species being native to South-East Asia, our findings may help to explain human ZIKV transmission in Asia. Aedes albopictus was first introduced in Africa in 1991 [34] and detected in Gabon in 2007, where its invasion likely contributed to the emergence of CHIKV and DENV in this country [17]–[19], [35]. Multiple lines of evidence supporting its increasing impact as an arboviral vector have also been obtained during CHIKV outbreaks in the Indian Ocean region (2005–2007) and in Italy (2007) [36], [37] through viral evolutionary convergence of Ae. albopictus adaptive mutations [38]–[41]. Whether or not the transmission of ZIKV in Central Africa was also link to such an adaptative mutation of ZIKV to Ae. albopictus cannot be answered at this stage. Wong and colleagues [42] have just demonstrated experimentally that Ae. albopictus strains from Singapore were orally receptive to the Ugandan strain of ZIKV sampled in 1947, suggesting that this virus-vector association in Africa may have been previously prevented because the required ecological conditions did not yet exist. However, given the relatively low ZIKV viral loads previously reported in patients - with an order of magnitude of 105 copies/ml compared to 107 to 109 copies/ml for CHIKV [16], [18], [40] - the oral infectivity for Ae. albopictus may seem at least as critical as it was for CHIKV in establishing this new human-mosquito cycle. Why ZIKV has not yet been detected in the areas where DENV and CHIKV have already spread via Ae. albopictus is unclear, but it may be an ongoing process which we are just starting to detect. The spread of CHIKV reflects the ability of arboviruses to adapt to alternative hosts, and the resulting public health concerns in both developed and developing countries. Is ZIKV the next virus to succeed CHIKV as an emerging global threat? The increasing geographic range of Ae. albopictus in Africa, Europe, and the Americas [34], [36], [43], [44], together with the ongoing ZIKV outbreak in French Polynesia at the time of writing [45] suggest this possibility should be seriously considered. Analysis of sylvan and urban transmission cycles, together with viral genetics and vector competence studies, are now required to assess (i) how ZIKV is able to establish a sustainable transmission cycle involving this new vector in Central Africa, (ii) vector(s)-virus relationships in Asia, and (iii) the risk of importation and spread to new areas where Ae. albopictus occurs as well. Supporting Information Figure S1 Phylogenetic trees reconstructed from the E and NS3 datasets. Analyses were performed with the maximum likelihood algorythm implemented in PhyML and parameters set as described in the Methods section. Trees are rooted on midpoint. (TIF) Click here for additional data file.