Diffuse intrinsic pontine glioma (DIPG) and other histone H3 K27M (H3K27M) mutated
diffuse midline gliomas (DMGs)
1–5
are aggressive and universally fatal pediatric brain cancers
6
. Chimeric antigen receptor (CAR)-expressing T-cells have mediated impressive clinical
activity in B-cell malignancies
7–10
, and recent results suggest benefit in CNS malignancies
11–13
. Here, we report that patient-derived H3K27M-mutant glioma cell cultures exhibit
uniform, high expression of the disialoganglioside GD2. Anti-GD2 CAR T-cells incorporating
a 4-1BBz costimulatory domain
14
demonstrated robust antigen-dependent cytokine generation and DMG cell killing in
vitro. In five independent patient-derived H3K27M+ DMG orthotopic xenograft models,
systemic administration of GD2-CAR T-cells cleared engrafted tumors, save a small
number of residual GD2-low glioma cells. To date, GD2-targeting CAR T-cells have been
well-tolerated in clinical trials
15–17
. While GD2-CAR T-cell administration was tolerated in the majority of animals, peri-tumoral
neuroinflammation during the acute phase of antitumor activity resulted in hydrocephalus
that was lethal in a fraction of animals. Given the precarious neuroanatomical location
of midline gliomas, careful monitoring and aggressive neurointensive care management
will be required for human translation. With a cautious multidisciplinary clinical
approach, GD2-CAR T-cell therapy for H3K27M+ diffuse gliomas of the pons, thalamus
and spinal cord could prove transformative for these lethal childhood cancers.
Immune checkpoint inhibitors mediate substantial benefit in adult cancers refractory
to traditional therapies, but have not yet demonstrated widespread benefit in sporadic
childhood cancers, possibly due to the paucity of neoantigens in these diseases
18
. In contrast, CAR T cell therapies have mediated highly potent effects in childhood
B-cell acute lymphoblastic leukemia (B-ALL). To identify potential targets for CAR
T-cell immunotherapy in DIPG, we screened cell surface antigens using an antibody
array in patient-derived DIPG cultures (Fig. 1a, Supplementary Table 1). Significant
overlap between independent patient-derived cultures (Fig. 1b), suggests conservation
of a core group of surface markers across DIPG patients. From these common targets,
we observed that the disialoganglioside GD2 was expressed at high levels on each of
the four patient-derived DIPG cultures screened (Fig. 1a). Hit validation by flow
cytometry in six H3K27M+ DIPG cultures confirmed uniform, high GD2 expression in all
H3K27M+ DIPG cultures examined, including those with the H3F3A K27M mutation (SU-DIPG-6,
13, 17, 25, 29) and the less-common HIST1H3B K27M mutation (SU-DIPG-21)
2,19,20
(Fig. 1c). GD2 expression was far lower in two histone-3 WT pediatric high-grade gliomas
(pHGG), including a case of H3WT DIPG (Fig. 1c). To assess whether transcriptional
perturbations resulting from the H3K27M mutation might be linked to GD2 overexpression,
we profiled gene expression of ganglioside synthesis enzymes in patient-derived DIPG
and pHGG cultures and found higher expression of upstream ganglioside synthesis enzymes
in H3K27M+ cultures (Supplementary Figure 1). Double immunostaining of primary human
DIPG tissue for H3K27M to identify infiltrating malignant cells and GD2 confirmed
local expression of GD2 in the native tumor context (Fig. 1d).
GD2-targeting immunotherapies are currently under clinical and preclinical investigation
in several diseases, including neuroblastoma, osteosarcoma, and melanoma
14–17,21–24
. Unlike monoclonal antibodies which do not efficiently cross the blood-brain barrier,
activated T-cells can infiltrate the CNS following adoptive transfer
7,25
. We generated human GD2-targeting CAR T-cells incorporating a 4-1BBz costimulatory
domain (GD2-CAR)
14
(Fig. 1e) and observed significant GD2-dependent killing (Fig. 1f) and cytokine generation
(Fig. 1g) upon exposure to patient-derived DIPG cultures relative to control CD19-CAR
T-cells incorporating 4-1BBz (CD19-CAR). Notably, GD2-CAR T-cells do not produce significant
cytokines or induce cell killing when exposed to the H3WT, GD2-negative VUMC-DIPG10
patient-derived DIPG culture, providing evidence of therapeutic specificity of GD2-CAR
T-cells toward H3K27M DIPG. To further confirm the targeting specificity of GD2-CAR
T-cells, we used CRISPR-Cas9-mediated deletion of GD2 synthase (B4GALNT1) in patient-derived
DIPG cells to generate GD2 knockout DIPG cells (Supplementary Figure 2). Loss of GD2
antigen expression eliminated cytokine production by the GD2-CAR T-cells in comparison
to untreated or DIPG cells electroporated with a control guide sequence targeting
the AAVS1 locus (Fig. 1h). While GD2 expression in normal brain has been previously
reported
26
, GD2-CAR T-cell therapy in human trials in which the targeting domain is derived
from the same monoclonal antibody (14g2a) have reported no cases of significant neurotoxicity
15–17
. Moreover, intrathecal and intraventricular administration of anti-GD2 antibody radioconjugates
in patients has been well-tolerated in clinical trials
27,28
. Taken together, these findings indicate specific reactivity of GD2-CAR T-cells to
H3K27M+ glioma cells.
To evaluate in vivo efficacy of GD2-CAR T-cells against DIPG, we prepared orthotopic
mouse xenografts of DIPG cultures derived from post-mortem patient tissue. DIPG cultures
were transduced with a luciferase-expressing construct to enable longitudinal monitoring
of tumor burden. These xenograft models faithfully recapitulate the diffusely infiltrating
histology of DIPG
29,30
. Mice were distributed by tumor burden into equivalent treatment and control groups
before receiving 1×107 GD2-CAR or CD19-CAR T-cells by a single intravenous injection
7-8 weeks after establishment of pontine xenografts. Within 40 days post-treatment
(DPT), marked reductions in tumor burden were observed across two independent GD2-CAR
T-cell treated cohorts of mice bearing SU-DIPG6 xenografts
31
(Fig. 2a). Similar results were observed in a second patient-derived xenograft model,
SU-DIPG13FL
30
(Fig. 2e). All GD2-CAR treated animals demonstrated complete tumor clearance by bioluminescence
imaging (Supplementary Figure 3). By contrast, no mice in the CD19-CAR T-cell control
groups exhibited significant tumor regression. At 50 DPT brains were harvested, and
immunostaining for the mutant histone H3K27M – present in all engrafted tumor cells
– revealed that GD2-CAR treated tumors had been largely eradicated (Fig. 2c,d,g,h,i).
The small number of H3K27M+ tumor cells that remain after treatment are negative for
GD2 by immunostaining (Supplementary Figure 4). We hypothesize that the potency of
the GD2-CAR in this model is driven by very high expression of the target antigen
in H3K27M mutant DIPG, which was consistently higher than that present on GD2+ neuroblastoma
and sarcoma cell lines (Supplementary Figure 5). This study adds to the growing evidence
suggesting that CAR T-cells are more efficacious at high levels of target antigen
expression
32,33
.
Most patient-derived orthotopic DIPG xenograft models require many months for lethality,
limiting the ability to monitor survival benefit due to development of xenogeneic
graft versus host disease (GVHD) after treatment with human T-cells
34
. We therefore used SU-DIPG-13P*, a model that exhibits a dense pattern of growth
histologically
35
, and is consistently lethal within one month. Substantial improvement in survival
was seen in GD2-CAR treated animals compared with CD19-CAR treated controls (Fig.
3a). However, in one out of three independent cohorts, lethal toxicity occurred in
several GD2-CAR T-cell treated animals, while all GD2-CAR T-cell treated animals in
the other cohorts survived to endpoint (Supplementary Figure 6). GD2-CAR treated animals
that survived the initial phase of glioma clearance returned to a visibly healthy
state indistinguishable from untreated immunodeficient mice until the onset of GVHD
symptoms 4+ weeks after CAR administration that invariably triggered endpoint criteria
(Supplementary Figure 7). Histologic analysis of the brains of endpoint GD2-CAR treated
animals reveals clearance of this high-burden tumor while surrounding neural tissues
appear grossly normal (Fig. 3b).
To better understand the etiology of treatment-related toxicity in these DIPG xenograft
models, we examined the brains of treated SU-DIPG6 xenograft-bearing mice acutely
at DPT14 (Fig. 3c). GD2-CAR treatment was accompanied by a widespread inflammatory
infiltrate involving brain parenchyma, meninges and ventricles that was most prominent
in the brainstem. Ventriculomegaly was observed, consistent with hydrocephalus. We
observed histologically normal-appearing neurons present throughout the pons, hippocampus,
and cortex of GD2-CAR T-cell-treated animals with no evidence of neuronal cell killing
nor other tissue destruction in this model (Fig. 3c). Thus, neuropathological evaluation
indicates that the toxicity described above results from brainstem inflammation and
hydrocephalus due to fourth ventricular compression during the tumor-clearing interval
and not on-target, off-tumor toxicity of GD2-CAR T-cells.
To visualize CAR T-cell infiltration into the parenchyma and tumor, we generated GD2-4-1BBz-mCherry
and CD19-4-1BBz-mCherry fusion constructs (Fig. 3d). By DPT7, GD2-CAR T-cells are
extensively distributed throughout the leptomeninges of treated animals, leptomeningeal
tumor has been largely eradicated, and few mCherry+ cells are present within the brain
parenchyma (Fig. 3h, Supplemental Figure 8). By DPT14, mCherry+ GD2-CAR T-cells had
widely infiltrated throughout the parenchyma and numerous foci of Iba1+ macrophages
(Fig. 3e) are present in the xenografted site, along with extensive apoptotic cleaved
caspase 3+ cells (Fig. 3f). Notably, very few cleaved caspase 3+ apoptotic cells are
neurons as identified by NeuN double immunostaining (10 total apoptotic neurons identified
across 4 mice; Fig. 3g, Supplementary Figure 9). By DPT21, mCherry+ GD2-CAR T-cells
remain present throughout the CNS; whereas few CD19-CAR T-cells infiltrate the parenchyma
(Supplementary Figure 8). This supports a model in which intravenously administered
GD2-CAR T-cells enter through the meningeal lymphatic system
36
, then subsequently infiltrate brain parenchyma, although the mechanism of CAR T-cell
trafficking to the tumor remains to be defined. Given that resolution of tumor clearance
and ventriculomegaly temporally coincide in treated animals, it is likely that antigen-specific
antitumor activity, rather than on-target, off-tumor cell killing, precipitates neuroinflammation
and edema during active tumoricidal activity that results in hydrocephalus. Understanding
systemic and microenvironmental mechanisms that contribute to the resolution of acute
CAR T-induced neuroinflammation is a critical area of future study that may be best
addressed in immunocompetent models.
Recent WHO criteria place DIPG within a larger classification of diffuse midline gliomas
(DMG) expressing the H3K27M mutation (Fig. 4a)
37
. In patient-derived cultures of pediatric H3K27M thalamic (QCTB-R059, derived from
resection)
4
, and spinal cord (SU-pSCG1, derived post-mortem) DMGs, GD2 is also highly and uniformly
expressed (Fig. 4b) and triggers IFNγ and IL-2 production by GD2-CAR T-cells (Fig.
4c). While these data might reasonably predict similar efficacy of GD2-CAR T-cells
in these midline H3K27M gliomas, we reasoned that the neuroanatomical site of disease
could impact outcomes of CAR T-cell therapy. To explore in vivo GD2-CAR T-cell efficacy
in these H3K27M DMGs, we generated patient-derived orthotopic xenograft models of
spinal cord (SU-pSCG1) and thalamic (QCTB-R059) glioma. When engrafted in the medulla
to avoid the paralysis induced by injection into the spinal cord, widespread SU-pSCG1
growth is observed throughout the CNS (Fig. 4d). Systemic administration of GD2-CAR
T-cells achieves potent and lasting tumor-clearing in this spinal cord glioma xenograft
model, assessed both by longitudinal bioluminescence imaging (Fig. 4d,e) and endpoint
histology, where approximately 16 residual H3K27M+ cells per animal remained across
the sampled volume of 3 GD2-CAR T-cell treated animals (Fig. 4f,g). No mice from this
cohort died during the tumor-clearing phase.
To evaluate efficacy in H3K27M thalamic glioma, we engrafted QCTB-R059 cells orthotopically
in the thalamus (Fig. 4h). Tumor clearance was observed in this model (Fig. 4h,i,
Supplementary Figure 10) on a similar time scale as observed for DIPG and spinal cord
tumors discussed above. However substantial toxicity occurred in GD2-CAR T-cell treated
animals during the period of maximal therapeutic effect (Fig. 4k). The results are
reminiscent of “pseudoprogression”, well described following immunotherapy with checkpoint
inhibitors
38
, and highlight the danger of a robust immunotherapeutic response and subsequent neuroinflammation
in neuroanatomical locations intolerant of swelling. The thalamus – located just above
the cerebellum tentorial notch – is a precarious location for edema, particularly
when already expanded by tumor, and swelling in this location can precipitate hydrocephalus
from third ventricular compression, increased intracranial pressure and lethal transtentorial
herniation (Fig. 4j). Meticulous clinical monitoring and neurointensive management
of edema will be required for successful clinical translation of this powerful immunotherapy,
particularly for thalamic tumors, but may be insufficient to mitigate the peril of
neuroinflammation at midline brain locations susceptible to herniation.
Although stark tumor clearance occurs in these xenograft models, the persistence of
small numbers of tumor cells that are negative for GD2 expression by immunofluorescence
staining suggests that multimodal therapy could be required to circumvent potential
antigen escape (Supplementary Figure 4). While GD2 antibody-associated neuropathy
has been observed in clinical trials, it is critical to note that in GD2-CAR T-cell
human trials to date in which the targeting domain is derived from the same antibody
as used here, treatment-associated neuropathy has not been observed
15–17
. The effects of robust T-cell infiltration and potent killing with associated inflammation
within the tumor site represents a CNS tumor-specific element of the larger category
of possible neurotoxic complications of CAR T-cell therapy, distinct from the observed
CAR T-cell therapy-associated encephalopathy syndrome (CRES) that occurs in the context
of cytokine release and appears to result from endothelial dysfunction
39
. The importance of careful monitoring for hydrocephalus and signs of increased intracranial
pressure cannot be overemphasized and will require careful inpatient monitoring with
frequent neurological and fundoscopic exams, and neuroimaging as indicated. Neurosurgical
interventions, such as intraventricular shunt placement for relief of hydrocephalus
or even craniectomy for decompression, may be required to support children through
the phase of tumoricidal neuroinflammation.
In summary, we have identified GD2 as a novel immunotherapy target in H3K27M mutant
DMGs, and demonstrated potent antitumor efficacy of GD2-CAR T-cells delivered systemically
in five independent patient-derived orthotopic xenograft models representing three
distinct H3K27M mutant glioma subtypes of the pons, thalamus and spinal cord. Upregulation
of ganglioside synthesis pathway component genes in H3K27M mutant pediatric high-grade
gliomas relative to H3 WT pediatric high-grade gliomas suggests this mutation drives
GD2 overexpression. Tumor associated inflammation generated by CAR T-cell activity
is tolerated by the majority of mice in this setting, suggesting the possibility for
a therapeutic window with neurointensive management despite the precarious anatomic
sites of these midline tumors, but putative tolerability of this approach remains
to be demonstrated in children with H3K27M+ DMG. If the results in mouse models are
predictive of results in humans, this immunotherapeutic strategy could be transformative
for the outcomes of children with H3K27M-mutant diffuse midline gliomas.
Methods
DMG cultures
Patient-derived glioma cell cultures were generated as previously described
40
. Briefly, tumor tissue was dissociated mechanically and enzymatically (Liberase DH,
Roche) prior to separation of myelin and debris by sucrose centrifugation. Neurosphere-generating
cultures were maintained in serum-free media supplemented with B27 (ThermoFisher),
EGF, FGF, PDGF-AA, PDGF-BB (Shenandoah Biotechnology), and Heparin (StemCell Technologies).
All cultures were validated and monitored by STR-fingerprinting (Supplementary Table
2) and verified to be mycoplasma-free within the previous 6 months (MycoAlert Plus,
Lonza). SU-DIPG6 and SU-DIPG13 have been previously referred to as and are identical
to SU-DIPG-VI and SU-DIPG-XIII, respectively. Clinical characteristics and STR fingerprints
of all DIPG and pSCG cultures
30
along with QCTB-R059
4
used here have been previously reported. For all studies using human tissue, informed
consent was obtained per guidelines of the approved Stanford Institutional Review
Board protocol.
Cell surface screening
Cell surface markers present on DIPG cell cultures were screened using a panel of
monoclonal antibodies against human cell surface markers (Lyoplate, BD Biosciences).
Low passage (<12) DIPG cultures expanded from tumor tissue collected at autopsy in
serum-free, neurosphere forming conditions
40
were allotted to 96 well plates and blocked with 1ug of goat IgG per million cells
to reduce nonspecific binding of secondary antibodies subsequently used in the assay.
Cells were then incubated sequentially with primary and secondary antibodies with
intermediate wash steps according to the manufacturer’s instructions. Dead cells were
then labeled with a Live/Dead violet stain (ThermoFisher), and following washes cells
were fixed in 1% PFA for 10 minutes at room temperature. The following day, stained
cells were analyzed by flow cytometry. Doublets and dead cells were excluded by gating,
and the mean fluorescence intensity of antibody labeling for each target on the panel
was normalized to the mean fluorescence intensity for the matched isotype control
per the manufacturer’s recommendations.
Immunohistochemistry and light microscopy
Primary DIPG patient tumor samples were fixed overnight in 4% paraformaldehyde/PBS
upon arrival, and then transferred to 30% sucrose until the tissue samples sank (2-3
days). Tissues were then transferred to cryomolds and embedded in OCT (TissueTek).
10 micron cryosections were generated on a cryostat (Leica), and endogenous peroxidase
activity was neutralized (Bloxall, Vector Laboratories) prior to permeabilization
(0.3% Triton X-100, TBS) and blocking (5% horse serum, Vector Laboratories). Sequential
double-immunohistochemistry was conducted for H3K27M (Abcam ab190631, 1:1000, 1hr
RT) and GD2 (14g2a, BD, 1:500, 1hr at RT). H3K27M was developed with a peroxidase
secondary (ImmPRESS VR anti-rabbit IgG, Vector Laboratories, 30 minutes at RT) and
DAB substrate (BD). Under these conditions, H3K27M+ cells could be routinely identified
in multiple tissues confirmed to bear both H3F3A and HISTH1B3 mutations by Sanger
sequencing, but staining was absent in tissues from non-DIPG tumor samples confirmed
to be H3 WT by Sanger sequencing. After quenching the DAB substrate development in
TBS and staining with the 14g2a primary antibody, GD2 signal was developed using a
polymer-based alkaline phosphatase secondary (ImmPRESS AP anti-mouse IgG, Vector Laboratories,
30 minutes at RT) and blue alkaline phosphatase substrate (Vector Blue AP substrate
kit, Vector Laboratories, 150 seconds at RT). AP development was quenched in TBS,
and samples were mounted and imaged (Zeiss AxioObserver). For hematoxylin-eosin staining,
mice were deeply anesthetized by ip injection of tribromoethanol and perfused transcardially
with cold PBS, brains were removed and fixed overnight in 4% paraformaldehyde/PBS.
Brains were then transferred to 70% ethanol and subsequently embedded in paraffin,
sectioned, and stained with hematoxylin/eosin. H&E histology was analyzed by an expert
neuropathologist (H.V.)
Immunofluorescence and confocal microscopy
Mice were deeply anesthetized with tribromoethanol (Avertin) before being perfused
transcardially with cold PBS. Brains were then removed and fixed overnight in 4% PFA/PBS
before being transferred to 30% sucrose and allowed to sink (2-3 days). Serial 40
micron coronal sections were then cut on a freezing microtome and floated in a tissue
cryoprotectant solution (glycerol, ethylene glycol, phosphate buffer) before storage
at -20C. Serial sections were then stained overnight at 4C. Primary antibodies used
were: rabbit anti-H3K27M (Abcam, 1:1000), rabbit anti-cleaved caspase-3 (Cell Signaling
Technology, 9661, 1:250), mouse anti-NeuN (Millipore, MAB377, 1:500), and rabbit Iba1
(Wako, 019-19741, 1:500). Secondary antibodies raised in donkey and conjugated with
AlexaFluor 594 or 647 were used at 4C overnight to detect primary labeling (Jackson
ImmunoResearch, 1:500). Mounted samples were imaged by confocal microscopy (Zeiss
LSM710), and acquired Z stacks through the tumor region were flattened by maximum
intensity projection (ImageJ). To quantify tumor cell density, cells within the borders
of infiltrating tumor in acquired micrographs were counted and normalized to the tumor
area (ImageJ), and the sum of all cells was normalized to the total area investigated
across 3-4 sections for each animal in a 1:12 series.
RT-qPCR
Cultures were plated in triplicate under standard growth conditions and harvested
in Trizol 24 hours later. After DNAse treatment, extracted RNA was reverse transcribed
(Maxima first strand, ThermoFisher) and utilized as template for qPCR reactions (Maxima
SYBR green, ThermoFisher). Primers utilized are listed in Supplementary Table 3. No-template
and RT- controls did not significantly amplify. For each of the triplicate cultures,
technical duplicates were assayed and averaged. Relative expression was then calculated
by the deltaCt method.
CAR construction, retroviral vector production and T-cell transduction
The GD2-CAR incorporates the scFv derived from the 14g2a monoclonal antibody, a CD8
transmembrane domain, and 4-1BB and TCR zeta signaling endodomains. The CD19-CAR was
similarly configured but incorporated the FMC63 scFv. The GD2-4-1BBz and CD19-4-1BBz
CAR retroviral vectors were constructed as previously described
41
. GD2-4-1BBz and CD19-4-1BBz CAR-encoding retroviral supernatants were produced via
transient transfection of the 293GP cell line, as described
42
. Briefly, 293GP cells were transfected on poly-d-lysine coated plates via Lipofectamine
2000 (Life Technologies) with the plasmids encoding the CARs and the RD114 envelope
protein. Supernatants were collected 48 and 72 h after transfection. Isolated human
T-cells were activated with anti-CD3/CD28 beads (Life Technologies) in a 3:1 bead:cell
ratio with 40 IU/ml IL-2 for 3 days. Activated T-cells were then retrovirally transduced
on days 3 and 4 as described
14
using Retronectin (Takara) coated plates, and cultured in 300 IU/ml IL-2. Anti-CD3/CD28
beads were removed on day 5, and media and IL-2 were changed every 2-3 d. Flow cytometry
using the 1A7 anti-idiotype antibody
43
for the GD2-4-1BBz CAR and the FMC63 anti-idiotype antibody 136.20.1
44
or Protein L (Pierce) for the CD19-4-1BBz CAR was used to assess transduction efficiency
for each batch of CAR T cells.
In vitro cytokine generation and cell killing
In vitro cell killing activity of GD2 and CD19-CAR T-cells was assessed with a luciferase-based
assay as previously described
41
. Tumor cells lentivirally transduced to stably express firefly luciferase (10,000
tumor cells per well) were co-incubated with GD2 or CD19-CAR T-cells for 24 hours
at effector-to-target (E:T) ratios ranging from 10:1 to 2.5:1. The Steady-Glo® Luciferase
Assay System (Promega) was used to measure residual luciferase activity from remaining
tumor target cells, and lysis was calculated as follows: percent lysis = 100 – [[(average
signal from T-cell–treated wells)/(average signal from untreated target wells)] ×
100].
Cytokine production by CAR T-cells in vitro was evaluated by co-incubation of CAR+
T-cells with target tumor cells at a 1:1 ratio (100,000 cells each), with CAR+ T-cell
counts incorporating the transduction efficiency as assessed by anti-idiotype staining
and flow cytometry. The total number of T-cells used for the control CD19-4-1BBz CAR
T-cells matched the number used for the GD2-4-1BBz CAR T-cells to ensure that the
total number of T-cells remained consistent across groups. After 24 hours, supernatants
were harvested and cytokine levels measured by ELISA for IL-2 and IFN-gamma (BioLegend).
T-cell proliferation
GD2-CAR T-cells on Day 15 of culture were labeled with Cell Trace Violet (ThermoFisher)
according to manufacturer protocol. Labeled GD2-CAR T-cells were either incubated
with no tumor, VUMC-DIPG10 (GD2 negative, H3K27M negative) or SU-DIPG13 (GD2 positive,
H3K27M positive). After five days of incubation, cells were collected and analyzed
by flow cytometry for proliferation. Analysis was performed on CAR+ T-cells only as
identified by anti-idiotype staining.
Orthotopic xenograft generation and treatment
Orthotopic DIPG xenografts were generated as previously described
31
. All in vivo experiments were approved by the Stanford University Institutional Care
and Use Committee and performed in accordance with institutional guidelines. Animals
were housed according to institutional guidelines with free access to food and water
on a 12-hour light/dark cycle. Briefly, patient-derived DIPG cell cultures (SU-DIPG6
and SU-DIPG13-FL) previously transduced with a lentivirus expressing eGFP and firefly
luciferase driven by the CMV promoter were infused by stereotaxic injector (Stoelting)
into the pons (coordinates lambda AP-3mm, DV -3mm, 100k cells) of cold-anesthetized
newborn (P0-2) NOD-scidIL2rg−/− (NSG) mice (Jax). Orthotopic pediatric spinal cord
glioma xenografts were generated by stereotaxic injection of SU-pSCG1 transduced with
a lentivirus expressing eGFP and firefly luciferase driven by the CAG promoter into
the medulla of isoflurane-anesthetized P35 NSG mice (coordinates lambda ML+0.7mm,
AP-3.5mm, DV-4.5mm, 600k cells). Orthotopic thalamic glioma xenografts were generated
by stereotaxic injection of QCTB-R059 transduced with a lentivirus expressing eGFP
and firefly luciferase driven by the CMV promoter into the thalamus of isoflurane-anesthetized
P35 NSG mice (coordinates bregma ML+0.8mm, AP-1mm, DV -3.5mm, 600k cells). Tumors
were then allowed to develop for 60 days. Prior to treatment, tumor burden was assessed
by in vivo luminescence imaging (IVIS Spectrum, PerkinElmer), and total flux was calculated
by included software (Living Image, Perkin Elmer) as the radiance through standard
circular ROIs centered on the animal’s head. Paired background regions were quantified
using circular ROIs over the animal’s flank where no significant luminescence was
detected above background. Animals were rank-ordered by tumor burden and distributed
sequentially into GD2 or CD19-CAR treatment groups, such that populations of equivalent
initial tumor burden underwent each arm of therapy. Initial burden assessed in this
manner was equivalent across treatment groups and engrafted cell lines (Supplementary
Figure 3). SU-DIPG13P* cells were injected into the pons of isoflurane-anesthetized
P35 NSG mice (coordinates lambda ML+1mm, AP-0.8mm, DV-5mm, 600k cells) and allowed
to develop for 14 days before T-cell administration. CAR T-cells with concentrations
adjusted to deliver 1×107 transduced cells in 200 microliters of PBS (assessed by
idiotype staining using flow cytometry, routinely >60%) were then administered by
intravenous injection into the tail vein of animals. Where transduction efficiencies
varied between GD2-CARs and CD19-CARs, the concentration of CD19-CAR cells was adjusted
to match the total dose of human T-cells present in the GD2-CAR infusion. Tumor burden
was monitored longitudinally by in vivo luminescence imaging. Due to the obvious nature
of GD2-CAR response, blinding in initial cohorts was deemed ineffective and subsequently
not performed. All images were scaled to display minimum flux intensity as 5E4 and
maximum as 5E6, then images of individual animals were arranged with like-treated
animals in the cohort for display in figures. Trial endpoint at 50 days post treatment
was determined in initial cohorts where substantial hair loss, reduced activity, and
weight loss in both GD2-CAR and CD19-CAR groups that triggered morbidity criteria
for euthanasia.
CRISPR/Cas9-mediated deletion of GD2 synthase
Deletion of GD2 synthase (B4GALNT1) in SU-DIPG13 cells was accomplished by electroporation
of DIPG13 with Cas9:sgRNA ribonucleoprotein complexes as previously described
45
. Briefly, guide RNAs targeting exon1 of B4GALNT1 (CGUCCCGGGUGCUCGCGUAC and CCGGCUACCUCUUGCGCCGU,
Synthego) were incubated with Cas9 nuclease to form ribonucleoprotein complexes and
electroporated with an Amaxa 4-D nucleofector (SE Buffer, program DS-112). In parallel,
a control gRNA targeting the AAVS1 locus
46
(GGGGCCACUAGGGACAGGAU) was electroporated with Cas9 nuclease as a ribonucleoprotein
complex using identical parameters. GD2-negative cells electroporated with B4GALNT1-targeting
gRNAs were isolated by FACS sorting, and deletion was confirmed by Sanger sequencing
and TIDE analysis
47
.
Statistics and Reproducibility
Statistical tests were conducted using Prism (GraphPad) software unless otherwise
indicated. Gaussian distribution was confirmed by the Shapiro–Wilk normality test.
For parametric data, unpaired, two-tailed Student’s t-tests and one-way ANOVA with
Tukey’s post hoc tests to further examine pairwise differences were used. For survival
analysis, a log-rank (Mantel-Cox) test was used. A level of P < 0.05 was used to designate
significant differences. On the basis of the variance of xenograft growth in control
mice, we used at least 3 mice per treatment group to give 80% power to detect an effect
size of 20% with a significance level of 0.05. For all animal experiments, the number
of independent mice used is listed in figure legend. For each of the five patient-derived
xenograft models used, at least two independent cohorts were tested (i.e. independent
litters of mice on different days with independent batches of cells.) For cytokine
and in vitro cell killing experiments, n=3 and experiments were repeated twice.
Data Availability Statement
The datasets generated during the current study are available from the corresponding
author upon reasonable request.
Supplementary Material
1
2