31
views
0
recommends
+1 Recommend
0 collections
    0
    shares
      • Record: found
      • Abstract: found
      • Article: not found

      Taxonomy and Biogeography of Apomixis in Angiosperms and Associated Biodiversity Characteristics

      research-article

      Read this article at

      ScienceOpenPublisherPMC
      Bookmark
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          Apomixis in angiosperms is asexual reproduction from seed. Its importance to angiospermous evolution and biodiversity has been difficult to assess mainly because of insufficient taxonomic documentation. Thus, we assembled literature reporting apomixis occurrences among angiosperms and transferred the information to an internet database ( http://www.apomixis.uni-goettingen.de). We then searched for correlations between apomixis occurrences and well-established measures of taxonomic diversity and biogeography. Apomixis was found to be taxonomically widespread with no clear tendency to specific groups and to occur with sexuality at all taxonomic levels. Adventitious embryony was the most frequent form (148 genera) followed by apospory (110) and diplospory (68). All three forms are phylogenetically scattered, but this scattering is strongly associated with measures of biodiversity. Across apomictic-containing orders and families, numbers of apomict-containing genera were positively correlated with total numbers of genera. In general, apomict-containing orders, families, and subfamilies of Asteraceae, Poaceae, and Orchidaceae were larger, i.e., they possessed more families or genera, than non-apomict-containing orders, families or subfamilies. Furthermore, many apomict-containing genera were found to be highly cosmopolitan. In this respect, 62% occupy multiple geographic zones. Numbers of genera containing sporophytic or gametophytic apomicts decreased from the tropics to the arctic, a trend that parallels general biodiversity. While angiosperms appear to be predisposed to shift from sex to apomixis, there is also evidence of reversions to sexuality. Such reversions may result from genetic or epigenetic destabilization events accompanying hybridization, polyploidy, or other cytogenetic alterations. Because of increased within-plant genetic and genomic heterogeneity, range expansions and diversifications at the species and genus levels may occur more rapidly upon reversion to sexuality. The significantly-enriched representations of apomicts among highly diverse and geographically-extensive taxa, from genera to orders, support this conclusion.

          Related collections

          Most cited references74

          • Record: found
          • Abstract: not found
          • Article: not found

          THE RELATION OF RECOMBINATION TO MUTATIONAL ADVANCE.

          J. Müller (1964)
            Bookmark
            • Record: found
            • Abstract: not found
            • Article: not found

            Asynchronous expression of duplicate genes in angiosperms may cause apomixis, bispory, tetraspory, and polyembryony

              Bookmark
              • Record: found
              • Abstract: found
              • Article: not found

              Turning Meiosis into Mitosis

              Introduction Apomixis, or asexual reproduction through seeds, results in progeny that are genetic clones of the maternal parent [1],[2]. Apomixis is of great interest due to its potential application in crop improvement. By introducing apomixis into sexual plants, any desired genotype, no matter how complex, could be perpetuated through successive seed generations [3],[4]. However, despite the occurrence of apomixis in over 400 species of angiosperms, very few crop species are apomictic and attempts to introduce this trait by crossing have failed [4]–[6]. An alternative approach is to de novo engineer apomixis [3]. For this strategy to be applied, the genes that confer elements of apomixis must first be identified. One major element of apomixis is apomeiosis, the skipping or deregulation of meiosis resulting in a mitotic-like division, which prevents ploidy reduction, and means that all the parent's genetic information is retained in the gamete [1]. Three features distinguish meiosis from mitosis: (i) a succession of two rounds of division following a single replication, (ii) pairing and recombination between homologous chromosomes, and (iii) co-segregation of sister chromatids at the first division [7] (Figure 1). In this study, we identified a gene that controls one of these three features—entry into the second meiotic division—in the sexual plant Arabidopsis thaliana. By combining a mutation in this gene with two other mutations—one that eliminates recombination and pairing (Atspo11-1) [8] and another that modifies chromatid segregation (Atrec8) [9]—we created a genotype in which meiosis is totally replaced by mitosis without affecting subsequent sexual processes. We called this genotype MiMe for “mitosis instead of meiosis”. The induction of apomeiosis by the creation of the MiMe genotype is an important step towards understanding and engineering apomixis. 10.1371/journal.pbio.1000124.g001 Figure 1 Schematic summary of the main results. During mitosis in diploid cells, chromosomes replicate and sister chromatids segregate to generate daughter cells that are diploid and genetically identical to the initial cell. During meiosis, two rounds of chromosome segregation follow a single round of replication. At division one, homologous chromosomes recombine and are separated. Meiosis II is more similar to mitosis, resulting in equal distribution of sister chromatids. The obtained spores are thus haploid and carry recombined genetic information. In the osd1 mutant (this study), meiosis II is skipped giving rise to diploid spores and gametes with recombined genetic information. The double Atspo11-1/Atrec8 mutant undergoes a mitotic-like division instead of a normal first meiotic division, followed by an unbalanced second division leading to unbalanced spores and sterility [9]. In the triple osd1/Atspo11-1/Atrec8 mutant (MiMe, this study), the presence of the Atspo11-1 and Atrec8 mutations leads to a mitotic-like first meiotic division, and the presence of the osd1 mutation prevents the second meiotic division from occurring. Thus meiosis is replaced by a mitotic-like division. The obtained spores and gametes are genetically identical to the initial cell. Results and Discussion Osd1 Mutants Produce Diploid Gametes by Skipping the Second Meiotic Division As a part of an expression-profiling screen for meiotic genes using the Expression Angler tool [10] with the AtGenExpress tissue set [11], At3g57860 was selected as a good candidate due to its co-regulation with several known meiotic genes [12]. At3g57860 corresponds to the UVI4-Like gene (UVI4-L) which was briefly described in a study of its paralogue, the UVI4 gene [13]. Due to its role in meiosis (see below), we renamed the At3g57860 gene OSD1, for omission of second division. The OSD1 and UVI4 proteins are conserved throughout the plant kingdom (Figure 2) but do not contain any obvious conserved known functional domains. No homologues were identified outside of the plant kingdom. We investigated the role of the OSD1 gene by isolating and characterising two mutants. The osd1-1 (pst15307) [14] and the osd1-2 (GT21481) [15],[16] Ds insertional mutants are in the Nooseen (No-0) and Landsberg (Ler) backgrounds, respectively, and in both cases the insertion is in the second exon of the OSD1 gene (Figure 2). In both independent osd1 mutants, the products of male meiosis were dyads (osd1-1: 714/714; osd1-2: 334/334) instead of tetrads (Figure 3A and 3B). Complementation tests between osd1-1 and osd1-2 confirmed that these mutations are allelic (osd1-1/osd1-2: 369 dyads/369). osd1 mutants did not show any somatic developmental defects, male and female gametophyte lethality, or reduced fertility (wild type 38±11 seeds/fruit; osd1 35±6). Next, we measured ploidy levels among the offspring of diploid osd1 mutants. Among selfed progeny, tetraploids (4n) (84%) and triploids (3n) (16%), but no diploid (2n) plants, were found (osd1-1: n = 56; osd1-2: n = 24). When mutant pollen was used to fertilise a wild-type plant, all the resulting progeny were triploid (osd1-1: n = 75). When mutant ovules were fertilised with wild-type pollen grains, we isolated 12% diploid and 88% triploid plants (n = 25). This demonstrated that the osd1 mutants produce high levels of male (100%) and female (∼85%) diploid spores, which result in functional gametes. 10.1371/journal.pbio.1000124.g002 Figure 2 The OSD1 gene and protein. (A)The OSD1 gene contains three exons and two introns and encodes a protein of 243 amino acids. The positions of the two Ds insertions are indicated by triangles. (B) A multiple sequence alignment of OSD1/UVI4 family members is shown, pointing out the segments of best conservation along OSD1. Particularly high conservation is observed in the central OSD1-motif, which is the only section with clear sequence similarity in moss and club-mosses. The conserved C-terminal 40–60 amino acids are predicted to contribute to alpha-helical structural elements. All available homologues are included for the selected range of species, with the species of origin being indicated by a two letter code preceding each protein identifier. Brassicaceae: Al, Arabidopsis lyrata; At, Arabidopsis thaliana; Br, Brassica rapa. Eurosids I: Gm, Glycine max; Pt, Populus trichocarpa. Poaceae: Os, Oryza sativa; Sb, Sorghum bicolor; Zm, Zea mays. Mosses: Pp, Physcomitrella patens. (C) Unrooted phylogenetic tree inferred from a OSD1/UVI4 family alignment using a neighbour-joining algorithm with pairwise gap removal. The full length sequences are included in the alignment except for Physcomitrella patens (Pp) sequences, for which only the conserved segment is aligned. The fact that only the aligning portions of Pp proteins were used in the reconstruction of the consensus tree topology should be taken into account during Pp-node branch length interpretation. Based on paralogue grouping, it can be hypothesised that gene duplication events occurred repeatedly in the evolution of plant OSD1/UVI4 family. The robustness of the topology is indicated by bootstrap confidence levels in percentage of 1,000 replicates. The analysis was performed with PHYLIPv3.66 (Felsenstein J (2006)) distributed by the author. Department of Genome Sciences, University of Washington, Seattle, United States of America) and PHYLO_WINv2.0 [32]. 10.1371/journal.pbio.1000124.g003 Figure 3 osd1 mutants skip meiosis II. (A and B) Male meiotic products stained with toluidine blue. (A) A wild-type tetrad. (B) A dyad in the osd1-1 mutant. (C–D) Male meiosis in osd1 is indistinguishable from wild type until telophase I (compare to figure 4), but no figures characteristic of a second division were observed. (C) Pachytene. (D) Diakinesis. (E) Metaphase I. (F) Anaphase I. (G) Telophase I. Two nuclei separated by a band of mitochondria are observed. (H) Metaphase I of female meiosis in osd1. To unravel the mechanisms leading to dyad production in osd1, we investigated chromosome behaviour during meiosis. Both male and female meiosis I were indistinguishable from wild type (compare Figure 3 with Figure 4). Notably, chiasmata, the cytological manifestation of crossovers, and bivalents were observed. However, we were unable to find any meiosis II figures (among >500 male meiocytes from prophase to spore formation), strongly suggesting that dyad production is due to an absence of the second meiotic division. If this second division does not take place, then any heterozygosity at centromeres will be lost in the diploid gametes because of sister chromatid co-segregation and homologue separation during the first division. Because of recombination, any loci that are not linked to centromeres will segregate. 10.1371/journal.pbio.1000124.g004 Figure 4 Meiosis in wild type. (A) Pachytene. Homologous chromosomes are fully synapsed. (B) Diakinesis. Five pairs of homologous chromosomes (bivalent), linked by chiasmata, are observed. (C) Metaphase I. The five bivalent are aligned on the metaphase plate. (D) Anaphase I. The homologous chromosomes are separated. (E) Telophase I. (F) Metaphase II. The pairs of sister chromatids align on the metaphase plates. (G) Anaphase II. The sister chromatids are separated. (H and I) Telophase II. Four haploid spores are formed (tetrad). Scale bar = 10 µm. We tested our assumption by taking advantage of the two different genetic backgrounds of the osd1-1 (No-0) and osd1-2 mutants (Ler). F1 plants bearing the two mutations—mutant for osd1 and heterozygous for any No-0/Ler polymorphisms—were crossed as male or female to a third genetic background, Columbia (Col-0). Karyotyping and genotyping of the obtained plants for trimorphic molecular markers provided direct information on the genetic make-up of pollen grains and female gametophytes produced by the mutant. All the diploid gametes tested had the predicted genetic characteristics (Figure 5A). They were systematically homozygous at centromeres and segregating—because of recombination—at other loci (n = 48 for male diploid gametes and n = 41 for female diploid gametes). These results confirmed that the absence of a second meiotic division is indeed the cause of 2n gametes production in osd1. This mechanism also implies that unbalanced chromosome segregation at meiosis I would give rise to unbalanced dyads in osd1; this was confirmed by analysing a double Atspo11-1/osd1-1 mutant (unpublished data). Such a phenotype has been already described in the maize elongate mutant in which diploid female gametes are produced because of failure to undergo meiosis II, but the corresponding gene has not been identified [17],[18]. 10.1371/journal.pbio.1000124.g005 Figure 5 Genetic make-up of the osd1 and MiMe diploid gametes. (A) Triploid offspring of the osd-1 (No-0)/osd1-2 (Ler) × Col-0 crosses were genotyped for several molecular markers. Each line represents one plant. For each marker, plants carrying only the No-0 allele are in green, plants carrying only the Ler allele are in yellow, and plants with both the No-0 and Ler alleles are in red. Col-0 alleles are present in all the plants because it was used as the male or female parent in the cross. The position of each marker (red) and the centromeres (dark blue) are indicated along the chromosomes. (B) Similarly, triploid offspring of the MiMe (patchwork of Col-0 from Atspo11-1/Atrec8 and No-0 from osd1-1) × Le crosses was genotyped for molecular markers that were heterozygous in the MiMe mother plant. All the plants were heterozygous for each marker (Col-0/No-0). Interestingly, the OSD1 paralogue UVI4 is necessary for maintaining the mitotic state, and loss of UVI4 function stimulates endo-reduplication, whereas OSD1 is not required for this process [13]. Meiosis is not affected when UVI4 is disrupted (unpublished data). This suggests that UVI4 and OSD1 are both involved in cell cycle regulation, with specialized functions in mitosis and meiosis, respectively. The transition from meiosis I to meiosis II requires a balance in Cyclin–Cdk activity: it must be lowered sufficiently to exit meiosis I but maintained at high enough levels to suppress DNA replication and promote entry into meiosis II [19],[20]. Two protein depletions generate a phenotype similar to that of osd1: the fission yeast Mes1 protein partially inhibits cyclin degradation by the anaphase promoting complex (APC) and thereby allows entry into meiosis II [21],[22]. Similarly, the expression of Erp1/Emi2 at the end of meiosis I is essential for entry into meiosis II in Xenopus [23],[24] and mouse [25] oocytes, most likely by inhibiting cyclin degradation by APC. Erp1/Emi2-depleted oocytes and the mes1 yeast mutant fail to enter meiosis II, which is reminiscent of the osd1 phenotype. Therefore, one possible function of OSD1 may also be to fine tune APC activity/cyclin levels at the end of meiosis I to ensure the transition to meiosis II. Turning Meiosis into Mitosis Due to an absence of the second meiotic division, osd1 mutants produce high frequencies of viable diploid male and female gametophytes, which generate, after fecundation, viable tetraploid plants. However, this phenomenon differs from apomeiosis in that the produced gametes are genetically different from the mother plant. Previously, we reported that in double Atspo11-1/Atrec8 mutants, the first meiotic division is replaced by a mitotic-like division, followed by an unbalanced second division that leads to unbalanced spores and sterility [9]. Triple osd1/Atrec8/Atspo11-1 mutants were generated and expressed an apomeiosis phenotype in which meiosis was completely replaced by a mitotic-like division. This was expected, because the Atspo11-1 and Atrec8 mutations lead to a mitotic-like first meiotic division, and the osd1 mutation prevents the second meiotic division from taking place. We called this genotype MiMe for mitosis instead of meiosis. MiMe plants generate dyads (408/408) and are fertile (25±6 seeds per fruit). The osd1 mutation therefore suppressed the sterility phenotype of the Atspo11-1/Atrec8 double mutant. Observation of chromosome behaviour during male and female meiosis revealed a mitotic-like division: ten univalents aligned on the metaphase plate and sister chromatids separated at anaphase (Figure 6). The selfed progeny of MiMe plants were systematically tetraploid (n = 24), and backcrosses between diploid MiMe plants and wild-type plants generated triploid plants regardless of whether male (n = 24) or female (n = 67) MiMe gametes were used, showing that this mitotic-like division gives rise to functional diploid gametes. All the gametes (male and female), tested similarly as described above systematically retained the mother plant heterozygosity for every genetic marker tested (Figure 5B) and were thus genetically identical to the mother plant. These results confirm that MiMe plants undergo a mitotic-like division instead of a normal meiotic division, without affecting subsequent sexual processes. 10.1371/journal.pbio.1000124.g006 Figure 6 Mitosis-like divisions instead of meiosis in MiMe plants. (A) Male metaphase I (B) Male anaphase I. The vignette shows a dyad in MiMe. (C) Female metaphase I. (D) Female anaphase I. Scale bar = 10 µm. When meiosis is replaced by mitosis, ploidy is expected to double with each generation. Indeed, in successive generations, we obtained tetraploid (4n, 20 chromosomes, n = 26) and octoploid (8n, 40 chromosomes, n = 33) (Figures 7 and 8). Fertility dropped from 25±6 seeds/fruit in 2n plants and 19±4 in 4n plants to <0.1 in 8n plants. Further investigations will be required to understand the cause of this reduced fertility associated with high ploidy level. 10.1371/journal.pbio.1000124.g007 Figure 7 Doubling of ploidy at each generation in the MiMe line. In subsequent generations, MiMe plant ploidy doubled at each generation, from 2n (A) (10 chromosomes), to 4n (B) (20 chromosomes) and 8n (C) (40 chromosomes). The left column shows mitotic metaphase, scale bar = 10 µm. The right column shows the corresponding four-week-old plants, (scale bar = 2 cm) and flowers (scale bar = 1 mm). 10.1371/journal.pbio.1000124.g008 Figure 8 Male meiosis in 2n, 4n, and 8n MiMe plants. MiMe plants underwent a mitosis-like division instead of meiosis in 2n (A), 4n (B), and 8n (C) plants. Meiotic metaphase I, anaphase I, and telophase I are shown for each generation. Scale bar = 10 µm. Towards Apomixis Apomixis can be separated into three developmental components: an absence or alteration of meiosis which prevents reduction (apomeiosis), the fertilization-independent development of the embryo from the egg cell (parthenogenesis), and the initiation of endosperm development with or without fertilization [1]. Here we showed that fully penetrant apomeiosis can be induced in a sexual plant, when a mitotic-like division replaces meiosis in the MiMe genotype. A previous case of apomeiosis was reported in the Arabidopsis dyad mutant [26]. However, only 0.2% of dyad ovules generate viable gametes, which makes it practically unusable in an apomixis engineering strategy, in contrast to MiMe plants, which produce quasi–wild type levels of viable—and apomeiotic—ovules and pollen grains. The three genes conferring the MiMe genotype are strongly conserved among plants, suggesting that apomeiosis may be engineered in any plant species, including crops. In addition, several other genes required for recombination initiation have been described in plants [27], and the corresponding mutants could be used instead of spo11-1 to construct a MiMe genotype. However, it remains to be confirmed that the MiMe genotype would have the same phenotype in other plant species. To obtain apomixis, in addition to apomeiosis, parthenogenesis will have to be introduced, and the problem of endosperm formation must also be overcome. However, mutations that mimic early parthenogenesis or give rise to functional autonomous endosperm have been reported in Arabidopsis [28],[29], suggesting that it should be ultimately feasible to introduce apomixis into a sexual plant species. Materials and Methods Growth Conditions Arabidopsis plants were cultivated as described in [30]. For germination assays and cytometry experiments, Arabidopsis were cultivated in vitro on Arabidopsis medium [31] at 21°C with a 16-h day/8-h night photoperiod and 70% hygrometry. Genetic Analysis Plants were genotyped by PCR (30 cycles of 30 s at 94°C, 30 s at 56°C, and 1 min at 72°C) using two primer pairs (see Table 1). For each genotype, the first primer pair is specific to the wild-type allele and the second pair is specific to the insertion. 10.1371/journal.pbio.1000124.t001 Table 1 Primers for mutant genotyping. mutant Primers for Wild-type Allele Primers for Mutant Allele osd1-1 pst15307U (CGTCACTCTCCCCAAGAAAG3) pst15307L pst15307L (GGCTAAGCAAGCCTGCTATG3) Ds5-2a (TCCGTTCCGTTTTCGTTTTTTAC). osd1-2 GT21481U (CCGGTGTTCTTGTGACTCG) GT21481U GT21481L (GCAGATTCCTAATTCAGCTC) Ds3-4 (CCGTCCCGCAAGTTAAATATG) Atspo11-1-3 N646172U ( AATCGGTGAGTCAGGTTTCAG ) N646172L N646172L (CCATGGATGAAAGCGATTTAG) LbSalk2 (GCTTTCTTCCCTTCCTTTCTC) Atrec8-3 N836037U (CTCATATTCACGGTGCTCCC) N836137L N836037L (GGGGGAAAAGAGAAAGGTTC) LB3sail (TAGCATCTGAATTTCATAACCAATCTCGATACAC) Genetic trimophic (Col-0/Ler/No-0) markers used to genotype the osd1-1 (No-0)/osd1-2 (Ler) × Col-0 F1 population and osd1-1 (No-0)/spo11-1 (Col-0)/rec8 (Col-0) triple mutant × Ler F1 population were amplified (40 cycles of 30 s at 94°C, 30 s at 58°C, and 30 s at 72°C) with specific primers (see Table 2) and observed after migration on 3% agarose gel. CAPS K4_10355 was observed after Eco47III/HpaII double digestion. The two primer pairs specific for the osd1-1 and osd1-2 insertion borders were used as a marker on Chromosome 3. 10.1371/journal.pbio.1000124.t002 Table 2 Genetic markers. Marker Chromosome Position (bp) Primer 1 Primer 2 Msat1-13 1 25,827,433 CAACCACCAGGCTC GTCAAACCAGTTCAATCA F5i14 1 24,374,008 CTGCCTGAAATTGTCGAAAC GGCATCACAGTTCTGATTCC Msat2-18 2 2,799,644 TAGTCTCTTTTGGTGCGCATA AGCCTCTCCAAGCTTAGGTCT Msat2-21 2 11,461,020 ATTTTTAGCCCAATCACGTTT AGGTCAAGTGAAAGGGTAAGG Msat2-9 2 18,152,580 TAAAAGAGTCCCTCGTAAAG GTTGTTGTTGTGGCATT CapsK4_10355 4 10,354,800 ACCCATTTGGTGATGCTAAC GAGCAGTTTCCACTTTGTCC Msat4-18 4 11,966,304 TGTAAATATCGGCTTCTAAG CTGAAACAAATCGCATTA Nga151 5 4,669,932 GTTTTGGGAAGTTTTGCTGG CAGTCTAAAAGCGAGAGTATGATG Cytology and Flow Cytometry Final meiotic products observation, chromosomes spreads, and genome size measurement were carried out using the techniques described by d'Erfurth et al. [12].
                Bookmark

                Author and article information

                Journal
                CRC Crit Rev Plant Sci
                CRC Crit Rev Plant Sci
                BPTS
                bpts20
                Critical Reviews in Plant Sciences
                Taylor & Francis
                0735-2689
                3 September 2014
                29 May 2014
                : 33
                : 5
                : 414-427
                Affiliations
                [ a ]Georg August University Göttingen, Albrecht-von-Haller Institute for Plant Sciences, Department of Systematic Botany , Göttingen, Germany
                [ b ]Gesellschaft für wissenschaftliche Datenverarbeitung mbH Göttingen (GWDG), Arbeitsgruppe Anwendungs- und Informationssysteme , Göttingen, Germany
                [ c ]Plants, Soils and Climate Department, Utah State University , Logan, UT, USA
                Author notes
                Address correspondence to Elvira Hörandl, Georg August University Göttingen, Albrecht-von-Haller Institute for Plant Sciences, Department of Systematic Botany , Untere Karspüle 2, D37073 Göttingen, Germany. E-mail: elvira.hoerandl@ 123456biologie.uni-goettingen.de

                Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/bpts.

                Article
                898488
                10.1080/07352689.2014.898488
                4786830
                27019547
                c260f307-1f1e-4059-b367-938d1e6646d8
                © 2014 The Author(s). Published with license by Taylor & Francis

                This is an Open Access article. Non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly attributed, cited, and is not altered, transformed, or built upon in any way, is permitted. The moral rights of the named author(s) have been asserted.

                History
                Page count
                Figures: 8, Tables: 1, References: 78, Pages: 14
                Categories
                Original Articles

                angiosperms,biodiversity,biogeography,online database,evolution,polyploidy,phylogeny,geographical parthenogenesis

                Comments

                Comment on this article