Analysis and comparative genomics of R997, the first SXT/R391 integrative and conjugative element (ICE) of the Indian Sub-Continent

There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

Abstract

The aim of this study was to analyse R997, the first integrative and conjugative element (ICE) isolated from the Indian Sub-Continent, and to determine its relationship to the SXT/R391 family of ICEs. WGS of Escherichia coli isolate AB1157 (which contains R997) was performed using Illumina sequencing technology. R997 context was assessed by de novo assembly, gene prediction and annotation tools, and compared to other SXT/R391 ICEs. R997 has a size of 85 Kb and harbours 85 ORFs. Within one of the variable regions a HMS-1 β-lactamase resistance gene is located. The Hotspot regions of the element contains restriction digestion systems and insertion sequences. R997 is very closely related to the SXT-like elements from widely dispersed geographic areas. The sequencing of R997 increases the knowledge of the earliest isolated SXT/R391 elements and may provide insight on the emergence of these elements on the Indian sub-continent.

Related collections

Most cited references 24

Record: found
Abstract: found
Article: found

Is Open Access

Comparative ICE Genomics: Insights into the Evolution of the SXT/R391 Family of ICEs

Rachel Wozniak, Derrick Fouts, Matteo Spagnoletti … (2009)

Introduction There are three types of self-transmissible mobile genetic elements: plasmids, bacteriophages and integrative conjugative elements (ICEs). All three classes of elements enable horizontal transmission of genetic information and all have had major impacts on bacterial evolution [1]–[4]. ICEs, (aka conjugation transposons), like plasmids, are transmitted via conjugation; however, unlike plasmids, ICEs integrate into and replicate along with the chromosome. Following integration, ICEs can excise from the chromosome and form circular molecules that are intermediates in ICE transfer. Plasmids and phages have been the subject of more extensive study than ICEs and while there is growing understanding of the molecular aspects of several ICEs [5]–[10], to date there have been few reports of comparative ICE genomics [11],[12] and consequently understanding of ICE evolution is only beginning to be unraveled. Diverse ICEs have been identified in a variety of gram-positive and gram–negative organisms [13]. These elements utilize a variety of genes to mediate the core ICE functions of chromosome integration, excision and conjugation. In addition to a core gene set, ICEs routinely contain genes that confer specific phenotypes upon their hosts, such as resistance to antibiotics and heavy metals [14]–[18], aromatic compound degradation [19] or nitrogen fixation [20]. SXT is an ∼100 Kb ICE that was originally discovered in Vibrio cholerae O139 [16], the first non-O1 serogroup to cause epidemic cholera [21]. SXT encodes resistances to several antibiotics, including sulfamethoxazole and trimethoprim (which together are often abbreviated as SXT) that had previously been useful in the treatment of cholera. Since the emergence of V. cholerae O139 on the Indian subcontinent in 1992, SXT or a similar ICE has been found in most clinical isolates of V. cholerae, including V. cholerae serogroup O1, from both Asia and Africa. Other vibrio species besides V. cholerae have also been found to harbor SXT-related ICEs [22]. Furthermore, SXT-like ICEs are not restricted to vibrio species, as such ICEs have been detected in Photobacterium damselae, Shewanella putrefaciens and Providencia alcalifaciens [23]–[25]. Moreover, Hochhut et al [26] found that SXT is genetically and functionally related to the so-called ‘Inc J’ element R391, which was derived from a South African Providencia rettgeri strain isolated in 1967 [27]. It is now clear that Inc J elements are SXT-related ICEs that were originally misclassified as plasmids. In the laboratory, SXT has a fairly broad host range and can be transmitted between a variety of gram-negative organisms [16]. The SXT/R391 family of ICEs is now known to include more than 30 elements that have been detected in clinical and environmental isolates of several species of γ- proteobacteria from disparate locations around the globe [28]. SXT/R391 ICEs are grouped together as an ICE family because they all encode a nearly identical integrase, Int. Int, a tyrosine recombinase, is considered a defining feature of these elements because it enables their site-specific integration into the 5′ end of prfC, a conserved chromosomal gene that encodes peptide chain release factor 3 [29]. Int mediates recombination between nearly identical element and chromosome sequences, attP and attB respectively [29]. When an SXT/R391 ICE excises from the chromosome, Int, aided by Xis, a recombination directionality factor, mediates the reverse reaction - recombination between the extreme right and left ends (attR and attL) of the integrated element - thereby reconstituting attP and attB [6],[29]. The excised circular SXT form is thought to be the principal substrate for its conjugative transfer. The genes that encode activities required for SXT transfer (tra genes) were originally found to be distantly related to certain plasmid tra genes [30]–[32]. The tra genes encode proteins important for processing DNA for transfer, mating pair formation and generating the conjugation machinery. Regulation of SXT excision and transfer is at least in part governed by a pathway that resembles the pathway governing the lytic development of the phage lambda. Agents that damage DNA and induce the bacterial SOS response are thought to stimulate the cleavage and inactivation of SetR, an SXT encoded λ cI-related repressor, which represses expression of setD and setC, transcription activators that promote expression of int and tra genes [5]. The complete nucleotide sequences of SXT (99.5kb) and R391 (89kb) were the first SXT/R391 ICE family genomes to be reported [14],[32]. Comparative [33] and functional genomic analyses [5],[32] revealed that these 2 ICEs share a set of conserved core genes that mediate their integration/excision (int and xis), conjugative transfer (various tra genes), and regulation (setR, setCD). In addition to the conserved genes, these 2 ICEs contain element specific genes that confer element specific properties such as resistance to antibiotics or heavy metals. Interestingly, many of these genes were found in identical locations in SXT and R391, leading Beaber et al [33] to propose that there are ‘hotspots’ where SXT/R391 ICEs can acquire new DNA. The genomes of two additional SXT/R391 ICEs, ICEPdaSpa1, isolated from Photobacterium damselae [23], and ICESpuPO1, derived from an environmental isolate of Shewanella putrefaciens [24] are now also known. These two genomes also share most of the conserved set of core genes present in SXT and R391 and contain element specific DNA. Determination of the sequences of SXT/R391 family ICE genomes was a fairly arduous task due to their size and predominantly chromosomal localization. Here, we developed a method to capture and then sequence complete SXT/R391 ICE genomes. In addition, we identified 3 as yet unannotated SXT/R391 ICE genomes in the database of completed bacterial genomes. Comparative analyses of the 13 SXT/R391 genomes now available allowed us to greatly refine our understanding of the organization and conservation of the core genes that are present in all members of this ICE family. Comparative and functional analyses also facilitated our proposal of the minimal functional SXT/R391 ICE genome. Furthermore, this work provides new knowledge of the considerable diversity of genes and potential accessory functions encoded by the variable DNA found in these mobile elements. Finally, this comparative genomics approach has allowed us to garner clues regarding the evolution of this class of mobile elements. Results/Discussion An ICE capture system To date, ICE sequencing has been cumbersome because it has typically required construction of chromosome-derived cosmid libraries and screening for sequences that hybridize to ICE probes [23],[32]. We constructed a vector (pIceCap) that enables capture of complete SXT/R391 ICE genomes on a low-copy plasmid to simplify the protocol for ICE sequencing. This plasmid is a derivative of the single-copy modified F plasmid pXX704 [34],[35], which contains a minimal set of genes for F replication and segregation but lacks genes enabling conjugation. We modified pXX704 to include an ∼400bp fragment that encompasses the SXT/R391 attachment site (attB) and thereby enabled Int-catalyzed site-specific recombination between attB on pIceCap and attP on an excised and transferred ICE to drive ICE capture (Figure 1). Conjugations between an SXT/R391 ICE-bearing donor strain and an E. coli recipient deleted for prfC (and thus chromosomal attB) and harboring pIceCap yielded exconjugants containing the transferred ICE integrated into pIceCap (Figure 1). We used the ΔprfC recipient to bias integration of the transferred ICE into pIceCap rather than the chromosome. In these experiments, we selected for exconjugants containing the transferred ICE integrated into pIceCap, using an antibiotic marker present on the ICE as well as a marker present in pIceCap. The low copy IceCap::ICE plasmid was then isolated and used as a substrate for shotgun sequencing. We also found that the IceCap::ICE plasmids were transmissible. Thus, in principle this technique should facilitate capture of ICEs that do not harbor genes conferring resistance to antibiotics, by mating out the IceCap::ICE plasmid into a new recipient and selecting for the marker on pIceCap. 10.1371/journal.pgen.1000786.g001 Figure 1 Schematic of the ICE capture system. Conjugation between a donor strain bearing a chromosomal ICE and a ΔprfC recipient strain harboring pIceCap, which contains attB, yields exconjugants that contain the transferred ICE integrated into pIceCap. Exconjugants were selected for using a marker on pIceCap and on the ICE. attR and attL represent the right and left ICE-chromosome junctions. SXT/R391 ICEs included in this analysis A list of the 13 SXT/R391 ICEs whose genomes were analyzed and compared in this study is shown in Table 1. All of the ICEs included in our analyses contain an int gene that was amplifiable using PCR primers for intsxt [29]. They were isolated on 4 continents and from the Pacific Ocean during a span of more than 4 decades. They are derived from 7 different genera of γ-proteobacteria and the ICEs derived from V. cholerae strains are from both clinical and environmental isolates of 3 different V. cholerae serogroups. 10.1371/journal.pgen.1000786.t001 Table 1 SXT/R391 ICE family members analyzed in this study. ICE Host strain Site and year of isolation Size (bp) % Identity to Int SXT Resistance profile Notable Variable Genes Genbank Accession Number Strain or ICE References ICEVchMex1 Vibrio cholerae non O1-O139 San Luis Potosi, Mexico 2001 82839 99% (410/413) - Fic family protein, diguanylate cyclase, restriction modification system GQ463143 [66] ICEVchInd4 Vibrio cholerae O139 Kolkata, India 1997 95491 100% (413/413) floR, strBA, sul2 Toxin-antitoxin system GQ463141 [54] ICEVchInd5 Vibrio cholerae O1 Sevagram, India 1994 97847 99% (409/413) floR, strBA, sul2, dfrA1 AraC family transcription regulator, glyoxoylase abx resistance GQ463142 This study ICEVchBan5 Vibrio cholerae O1 Bangladesh, 1998 102131 99% (409/413) floR, strBA, sul2, dfrA1 AraC family transcription regulator, glyoxoylase abx resistance GQ463140 [29] ICEPalBan1 Providencia alcalifaciens Bangladesh, 1999 96586 99% (409/413) floR, strBA, sul2, dfrA1 Toxin-antitoxin system, phenazine biosynthesis protein, lysine exporter GQ463139 [25] ICEVflInd1 Vibrio fluvialis Kolkata, India 2002 91369(a) 99% (409/413) dfr18, floR, strBA, sul2 Toxin-antitoxin system GQ463144 [22] ICEVchMoz10 Vibrio cholerae O1 Beira, Mozambique 2004 104495 99% (409/413) floR, strBA, sul2, tetA' AraC family transcription regulator, glyoxoylase abx resistance, ATP-dependent Lon protease ACHZ00000000 [67] ICEPmiUsa1 Proteus mirabilis Maryland, United States 1986 79733 99% (409/413) - ATP-dependent helicase AM942759 [68] ICEVchBan9 Vibrio cholerae O1 Matlab, Bangladesh 1994 106124 99% (409/413) floR, strBA, sul2, dfrA1, tetA' AraC family transcription regulator, glyoxoylase abx resistance, ATP-dependent Lon protease CP001485 [69] ICEVchBan8 Vibrio cholerae non O1-O139 Bangladesh, 2001 105790(a) 25% (76/301) - Toxin-antitoxin system NZ_AAUU00000000 This study SXTMO10 Vibrio cholerae O139 Chennai, India 2002 99452 100% dfr18, floR, strBA, sul2 Toxin-antitoxin system AY055428 [16] R391 Providencia rettgeri Pretoria, South Africa 1967 88532 99% (410/413) kanR, merRTPCA Sulfate transporter, universal stress protein AY090559 [27] ICEPdaSpa1 Photobacterium damselae Galicia, Spain 2003 102985 99% (412/413) tetAR ATP-dependent Lon protease, heat-shock protein AJ870986 [23] ICESpuPO1 Shewanella putrefaciens 630m, Pacific Ocean 2000 108623 99% (409/413) - Zn/Co/Cd efflux system, restriction modification system CP000503 [24] (a) The sequence is not complete and therefore the true size is not known. Five of these ICE genome sequences were determined at the J. Craig Venter Institute (JCVI) using the ICE capture system described above (Table 1, rows 1–5). In addition, we sequenced ICEVflInd1, also at the JCVI, by isolating cosmids that encompassed this V. fluvialis derived ICE prior to developing the ICE capture technique (Table 1, row 6). Table 1 (rows 7–10) also includes 4 previously unannotated ICE genomes that we found in BLAST searches of the NCBI database of completed but as yet unannotated genomes; 3 of these ICEs are clearly members of SXT/R391 ICE family since they are integrated into their respective host's prfC locus and contain int genes that are predicted to encode Int proteins that are 99% identical to Int sxt . The fourth element, ICEVchBan8 does not encode an Int sxt orthologue; however, this element contains nearly identical homologues of most of the known conserved core SXT/R391 ICE family genes. ICEVchBan8 will be discussed in more detail below but since it does not contain an Int sxt orthologue it is not considered a member of the SXT/R391 family of ICEs and thus not included in our comparative study. Finally, Table 1 also includes the 4 SXT/R391 ICEs that were previously sequenced (Table 1, rows 11–14). Despite the diversity of our sources for SXT/R391 ICEs, the genomes of two pairs of ICEs that we analyzed proved to be very similar. SXTMO10 and ICEVchInd4 only differed by 13 SNPs in 7 genes and by the absence from ICEVchInd4 of dfr18, a gene conferring trimethoprim resistance. These ICEs were derived from V. cholerae O139 strains isolated in India from different cities at different times: SXTMO10 from Chennai in 1992 and ICEVchInd4 from Kolkata in 1997. The high degree of similarity of these two ICE genomes suggests that ICEs can be fairly stable over time. ICEVchBan9 and ICEVchMoz10 were also extremely similar although ICEVchMoz10 lacks dfrA1, another allele for trimethoprim resistance. These two ICEs were derived from V. cholerae O1 strains from Bangladesh (1994) and Mozambique (2004) respectively. The great similarity of these ICEs suggests that there has been spread of SXT-related ICEs between Asia and Africa in recent times. Studies of CTX prophage genomes have also suggested the spread of V. cholerae strains between these continents [36]. General structure and sizes of SXT/R391 genomes The ICEs listed in Table 1 were initially compared using MAUVE [37] and LAGAN [38], programs that enable visualization of conserved and variable regions on a global scale. All of the SXT/R391 ICEs we analyzed share a common structure and have sizes ranging from 79,733 bp to 108,623 bp (Table 1 and Figure 2). They contain syntenous sets of 52 conserved core genes (Figure 2A) that total approximately 47kb and encode proteins with an average of 97% identity to those encoded by SXT. All of the individual ICEs also contain DNA that is relatively specific for individual elements (Figure 2B); the differences in the sizes of the variable regions accounts for the range in ICE sizes. 10.1371/journal.pgen.1000786.g002 Figure 2 Structure of the genomes of 13 SXT/R391 ICEs. (A) The upper line represents the set of core genes (thick arrows) and sequences common to all 13 SXT/R391 genomes analyzed. Hatched ORFs indicate genes involved in site-specific excision and integration (xis and int), error-prone DNA repair (rumAB), DNA recombination (bet and exo) or entry exclusion (eex). Dark gray ORFs correspond to genes involved in regulation (setCDR). Light gray ORFs represent genes encoding the conjugative transfer machinery, and white ORFs represent genes of unknown function. (B) Variable ICE regions are shown with colors according to the elements in which they were originally described SXT (blue), R391 (red), ICEPdaSpa1 (green), ICESpuPO1 (purple), ICEVchMex1 (yellow), ICEPalBan1 (orange), ICEVchInd5 (turquoise), ICEPmiUSA1 (olive), ICEVchBan9 (pink), ICEVflInd1 (light green). Thin arrows indicate the sites of insertion for each variable region and HS1–HS5 represent hotspots 1–5. Roman numerals indicate variable regions not considered true hotspots. Cm, chloramphenicol; Hg, mercury; Kn, kanamycin; Sm, streptomycin; Su, sulfamethoxazole; Tc, tetracycline; Tm, trimethoprim. * indicates that s073 is absent from ICEPdaSpa1. a ICEVchMoz10, which lacks dfrA1 in the integron structure, does not confer resistance to Tm. b The purple gene content of ICEVflInd1 was deduced from partial sequencing, PCR analysis and comparison with ICESpuPO1. Five sites within the conserved SXT/R391 ICE structure have variable DNA present in all of the ICEs in Figure 2. Four of these sites were previously termed ‘hotspots’ for ICE acquisition of new DNA [33]. Due to similarities between SXT and R391, the fifth hotspot only became apparent through our comparison of the 13 ICEs examined here. Each of these hotspots (HS1 to HS5 in Figure 2B) is found in an intergenic region (see below), suggesting that the acquisition of these variable DNA regions has not interrupted core ICE gene functions. In addition, some of the ICEs have variable DNA inserted in additional intergenic locations or in rumB (labeled I–IV in Figure 2B). Previous analyses [32] indicated that the insertion in rumB, did not impair SXT transmissibility. Overall, comparison of these 13 SXT/R391 ICE genomes suggests that: 1) these elements consist of the same perfectly syntenous and nearly identical 52 core genes that serve as a scaffold (see below) capable of mobilizing a large range of variable DNA; and 2) selection pressure to maintain ICE mobility has restricted insertions of variable DNA into sites that do not interrupt core functions. The SXT/R391 ICE core genes The 52 core genes present in all the SXT/R391 ICEs analyzed include sets of genes that are known to be required for the key ICE functions of integration/excision, conjugative transfer and regulation [32] as well as many genes of unknown function. Most genes of known or putative (based on homology) function (coded by gray shading or hatch marks in Figure 2A) are clustered with genes that have related functions. For example, int and xis, genes required for integration and excision, are adjacent and setR, and setC/D, the key SXT regulators are near each other at the extreme 3′ end of the elements, although separated by 4 conserved genes of unknown function. Each ICE also has four gene clusters implicated in conjugative DNA processing and transfer (shown in light gray in Figure 2A). Finally, each of the ICEs has a nearly identical origin of transfer (oriT), a cis-acting DNA site that is thought to be nicked to initiate DNA processing events during conjugative transfer [39], in the same relative location. The conserved core genes include approximately as many genes of unknown function as genes of known function. Some of the genes of unknown function are found either interspersed amongst gene clusters that likely comprise functional modules (e.g s091 between traD and s043) while others are grouped together (e.g. most genes between traN and traF). In several cases, the interspersed genes appear to be part of operons with genes of known function (e.g. s086-s082 maybe in an operon with setDC). Variable ICE DNA In addition to sharing 52 core genes, all of the ICE genomes analyzed contain variable DNA regions, ranging in size from 676 to 29,210 bp. Most of the variable DNA sequences are found in 5 intergenic hotspots (Figure 2B). However, some ICEs contain additional variable DNA inserts outside the 5 hotspots. For example, SXT and five other ICEs in Figure 2 have variable DNA segments, corresponding to related ISCR2 elements, disrupting rumB (Figure 2B, site III). ISCR2 elements are IS91-like transposable elements that tend to accumulate antibiotic resistance genes [40]. Interestingly, it is unusual for the contents of the hotspots and other variable regions to be found in only one ICE. Instead, the variable gene content of most of the ICEs shown in Figure 2B is found in more than one ICE. For example, ICESpuPO1, ICEPalBan1, and ICEVflInd1, all have identical contents in hotspot 5 (lavender genes in hotspot 5 in Figure 2B); however, the contents of the other hotspots in these 3 elements are almost entirely different. Thus, the variable gene content of the SXT/R391 ICEs reveals that these elements are mosaics. The overlapping distribution of variable DNA segments seen in the ICEs in Figure 2B suggests that recombination among this family of mobile elements may be extensive. In addition, in some instances, the variable regions appear subject to additional genetic modifications. For example, ICEPdaSpa1 and ICEVchBan9 contain ICE-specific DNA nested within the shared sequences inserted at hotspot 5 DNA (the green and pink genes in hotspot 5 in these elements, Figure 2B). The variable genes encode a large array of functions and only a few will be discussed here. A complete list of the diverse genes found in the hotspots is found in Table S1. Although we cannot predict functions for many genes found in the hotspots, since they lack homology to genes of known function, at least a subset of the known genes seem likely to confer an adaptive advantage upon their hosts. Most of the ICE antibiotic resistance genes are found within transposon-like structures (e.g., the ISCR2 elements noted above) but four ICEs contain a dfrA1 cassette, which confers resistance to trimethoprim [25], in a class IV integron located in hotspot 3. A disproportionate number of variable genes are likely involved in DNA modification, recombination or repair, as they are predicted to encode diverse putative restriction-modification systems, helicases and endonucleases. Such genes may provide the host with barriers to invasion by foreign DNA including phage infection and/or promote the integrity of the ICE genome during its transfer between hosts. Three ICEs contain genes that encode diguanylate cyclases [41] in hotspot 3. These enzymes catalyze the formation of cyclic-diguanosine monophosphate (c-di-GMP), a second messenger molecule that regulates biofilm formation, motility and virulence in several organisms including V. cholerae [42],[43]. Most SXT/R391 ICEs contain mosA and mosT in hotspot 2. These two genes encode a novel toxin-antitoxin pair that promotes SXT maintenance by killing or severely inhibiting the growth of cells that have lost this element [44]. Not all ICEs in the SXT/R391 family contain mosAT; however, those lacking these genes may encode similar systems to prevent ICE loss. For instance, R391 and ICEVchMex1 contain two genes (orf2 and orf3) encoding a predicted HipA-like toxin and a predicted transcriptional repressor distantly related to the antitoxin HipB. Locations of the ICE variable genes The variable regions found in the 5 hotspots are found exclusively in intergenic regions, punctuating the conserved ICE backbone (Figure 2). The boundaries between the conserved and variable sequences were mapped on the nucleotide level and compared (Figure 3A–3E). Each hotspot had a distinct boundary. Remarkably, even though the contents of the variable regions markedly differ, with few exceptions the left and right boundaries between conserved and variable DNA for each hotspot was identical among all the ICEs (Figure 3). For example, the left junctions of the inserts in hotspot 2 immediately follow the stop codon of traA and the right junctions are exactly 79 bp upstream of the start of s054 (Figure 3B), despite the fact that the DNA contents within these borders greatly differ. In hotspot 2, the right junction appears to begin with a 15 bp sequence that has two variants (Figure 3B, brown & light brown sequence). These sequences may reflect the presence of earlier insertions that have since been partially replaced. A similar pattern was found adjacent to the left boundary of hotspot 4 in several ICEs (Figure 3D, lines 3–6). Once an insertion is acquired, the number of permissive sites for the addition of new variable DNA likely increases. 10.1371/journal.pgen.1000786.g003 Figure 3 The boundaries of the 5 hotspots. The boundaries between conserved and hotspot variable regions are shown. Black typeface indicates conserved sequence, while color indicates variable sequence. Numbers in parentheses indicate the number of intervening nucleotides. The thin dotted lines indicate continuations of variable DNA. Bold letters indicate a non-conserved base. (A) Hotspot 1, which is present between traJ and traL. Line 1: SXT, ICEVchInd4, ICEPalBan1; Line 2: R391, ICEPdaSpa1, ICEVchBan5, ICEVchInd5, ICEPmiUSA, ICESpuPO1, ICEVflInd, ICEVchMoz10, ICEVchBan9; Line 3: ICEVchMex1. (B) Hotspot 2, which is present between traA and s054. Line 1: SXT, ICEVchInd4, ICEPmiUSA, ICEVflInd, ICEVchInd5, ICEPalBan1, ICEVchBan5; Line 2: ICEPdaSpa1, ICEVchMoz10, ICEVchBan9; Line 3: R391; Line 4: ICEVchMex1; Line 5: ICESpuPO1. (C) Hotspot 3, which is present between s073 and traF. Line 1: SXT, ICEVchInd4; Line 2: ICEVchMex1, ICEVflInd; Line 3: ICEVchMoz10, ICEVchBan9, ICEVchInd5, ICEPalBan1, ICEVchBan5. Line 4: R391; Line 5: ICEPmiUSA; Line 6: ICESpuPO1; Line 7: ICEPdaSpa1. (D) Hotspot 4, which is present between traN and s063. Line 1: SXT, ICEVchInd4. Line 2: ICEVchInd5, ICEVchBan5; Line 3: ICESpuPO1, ICEPmiUSA; Line 4: R391, ICEVchMoz10, ICEVchBan9, ICEVflInd. Line 5: ICEPdaSpa1; Line 6: ICEPalBan1; Line 7: ICEVchMex1. (E) Hotspot 5, which is present between s026 and traI. Line 1: SXT, ICEVchInd4, ICEPdaSpa1, R391, ICEVchMoz10, ICEVchBan9; Line 2: ICEPmiUSA; Line 3: ICESpuPO1, ICEPalBan1, ICEVflInd1; Line 4: ICEVchInd5, ICEVchBan5; Line 5: ICEVchMex1. There are two exceptions to the precise boundaries between variable and conserved DNA. Hotspot 1 and hotspot 3 in ICEVchMex1 and ICEPdaSpa1, respectively, contain variable DNA that extends beyond the boundary exhibited by all the other ICEs in these locations (Figure 3A, line 3, and Figure 3C, line 7). The only boundary that could not be identified was the left border of hotspot 5, the region containing genes between s026 and traI. As discussed below, s026 is the least conserved core gene and its variability obscured any consensus sequence abutting the variable DNA. Perhaps this border has eroded because s026 is not required for ICE mobility [32]. The relative precision of most boundaries between conserved and variable DNA sequences in all the ICEs analyzed suggests that a particular recombination mechanism, such as bet/exo-mediated recombination, may explain the acquisition of the variable regions. However, at this point, we cannot exclude the possibility that the precise locations for variable DNA insertions simply reflects selection for optimal ICE fitness; i.e., ICEs can optimally accommodate variable DNA in these locations while preserving their essential functions. Similarity of SXT/R391 ICE and IncA/C plasmid core genes Unexpectedly, BLAST analyses revealed that most of the conserved core SXT/R391 genes are also present in IncA/C conjugative plasmids. These multidrug resistance plasmids are widely distributed among Salmonella and other enterobacterial isolates from agricultural sources [45],[46]. Recently, members of this family of plasmids have also been identified in Yersinia pestis, including from a patient with bubonic plague [47], and in aquatic γ-proteobacteria [48], including Vibrio cholerae [49],[50]. To date, the closest known relatives of the SXT/R391 transfer proteins are found in the IncA/C plasmids. Every predicted SXT transfer protein is encoded by the IncA/C plasmid pIP1202 isolated from Y. pestis [50] and the identities of these predicted protein sequences vary from 34 to 78% (Figure 4A). Furthermore, there is perfect synteny between the four gene clusters encoding the respective conjugative machineries of these two mobile elements (yellow and orange genes in Figure 4A). Despite the extensive similarity of the SXT and IncA/C conjugative transfer systems, these plasmids lack homologues of setR and setD/C as well as int/xis, suggesting that regulation of conjugative transfer differs between these elements. 10.1371/journal.pgen.1000786.g004 Figure 4 Comparison of the SXT/R391 core genome with the genome of pIP1202 and defining the minimal functional SXT/R391 gene set. (A) Alignment of the conserved core genes of SXT/R391 ICEs with the genome of the IncA/C conjugative plasmid pIP1202 from Yersinia pestis. The top line shows the same core ICE genes shown in Figure 2A. ORFs are color coded as follows: DNA processing, yellow; mating pair formation, orange; DNA recombination and repair, green; integration/excision, red; replication, purple; regulation, gray; entry exclusion, blue; homologous genes of unknown function, black; genes without corresponding counterparts in ICEs and pIP1202, white. Numbers shown in the middle represent % identity between the orthologous proteins encoded by SXT and pIP1202 [GenBank:NC_009141]. The positions of the hotspots in SXT/R391 ICEs are marked by downward pointing arrowheads. For pIP1202, the size of the sequences (which include IncA/C backbone DNA as well as variable DNA) found at these locations as well as resistance markers are indicated by upward pointing arrowheads. aphA, aadA and strAB confer resistance to aminoglycosides. sul1 and sul2 confer resistance to sulfonamides. cat, blaSHV-1 , tetAR, qacED1 and merRTPCADE confer resistance to chloramphenicol, β-lactams, tetracyclines, quaternary ammonium compounds and mercury ions, respectively. Detailed descriptions of the conserved backbone of the IncA/C conjugative plasmids have been published elsewhere [48],[50]. Regions that were deleted from SXT to investigate the function of genes of unknown function (see panel B) are indicated with straight lines. Dotted lines indicate that the deletion included DNA in the adjacent hotspots. (B) Influence of deletion of genes of unknown function on the frequency of SXT transfer. The mean values and standard deviations from three independent experiments are shown. * indicates that the frequency of transfer was below the detection level (<10−8). Deletion mutants SXTΔa, SXTΔk and SXTΔl, transferred at frequencies that were not significantly different from that of wild-type SXT (data not shown). (C) Proposed minimal set of genes necessary for a functional SXT/R391 ICE. int, integration/excision module; mob, DNA processing module; mpf, mating pair formation modules; reg, regulation module. The similarity of IncA/C plasmids and SXT/R391 ICEs is not limited to genes important for conjugal DNA transfer. Ten genes of unknown function (shown in black in Figure 4A), some of which are interspersed within likely tra gene operons and some of which are clustered together between traN and traF, are similar in the two elements. Furthermore, most of these ten genes are in identical locations in the two elements. Both elements also contain homologs of bet and exo (shown in green in Figure 4A); these are the only known homologs of the λ Red recombination genes found outside of bacteriophages. Together, the similarity of DNA sequences and organization of SXT/R391 ICEs and IncA/C plasmids suggests that these elements have a common ancestor. The fact that the contents of the hotspots in the two classes of elements are entirely distinct suggests that their evolutionary paths diverged prior to acquisition of these variable DNA segments. The minimal functional SXT/R391 ICE gene set The conservation of the 52 core genes in all 13 SXT/R391 ICEs analyzed suggested that many or even all of these genes would be required for key ICE functions of excision/integration, conjugative transfer and regulation. The presence of ten ICE core genes of unknown function in IncA/C plasmids (black genes in Figure 4A) is also consistent with the hypothesis that these genes might be required for ICE transfer. However, our previous work demonstrated that not all genes recognized here as part of the conserved core gene set are required for SXT transfer. Beaber et al showed that deletion of rumB – s026 (which includes 5 cores genes) from SXT had no detectable influence on SXT excision or transfer [32]. Therefore, we systematically deleted all of the core ICE genes whose contributions had not previously been assessed, in order to explore the hypothesis that these genes (especially those also present in IncA/C plasmids) would be essential for ICE transfer and to define the minimum functional SXT/R391 gene set. Surprisingly, deletion of most of the ICE core genes of unknown function, including genes with homologues in IncA/C plasmids, did not alter SXT transfer efficiency. Deletion of s002 or s003, which are located downstream of int in all SXT/R391 ICEs, did not alter the frequency of SXT transfer; similarly, deletion of s082, s083, and s084, core genes of unknown function that are found near the opposite end of SXT/R391 ICEs but not in IncA/C plasmids, also did not influence SXT transfer frequency (Figure 4B). Furthermore, deletion of s091, which is found between traD and s043 in ICEs and IncA/C plasmids, did not reduce SXT transfer (Figure 4B). In contrast, deletion of s043, which has weak homology to traJ in the F plasmid (a gene important in DNA processing) and is located in a transfer cluster containing traI and traD, abolished transfer (Figure 4B, Δd), suggesting that s043, here re-named traJ is required for SXT transfer. It is unlikely that the transfer defect of SXTΔtraJ can be explained by polar effects of the deletion on downstream genes, since traJ appears to be the last gene of an operon found immediately upstream of hotspot 1. Similarly, deletion of s054, which is found immediately 5′ of traC and is homologous to a disulfide-bond isomerase dsbC, also abolished transfer (Figure 4B, Δe). Interestingly, disulfide bond-isomerases are present in several other conjugative systems [51]. However, it is not clear at this point if the deletion of s054 from SXT accounts for the transfer defect of SXTΔs054, since we could not restore transfer by complementation. Additionally, Beaber et al found that deletion of s060 through s073 in SXT, which includes 7 genes that are also found in IncA/C plasmids reduced SXT transfer more than 100-fold [32]. We constructed several smaller deletions in this region and found that deletion of s063, which is also found in pIP1202, reduced the transfer frequency of SXT by ∼100-fold, nearly the same amount as deleting the entire region (Figure 4B). Complementation analyses revealed that the absence of s063 accounted for the transfer defect of SXTΔs063 (data not shown). Even though SXTΔs063 was still capable of transfer, in our view, the drastic reduction in the transfer frequency of this mutant warrants inclusion of s063 into the minimum functional SXT ICE genome (shown in Figure 4C). Other deletions in this region, including deletions of bet, exo, s067, s068 and s070, which have orthologues in IncA/C plasmids, resulted in ≤10-fold reductions in transfer frequency. We therefore did not include these genes in the minimal functional core SXT/R391 genome (Figure 4C). The findings from our experiments testing the transfer frequencies of SXT derivatives harboring core gene deletions (shown in Figure 4B), coupled with our previous work demonstrating the requirements for the predicted SXT tra genes in the element's transfer [32], suggest a minimal functional SXT/R391 ICE structure as shown in Figure 4C. This minimum element is ∼29.7 kb and consists of 25 genes. Genes with related functions, which in some cases encode proteins that likely form large functional complexes (such as the conjugation apparatus), are grouped together in the minimal genome. At the left end of the minimum ICE genomes are xis and int, the integration/excision module of SXT/R391 ICEs. In the minimal ICE genome, the ICE oriT and mobI, which encodes a protein required for SXT transfer [39], are no longer separated from the other genes (traIDJ) that are also thought to play roles in the DNA processing events required for conjugative DNA transfer. The genes required for formation of the conjugation machinery, including the pilus, and mating pair formation and stabilization [32],[39] are divided between three clusters (denoted mpf1-3 in Figure 4C). Finally, at the right end of the minimal functional genome are the genes that regulate ICE transfer (setC/D and setR). Thus, the minimal functional SXT/R391 ICE is relatively small and organized into 3 discrete functional modules that mediate excision/integration, conjugation, and regulation. Even though deletion of 27 out of 52 SXT/R391 ICE core genes proved to have little or no effect on SXT transfer frequency, and hence these genes were not included in Figure 4C, it is reasonable to presume that these genes encode functions that enhance ICE fitness given their conservation. For example, the presence of highly conserved bet and exo genes in all SXT/R391 ICEs suggests that there has been selection pressure to maintain this ICE-encoded recombination system that promotes ICE diversity by facilitating inter ICE recombination (G Garriss, MK Waldor, V Burrus, in press). A key challenge for future studies will be to determine how core genes of unknown function promote ICE fitness. Variations in the similarity of core genes To identify genes in the SXT/R391 core genome that may be subject to different selection pressures, we compared the percent identity of each ICE's core genes to the corresponding SXT gene (Figure 5). Most of the ICEs' core genes exhibited 94% to 98% identity on the nucleotide level to SXT's core genes. There was no discernable difference in the degree of conservation of most core genes that were or were not part of the minimal ICE, suggesting that there are equal selective pressures on essential and non-essential genes. However, we identified 8 genes (s026, traI, orfZ, s073, traF, eex, s086, and setR) that exhibit significantly different degrees of conservation (Figure 5 and Figure S1). Three of these showed unusually high conservation, while the other 5 had below average conservation. Two of the highly conserved genes, setR and s086, are found at the extreme 3′ end of the elements. The conservation of setR may reflect the key role of this gene in controlling SXT gene expression. S086 may also play a role in regulating SXT transfer [52]. The other highly conserved gene, orfZ, is found between bet and exo and has no known function. 10.1371/journal.pgen.1000786.g005 Figure 5 Variations in the nucleotide conservation of core ICE genes. The nucleotide sequence of each core gene from each ICE was compared to the corresponding sequence in SXT using pairwise BLASTn analyses to determine the percent identities. The average values for all of the ICEs, excluding SXT and ICEVchInd4, are shown in the inset. s026 and s073 are the most divergent of all the genes in the backbone. s026 encodes a hypothetical protein with homologues in many gram negative organisms. Although S026 is predicted to contain a conserved domain, COG2378, which has a putative role in transcription regulation, this protein is not required for SXT transfer [32]. The significant divergence of s026 along with its lack of essentiality suggests that this gene could become a pseudogene. A similar argument could be made for s073, which encodes a hypothetical protein that is also not required for ICE transfer. However, this argument does not hold for traI or traF, two genes which are essential for ICE transfer. Although the reasons which account for the different degrees of conservation of these 8 core genes are hard to ascertain at this point, the data in Figure 5 suggests that individual core genes are subject to different evolutionary pressures. Comparisons of core gene phylogenies We created phylogenetic trees for each core gene based on their respective nucleotide sequences to further explore the evolution of the conserved backbone of SXT/R391 ICEs. Since we found such a high degree of conservation for most of the core genes, the bootstrap values for most of these trees were relatively low. Thus, we concentrated on the most polymorphic genes found in Figure 5, s026, s073, traI, and eex, for phylogenetic analyses. As shown in Figure 6A, the trees for s026, traI and s073 exhibit 3 distinct branching patterns. The lack of similarity in these phylogenetic trees suggests that either individual core genes have evolved independently or that high degrees of recombination mask their common evolutionary history. The latter hypothesis seems more likely since experimental findings have revealed that SXT/R391 ICEs can co-exist in a host chromosome in tandem [26] and recombination between tandem elements can yield novel hybrid ICEs with considerable frequency [53] (G Garriss, MK Waldor, V Burrus, in press). Also, as noted above, the distributions of variable genes among the ICEs shown in Figure 2 also supports the idea that inter-ICE recombination is commonplace. 10.1371/journal.pgen.1000786.g006 Figure 6 Phylogenetic analysis of several core ICE genes. Nucleotide sequences of the indicated core genes were used to generate the phylogenetic trees shown. Bootstrap values are indicated at branch points. The individual scale bars represent genetic distances and reflect the number of substitutions per residue. Unlike most core genes, the trees for traG and eex were similar. In these two trees, the ICEs segregate into two evolutionarily distinct groups (Figure 6B), confirming and extending previous observations that revealed that there are two groups of eex and traG sequences in SXT/R391 ICEs [54]. These two groups correspond to the two functional SXT/R391 ICE exclusion groups. Interactions between traG and eex of the same group mediate ICE exclusion [55]. Thus, the identical 2 clusters of traG and eex sequences observed in their respective trees reveals the co-evolution of the traG/eex functional unit. The two groups of eex sequences can also be observed in Figure 5 where the bifurcating pattern reveals the 2 exclusion groups. This pattern is difficult to discern for traG, perhaps because of the large size of this multi-functional gene. ICEVchBan8, an SXT-like ICE that lacks Int sxt The sequence of ICEVchBan8, which was derived from a non-O1, non-O139 V. cholerae strain, is incomplete but it appears to contain 49 out of 52 SXT/R391 core genes. However, since this strain lacks Int sxt it was not included in our comparative analyses above. It is not known if ICEVchBan8 is capable of excision or transmission; however, it contains a P4-like integrase and a putative xis. It is tempting to speculate that the genome of ICEVchBan8 provides an illustration of how acquisition (presumably via recombination) of a new integration/excision module may generate a novel ICE family. Perspectives Comparative analysis of the genomes of the 13 SXT/R391 ICEs studied here has greatly refined our understanding of this group of mobile genetic elements. These elements, which have been isolated from 4 continents and the depths of the Pacific Ocean, all have an identical genetic structure, consisting of the same syntenous set of 52 conserved core genes that are interrupted by clusters of diverse variable genes. All the elements have insertions of variable DNA segments in the same five intergenic hotspots that interrupt the conserved backbone. Furthermore, some of the elements have additional insertions outside the hotspots; however, in all cases the acquisition of variable DNA has not compromised the integrity of the core genes required for ICE mobility. Functional analyses revealed that less than half of the conserved genes are necessary for ICE transmissibility and the contributions of the 27 core genes of unknown function to ICE fitness remains an open question. Finally, several observations presented here suggest that recombination between SXT/R391 ICEs has been a major force in shaping the genomes of this widespread family of mobile elements. Although comparisons of the 13 ICE genomes analyzed here strongly suggest that these mobile elements have undergone extensive recombination during their evolutionary histories, there is a remarkable degree of similarity among the SXT/R391 ICEs. All of these ICEs consist of the same syntenous and nearly identical 52 genes. In contrast, other families of closely related mobile elements, such as lambdoid or T4-like phages for example, exhibit greater diversity [56],[57]. Since the elements that we sequenced were isolated from several different host species and from diverse locations, the great degree of similarity of the SXT/R391 ICE family does not likely reflect bias in the elements that we sequenced. It is possible that this family of mobile elements is a relatively recent creation of evolution and has yet to undergo significant diversification. To date, relatively few formal comparative genomic analyses of other ICE families have been reported. Mohd-Zain et al [11] identified several diverse ICEs and genomic islands that shared a largely syntenous set of core genes with ICEHin1056, an ICE originally identified in Haemophilus influenzae. However, even though these elements share a similar genomic organization, they exhibit far greater variability in the sites of insertion of variable DNA and in the degree of conservation in their core genes compared to SXT/R391 ICEs. Thus, although this group of elements appears to share a common ancestor, they seem to have diverged earlier in evolutionary history than the SXT/R391 ICEs. However, when comparative genomic analyses were restricted to ICEHin1056-related ICEs found in only two Haemophilus sp., Juhas et al found that, like the SXT/R391 family of ICEs, these 7 ICEHin1056-related ICEs share greater than 90% similarity at the DNA level in their nearly syntenous set of core genes [12]. It will be interesting to learn the extent of conservation of genetic structure and DNA sequence in additional ICE families to obtain a wider perspective on ICE evolution. Comparative genomic studies of bacteriophages have led to the idea that the full range of phage sequences are part of common but extremely diverse gene pool [58],[59]. The SXT/R391 ICE genomes suggest that there may be an even larger network of phylogenetic relationships linking sequences found in all types of mobile genetic elements including phages, plasmids, ICEs and transposons. The genomes of SXT/R391 ICEs appear to be amalgams of genes commonly associated with other types of mobile elements. Many of the ICE core genes are usually associated with phages, such as int, bet, exo and setR, or with plasmids, such as the tra genes. Additionally, the SXT/R391 ICEs and IncA/C plasmids clearly have a common ancestor, as we found that the entire set of SXT/R391 tra genes are also present in IncA/C plasmids. Thus, the genes present in all types of mobile genetic elements appear to contribute to a common gene pool from which novel variants of particular elements (such as ICEVchBan8) or perhaps even novel types of mobile genetic elements can arise. Materials and Methods ICE Sequencing ICEPalBan1, ICEVchMex1, ICEVchInd4, ICEVchInd5 and ICEVchBan5 were isolated using the plasmid capture system described in Figure 1. The SXT chromosomal attachment sequence, attB, was introduced into the modified F plasmid pXX704 [34] to create pIceCap. This plasmid was then introduced into a ΔprfC derivative of the TcR E. coli strain CAG18439. Exconjugants derived from matings between this strain and those harboring the 5 ICEs listed above resulted in strains carrying a pIceCap::ICE plasmid. Once captured, the plasmids were isolated using the Qiagen plasmid midi kit for low-copy plasmids (Qiagen). Isolated pIceCap::ICE plasmids were then sequenced. ICEVflInd genome was determined by sequencing several overlapping cosmids that encompassed this ICE's genome. Briefly, genomic DNA from a Vibrio fluvialis strain carrying ICEVflInd was prepared using the GNome DNA kit (QBIOgene). Sau3A1 restricted genomic DNA was used to create a SuperCos1 (Stratagene)-based cosmid library according the manufacture's instructions. The library was subsequently screened for cosmids containing ICE-specific sequences using PCR with primers to conserved core ICE sequences. Four cosmids containing overlapping ICEVflInd sequences were identified and sequenced. The genomes of 6 ICEs were sequenced by the Sanger random shotgun method [60]. Briefly, small insert plasmid libraries (2–3 kb) were constructed by random nebulization and cloning of pIceCap::ICE DNA or of cosmid DNA for ICEVflInd. In the initial random sequencing phase, 8–12 fold sequence coverage was achieved. The sequences of either pIceCap or pSuperCos were subtracted and the remaining sequences were assembled using the Celera Assembler [61]. An initial set of open reading frames (ORFs) that likely encode proteins was identified using GLIMMER [62], and those shorter than 90 base pairs (bp) as well as some of those with overlaps eliminated. Bioinformatics Nucleotide and amino acid conservation were assessed with the appropriate BLAST algorithms. ICEs were aligned using clustalW with default settings [63]. MAUVE [37] and LAGAN [38] were used to identify core genes in Figure 2. To map the boundaries of the hotspots, sequence comparisons were made using MAUVE and then manually compared to find boundaries between conserved and variable DNA as shown in Figure 3. Phylogenetic trees were generated from alignments of nucleotide sequences using the neighbor-joining method as implemented by ClustalX software, version 2.011 [64]. The reliability of each tree was subjected to a bootstrap test with 1000 replications. Trees were edited using FigTree 1.22 (http://tree.bio.ed.ac.uk/software/figtree/). Generation and testing of SXT deletion mutants CAG81439 harboring SXT was used as the host strain to create the SXT deletion mutants shown in Figure 3; the deletions were constructed using one-step gene inactivation as previously described [44],[65]. The primers used to create the deletion mutants are available upon request. Matings were conducted as previously described [16],[44] using deletion mutants and a KnR E. coli recipient, CAG18420. Exconjugants were selected on LB agar plates containing chloramphenicol, 20µg/ml (for SXT selection) and kanamycin, 50 µg/ml. The frequency of exconjugant formation was calculated by dividing the number of exconjugants by the number of donors. Supporting Information Figure S1 Variations in the conservation of individual core ICE genes. The percent identity of the nucleotide sequence of each core gene and oriT versus the corresponding sequence in SXT was calculated for all ICEs studied. The average values for each gene (as shown in the inset of Figure 5) were then used in one-way ANOVA comparisons to determine genes that exhibit significantly more or less conservation compared to other core genes. p-values of one-way ANOVA comparisons of each core ICE gene are shown. The grid represents all pair-wise comparisons, and the color indicates the level of significance as follows: red: p<.001, orange: p<.01, and yellow: p<.05. Genes that exhibited a p-value<.05 when compared with at least 50% of all other core genes are discussed in the text. (0.56 MB TIF) Click here for additional data file. Table S1 Contents of the hotspots. (0.14 MB DOC) Click here for additional data file.

0 comments Cited 119 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: found

Is Open Access

ICEberg: a web-based resource for integrative and conjugative elements found in Bacteria

Dexi Bi, Zhen Xu, Ewan M. Harrison … (2011)

ICEberg (http://db-mml.sjtu.edu.cn/ICEberg/) is an integrated database that provides comprehensive information about integrative and conjugative elements (ICEs) found in bacteria. ICEs are conjugative self-transmissible elements that can integrate into and excise from a host chromosome. An ICE contains three typical modules, integration and excision, conjugation, and regulation modules, that collectively promote vertical inheritance and periodic lateral gene flow. Many ICEs carry likely virulence determinants, antibiotic-resistant factors and/or genes coding for other beneficial traits. ICEberg offers a unique, highly organized, readily explorable archive of both predicted and experimentally supported ICE-relevant data. It currently contains details of 428 ICEs found in representatives of 124 bacterial species, and a collection of >400 directly related references. A broad range of similarity search, sequence alignment, genome context browser, phylogenetic and other functional analysis tools are readily accessible via ICEberg. We propose that ICEberg will facilitate efficient, multi-disciplinary and innovative exploration of bacterial ICEs and be of particular interest to researchers in the broad fields of prokaryotic evolution, pathogenesis, biotechnology and metabolism. The ICEberg database will be maintained, updated and improved regularly to ensure its ongoing maximum utility to the research community.

0 comments Cited 113 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: not found

A Toxin–Antitoxin System Promotes the Maintenance of an Integrative Conjugative Element

Rachel Wozniak, Matthew Waldor (2009)

Introduction Integrating and conjugative elements (ICEs) are a class of self-transmissible mobile genetic elements that contribute to horizontal gene exchange among bacteria [1]. With our increasing knowledge of bacterial genomes, ICEs and putative ICEs have been identified in the chromosomes of many gram-positive and gram-negative bacteria [1]–[7]. ICEs have some features in common with plasmids and bacteriophages, other classes of mobile genetic elements that have been the subjects of more study. Like many temperate bacteriophages, ICEs integrate into and replicate with the host chromosome. However, like conjugative plasmids, ICEs encode DNA processing and type IV secretion machinery that enables their conjugative transfer from donor to recipient cells. ICEs excise from the host chromosome to form an extra-chromosomal circular molecule that is thought to be the substrate for conjugative transfer. Although the excised circular ICE form is presumed to undergo rolling-circle replication concomitant with its transfer from donor to recipient cell, ICEs, unlike plasmids, are not thought to be ordinarily capable of autonomous replication. In addition to diverse integration, excision and conjugation systems, ICEs encode a variety of additional properties including resistance to antibiotics [8]–[10], nitrogen fixation [11], and degradation of aromatic compounds [12]. SXT is a ∼100 Kb ICE originally discovered in a clinical isolate of the cholera pathogen, Vibrio cholerae [13]. SXT and closely related ICEs encode resistances to antibiotics such as sulfamethoxazole and trimethoprim that have previously been useful for the treatment of cholera. In the past 15 years, SXT-related ICEs have become widespread in clinical V. cholerae isolates in Asia and Africa [14]. SXT-related ICEs have also been isolated from other bacterial species; for example, R391, an Inc J element derived from Providencia rettgeri [15], was found to be genetically and functionally highly similar to SXT [8],[16],[17]. Currently, there are more than 25 known members of the SXT/R391 family of ICEs [14]. These ICEs are all thought to consist of a conserved set of core genes that mediate the elements' integration, excision, conjugation and regulation [18]. Besides the conserved core genes, these ICEs also contain element-specific genes, conferring attributes such as resistance to heavy metals or antibiotics; however, the function of most non-core SXT genes remains unknown. All SXT/R391 family ICEs encode nearly identical tyrosine recombinases (Int) that mediate the integration of the respective ICEs within the prfC locus in the host chromosome. Int mediates the site-specific recombination between a site (attP) found in the circular form of the ICE and a site (attB) found near the 5′ end of prfC. In addition, these ICEs all encode similar Xis proteins, which act along with Int to promote the elements' excision from the chromosome. Excision occurs by Int-mediated recombination between short sequences found at the right and left ends of the integrated element, yielding the extrachromosomal circular form of the ICE [19]. Xis functions as a recombination directionality factor (RDF), promoting SXT excision and inhibiting its integration [20]. SXT transfer functions are not constitutively expressed. An SXT-encoded repressor, SetR, ordinarily limits SXT transfer. SetR, a homologue of the lambda phage repressor, cI, represses the expression of SetC and SetD, transcription factors that activate expression of int and the tra operons that encode the proteins required for SXT's conjugative transfer [18],[21],[22]. DNA-damaging agents, including certain antibiotics, increase the frequency of SXT transfer by alleviating SetR repression of setDC expression, probably by promoting RecA-dependent SetR autoproteolysis [22]. In host cells that contain an ICE, there is an equilibrium between the integrated and excised circular ICE forms. For example, in the case of E. coli containing SXT, we found that ∼2% of cells in the population harbored excised SXT, detected as an amplifiable chromosomal attB site by quantitative PCR [20]. SXT excision from the chromosome poses a potential threat to the element's stability: if the host divides while SXT is extrachromosomal, the element may not be passed to a daughter cell. Our anecdotal observations suggest that cells rarely if ever lose SXT raising the possibility that this ICE may encode mechanisms to promote its maintenance. To date, there have been no systematic studies of mechanisms that promote ICE maintenance. Here, we developed a positively selectable reporter of SXT loss to begin to explore the environmental and genetic factors that influence this ICE's stability in E. coli. Using this reporter, SXT loss was detected in 1×10−7 cells. Excision appears necessary for loss, and factors influencing the frequency of excision altered the frequency of SXT loss. We screened the entire 100 kb SXT genome and identified two genes, which lack similarity to genes of known function that promote SXT maintenance. These genes, designated mosA and mosT, encode a toxin-antitoxin (TA) system. We found that factors that promote SXT excision also augment mosAT expression. Thus, when the element is extrachromosomal and vulnerable to loss, SXT activates a TA module to minimize formation of SXT-free cells. Results A Positively Selectable Reporter of SXT Loss During serial passage of SXT-bearing strains without selection for SXT-encoded markers, we never detected cells that have lost this ICE, suggesting that SXT is stably maintained in the host population. Given the apparently low frequency of SXT loss, an E. coli reporter strain was designed to allow positive selection of rare cells that have lost SXT (Figure 1). To construct this strain, the Lac repressor, lacIQ , was introduced into an innocuous location in SXT (between traG and s079) while the native lacI was deleted from the chromosome. Additionally, a spectinomycin (Spec) resistance cassette under the control of the lac promoter was introduced into the gal locus in the chromosome (Figure 1). Therefore, in the presence of SXT (and therefore lacIQ ), cells are sensitive to spectinomycin. If SXT (and lacIQ ) are lost, cells become resistant to spectinomycin. As a result, even very rare cells lacking SXT can be detected as Spec-resistant colony forming units (cfu). Once Spec-resistant cfu are identified, they can subsequently be screened for the presence of SXT-encoded antibiotic resistances, such as chloramphenicol, to confirm SXT loss. 10.1371/journal.pgen.1000439.g001 Figure 1 Schematic of a positively selectable reporter of SXT loss. SXT containing lacIQ was introduced into a lacI E. coli host containing Plac-aad7 (a spectinomycin-resistance gene). If SXT (and lacIQ ) is lost, the cells become SpecR. The black diamond represents the site of insertion for a fragment containing lacIQ (pFRTIq), thick black arrows represent ORFs, and the thin black line indicates the approximate location of the Δ9 deletion. Abbreviations: tet = tetracycline resistance gene, kan = kanamycin resistance gene, int = integrase, prfC = site of SXT insertion. Figure not to scale. Detectable SXT Loss Is Rare Loss of SXT from the E. coli reporter strain described above was detected at a very low frequency. After 15 hours of growth (∼20 generations) without selection for SXT-encoded markers, only ∼1×10−7 cfu were Spec-resistant and Cm-sensitive, indicating that they had lost SXT (Figure 2A). Similar extremely low levels of SXT loss were observed in exponential and in stationary phase cultures (data not shown), suggesting that culture growth phase does not influence SXT loss. This apparently very low frequency of SXT loss explains why we did not previously detect loss in replica-plating based screens for cells that lost resistance to SXT-encoded antibiotic markers. To confirm that SXT loss was not accompanied by heritable changes in the host chromosome, SXT was re-introduced into the reporter strain that had previously lost this ICE. SXT was lost from this re-constituted SXT loss reporter strain at approximately the same frequency as the original reporter (compare the first bars in Figure 2A and 2B), suggesting that loss of the element was not associated with mutations in the host chromosome. 10.1371/journal.pgen.1000439.g002 Figure 2 Influence of genetic factors on the frequency of SXT loss. The frequency of SXT loss was calculated as the ratio of SpecRCmS cfu / total cfu after 15 hour of growth. A) Factors that influence the frequency of SXT excision alter the frequency of SXT loss. The black diamonds indicate that the result is statistically different (p<0.05) than the result shown in the first column for the wild type reporter. The * signifies that the result was below the limit of detection which was ∼1×10−8. pXis and pXis-R harbor arabinose-inducible xis or its reverse complement respectively. B) SXT loss is not accompanied by heritable changes that influence maintenance of SXT. The ‘current SXT genotype’ refers to the ICE introduced into the host that lost the ICE designated as ‘previous SXT genotype’. Excision and Loss To begin to explore the relationship between SXT loss and its excision from the chromosome, we assessed the frequency of SXT excision in our reporter strain using quantitative PCR. In this assay, the amount of attB, which is only generated if SXT excises from the chromosome, is compared to the amount of a stable chromosomal locus (the 3′end of prfC), as described in Burrus and Waldor [20]. We found that SXT excises in 3–4% of cells in the population, a frequency that is nearly 100,000 times the frequency of detectable SXT loss (Table 1). SXT excision may routinely be followed by its re-integration. Furthermore, there may be mechanisms for either preventing DNA replication/cell division when SXT is excised and/or selecting against cells that have lost SXT. Overall, it appears that excision events are only rarely associated with formation of cells that can grow despite losing SXT; however, these numbers may underestimate the true extent of SXT loss if there is selection against such cells. 10.1371/journal.pgen.1000439.t001 Table 1 Comparison of SXT excision and loss frequencies. SXT1 Excision Frequency2 Loss Frequency3 Loss Events/Excision Events Wild type 3.7×10−2 3.2×10−7 8.5×10−6 ΔmosT 3.8×10−2 3.3×10−5 8.7×10−4 1 Isogenic E. coli hosts (RF146 or RF335) harboring either wild type SXT or most SXT were used in these assays. 2 Calculated using QPCR by measuring the ratio of attB: 3′prfC (see [20]). 3 Calculated as the fraction of SpecR cfu/total cfu. Since the SXT integrase is required for the element's excision from the chromosome [19],[20], we deleted the int gene from the SXT loss reporter strain to test if SXT loss requires its excision. SXT loss was never observed in the Δint SXT strain (Figure 2A) suggesting, as expected, that SXT excision is required for its loss. However, it is important to note that the limit of detection for this assay is ∼1×10−8, and thus can only conclude that SXT loss is reduced at least 10-fold in the Δint background. There appears to be some additional correlation between the frequency of SXT excision and its loss. In a recA background, where SXT excision is reduced (data not shown), there was a statistically significant reduction in SXT loss (Figure 2A). Conversely, increased SXT excision promoted its loss. Overexpression of Xis, the SXT recombination directionality factor (RDF), which increases the frequency of excised SXT (unpublished observations), resulted in an ∼500-fold increase in SXT loss (Figure 2A, pXis bar). A control plasmid containing xis in the reverse orientation (pXisR) did not alter SXT loss (Figure 2A). As an RDF, Xis could promote SXT loss by both promoting its excision and inhibiting its reintegration into the host chromosome. Conjugation Does Not Lead to SXT Loss Using the SXT loss reporter strain as a donor in conjugation experiments, we were able to address a longstanding question regarding SXT: do donors lose this ICE during conjugation? Following a 2 hour mating between the SXT loss reporter with an E. coli recipient, cells were plated on selective media to score for the number of donors, recipients, and exconjugants, as well as loss of SXT from the donor. As a control, the donor was grown by itself in identical conditions. As shown in Table 2, the frequency of exconjugant formation in this experiment was more than four orders of magnitude greater than the frequency of detectable SXT loss from the donor strain. Furthermore, the frequencies of SXT loss from the donor that was mixed with the recipient and the donor grown by itself under identical conditions were fairly similar. Although not statistically significant, there appears to be less loss of SXT when the donor was mixed with the recipient (Table 2). Together these observations suggest that donors do not lose SXT during conjugation and that a copy of SXT re-integrates into the donor chromosome following transfer of the ICE to the recipient. 10.1371/journal.pgen.1000439.t002 Table 2 Conjugation does not increase SXT loss. Donor1 Recipient Loss of Donor2 Exconjugant Formation3 SXTwt None 5.4×10−7 N/A SXTwt MG1655 3.3×10−8 3.1×10−4 1 SXTwt is strain RF146. 2 Loss was calculated as indicated in materials and methods. 3 Exconjugant formation was calculated as the number of exconjugant cfu/number of donor cfu. The data is from a representative experiment. Identification of SXT Genes That Promote Its Maintenance Given the very low frequency of SXT loss, we hypothesized that SXT contains genes that promote its maintenance in the host. We took advantage of a set of previously constructed SXT deletion mutants [18] and constructed new deletion mutants to screen for regions of this ICE's genome that contribute to its stability. The features of the SXT loss reporter as outlined in Figure 1 were introduced into 11 SXT deletion mutants spanning the entire SXT genome, yielding 11 new SXT loss reporter strains (Table 3). Each of the new reporters was tested for SXT loss and the findings from these experiments are summarized in Table 3. 10.1371/journal.pgen.1000439.t003 Table 3 Summarized deletions tested for SXT stability. Deletion Number of ORFs Length of Deletion (bp) Deletion Contents Increased Frequency of SXT Loss1 Δint 1 1239 Integrase (int) N Δ1 20 19993 transposon-like genes tnp, tnpA, tnpB, tnpB′, tnpA′; antibiotic resistances floR, dfr18, strA, strB, sulIII; UV repair homologues rum′B, rumB′, rumA; 5 hypothetical genes N Δ2 17 20131 17 hypothetical genes N Δ3 1 2148 conjugative transfer gene traI N Δ4 2 3009 conjugative transfer gene traD; 1 hypothetical gene N Δ7 2 320 hypothetical toxin-antitoxin s044-45 N Δ8 6 4109 conjugative transfer genes traL, E, B, V, A; 1 hypothetical gene N Δ9 8 11624 conjugative transfer genes traC, F, W, U, N; DsbC-like gene (s054); mosA, mosT Y Δ10 14 15112 bet, exo, and ssb homologues; 11 hypothetical genes N ΔD 5 11378 transfer genes traF, H, G; 2 hypothetical genes N ΔE 8 3669 entry exclusion gene (eex); master regulators setC, setD; master repressor, setR; 5 hypothetical genes N 1 N, no elevation in the frequency of loss of the mutant SXT vs wt SXT; Y indicates at least an ∼5-fold increase in loss relative to wild type SXT. Nearly all of the mutants tested exhibited rare loss of SXT, very similar to the loss frequency for wild type SXT. Several mutants (Δ3, Δ4, Δ8 and ΔE) contained deletions in genes required for conjugative transfer [18]; however, these mutants did not exhibit decreased SXT loss (Table 3) as would be expected if conjugation promoted SXT loss. Two deleted regions, Δ2 and Δ10, primarily consisted of predicted open reading frames of unknown or conserved hypothetical function, but these regions did not contain genes important for SXT maintenance (Table 3). Finally, two deletions that might have been suspected to influence SXT stability, Δ1 and Δ7, did not. The Δ1 deletion includes several transposases but deletion of this region did not promote SXT instability. The two genes deleted from the Δ7 mutant, s044-45, were previously proposed to function as a toxin-antitoxin module in SXT based on homology to a TA pair encoded in the Paracoccus aminophilus plasmid pAMI2 [23]. Our observation that the Δ7 mutant did not exhibit increased SXT loss argues against the idea that these genes encode a functional TA module in SXT. However, deletion of the 8 genes in the Δ9 mutant, which spans the region from s052 to traN, resulted in growth of markedly more colonies that lacked SXT (∼1×10−4), than observed to lack wt SXT (∼1×10−7) (Table 3 and Figure 3B). Five of the eight genes (see Figure 3A) in this deletion (traC, trsF, traW, traU, traN) are important for conjugative transfer of SXT. s054 encodes a homologue of a disulfide bond isomerase-related protein and s052 and s053 are currently classified as hypothetical genes with no known function, characterized homologues, or recognizable motifs. We constructed smaller deletions within the s052-traN region to pinpoint those gene(s) that account for the increased loss observed for the Δ9 mutant. As expected, ΔA, which only removed genes implicated in conjugative transfer, did not alter SXT stability (Figure 3B); deletion of s054 did not influence SXT stability either. However ΔB, which contains s052 and s053, resulted in a similar frequency of loss as the Δ9 mutant. Finally, deletion of s053 alone was sufficient to recapitulate the Δ9 phenotype (Figure 3B). It is important to note that while s052 and s053 could be deleted together, s052 could not be deleted in the presence of s053. From this point on, for reasons that will become clear below, s052 and s053 are referred to as mosA and mosT, respectively, for maintenance of SXT (Antitoxin, Toxin). 10.1371/journal.pgen.1000439.g003 Figure 3 Genetic analysis of loss of mosT SXT. A) Schematic of the region deleted from Δ9 SXT. Black arrows represent ORFs, thin black arrows represent the deletions studied below. B) Frequency of loss of the indicated mutant SXT. C) Influence of mosT expression in trans on the stability of mosT SXT. All cultures were grown in the presence of 0.02% arabinose for 15 hr. Black diamond represents a statistically significant (p<.05) result compared to loss in the presence of pBAD33. D) Loss of mosT SXT is influenced by factors affecting SXT excision. All cultures were grown for 15 hr except as noted. Black diamonds represent a statistically significant (p<0.05) result compared to the mosT SXT grown for 15 hr. The * signifies that the result was below the limit of detection which was ∼1×10−8. aLoss was calculated following 3 hours of growth in an early log phase culture. MosT Acts In Trans and Appears to Function following SXT Excision We confirmed that the elevated frequency of loss of mosT SXT was due to the absence of mosT and not to a secondary mutation on the chromosome or in SXT in several ways. First, a mosT SXT as well as a wild-type SXT were reintroduced into a strain that had previously lost mosT SXT. In these two new strains, the frequency of loss of the respective ICEs was very similar to that observed in their original hosts (compare Figure 2B, 3rd and 4th bars vs. Figure 2A 1st bar and 3B 5th bar respectively), demonstrating that the high frequency of mosT SXT loss is not due to changes in the chromosome of its original host. Furthermore, the frequency of loss of mosT SXT from an E. coli strain that had previously lost wild type SXT was approximately the same as observed in the original host (Figure 2B, 2nd bar vs 3B, 5th bar), lending support to the idea that the elevated frequency of loss of mosT SXT is linked to this ICE. Finally, introducing the mosT deletion into a wild type E. coli SXT loss reporter strain, using either P1 transduction or λ Red-based technology [24] resulted in mosT SXT strains that had frequencies of mosT SXT loss that were the same as observed in our original mutant (data not shown). Together, these observations link the elevated frequency of mosT SXT loss to the absence of mosT. To test whether mosT could act in trans to complement the elevated loss phenotype of mosT SXT, we constructed an arabinose-inducible version of mosT in the low copy vector pBAD33. Loss of mosT SXT was measured under inducing conditions in the presence of either the mosT-expression vector, pMosT, pBAD33 (empty vector), or pMosT', a pMosT derivative that was engineered to contain a stop codon in the 11th codon of mosT. As shown in Figure 3C, expression of mosT from pMosT restored the stability of mosT SXT to levels observed in wild type SXT. In contrast, pMosT' did not alter the ICE's stability (compare 1st and 3rd bars Figure 3C). These observations suggest that mosT encodes a protein that promotes SXT stability. To begin to explore how mosT influences SXT stability, we looked for conditions that alter the loss of mosT SXT. As with wild type SXT, the frequency of mosT SXT loss was not altered by growth phase (Figure 3D). MosT appears to act after SXT excises from the chromosome, since the frequency of mosT SXT excision was almost identical to that of wild type SXT (Table 1). Consistent with this idea, we found that mosT SXT loss was responsive to factors that influence SXT excision (Figure 3D) as observed above for wild type SXT. For example, loss of mosT SXT was abolished when int was deleted from mosT SXT and was reduced when a recA mutation was introduced into the host chromosome (Figure 3D and data not shown). Conversely, increasing mosT SXT excision by overexpression of Xis resulted in a significant increase in mosT SXT loss, whereas the control vector, pXis-R, did not alter mosT SXT loss (Figure 3D). Overall, the effects of mosT and xis appear to be independent, providing support for the idea that mosT likely acts after excision. MosT Inhibits Growth of E. coli and V. cholerae Our observation that s052 (mosA) could not be deleted in the presence of s053 (mosT) but that mosT could be deleted regardless of the presence of mosA suggested the possibility that mosT and mosA might comprise a toxin-antitoxin (TA) pair. TA pairs were originally described in plasmids but are now known to be present in many chromosomes as well [25],[26]. The toxin components of plasmid-borne TA modules are more stable than their cognate antitoxins; thus, cells that fail to inherit plasmids and can no longer synthesize antitoxin are thought to die or have impaired growth due to residual toxin activity [25],[27]. Several functions of chromosomal TA modules, including stress responses [28],[29] and stabilization of large chromosomal regions [30],[31], have been proposed. Consistent with the idea that mosT encodes a toxin, we found that mosT could only be cloned downstream of the arabinose-inducible promoter P BAD in the presence of glucose, which represses P BAD [32]. Furthermore, in the presence of arabinose, growth of E. coli harboring this plasmid-borne inducible mosT (pMosT) was severely impaired. There was minimal increase in culture OD600 following MosT induction (Figure 4A) and induction caused cfu to drop by several orders of magnitude (Figure 4B). Together, these data suggest that mosT over-expression is toxic to E. coli and V. cholerae (data not shown). 10.1371/journal.pgen.1000439.g004 Figure 4 MosT inhibits E. coli growth and its toxicity can be neutralized by MosA. Growth kinetics of E. coli strains CAG18439 (A and B), CAG18439 containing mosAT SXT (C) and CAG18439 containing wild type SXT (D). These strains, which harbored arabinose-inducible mosT and mosA, (pMosT or pMosA respectively) or control vectors, (pBAD33 and pBAD18), were grown in either 0.2% glucose (solid lines) or 0.02% arabinose (dashed lines). MosA Can Neutralize MosT Over-expression of MosT caused similar growth inhibition in E. coli lacking SXT (Figure 4A) and E. coli harboring mosAT SXT (Figure 4C), but had no effect on growth of E. coli harboring wild type SXT (Figure 4D), suggesting that mosA can neutralize the toxic effects of over-expressed MosT. To assess this possibility, we generated an arabinose-inducible mosA construct (in pMosA1). However, we were unable to demonstrate mosA neutralizing activity using this initial construct. Subsequent studies revealed that the putative mosA open reading frame was mis-annotated. 5′ RACE experiments to identify the +1 nucleotide of the mosA transcript (Figure 5B) suggested that the true mosA transcript begins upstream from the original annotation (Figure 5). Promoter and ORF predictions (BProm, FGENESB; http://linux1.softberry.com/berry.phtml) for mosA were consistent with the 5′ RACE results. We constructed a new arabinose-inducible mosA vector (pMosA) that included the entire mosA transcript; induction of mosA expression from this vector completely blocked the growth inhibitory effect of MosT in E. coli or E. coli harboring mosAT SXT (Figure 4A–C). An empty pBAD18 vector control did not diminish mosT toxicity (Figure 4A–C). Together, these findings are consistent with the idea that mosT and mosA encode a toxin and antitoxin respectively. 10.1371/journal.pgen.1000439.g005 Figure 5 5′RACE analysis of mosA transcription start site. A) Schematic of mosA transcription start site based on the 5′ RACE results shown in B). The +1 refers to the start of transcription as defined by the DNA sequence of the 5′RACE product obtained using primer A (small black arrow). The length of the PCR product is indicated. Black arrows represent ORFs as predicted using bioinformatics; the previously annotated s052 start codon is indicated. B) Shows a 1% agarose gel of the product of 5′RACE reaction using primer A. Excision Promotes mosAT Transcription To begin to explore the factors that promote expression of the mosAT locus, we inserted a promoterless lacZ gene downstream of the mosA promoter, leaving intact copies of the wild type genes (Figure 6A). mosA and mosT are likely co-transcribed since the two genes overlap, additional 5′ RACE experiments and Northern analyses are consistent with this idea (data not shown), and other characterized TA loci are operons [33],[34]. There was relatively weak basal activity of the mosA promoter measured in an overnight culture of the reporter strain (Figure 6B) and no detectable β-galactosidase activity in an isogenic control strain lacking a lacZ fusion (data not shown). 10.1371/journal.pgen.1000439.g006 Figure 6 Influence of Xis and SetCD on mosA expression. A) Schematic of chromosomal mosA:: lacZ transcription reporter within the mosAT locus. Thick black arrows represent ORFs as predicted by bioinformatics and the thin arrow represents the predicted location of the mosA promoter. B, D) β-galactosidase activities of the chromosomal mosA::lacZ fusion in CAG18439 containing wt SXT (B) or in CAG18439 containing Δint SXT (D) along with the indicating expression vectors. C) β-galactasidase activities from a plasmid-borne mosA-lacZ fusion (in pPmosA) in the indicated strains. All β-galactasidase measurements were conducted on 15 hr cultures and the results shown are the means and standard deviation from at least 9 independent cultures. We explored if the low activity of the mosA promoter was due to repression by MosA, since such autorepression has been observed for several other TA loci [33],[34]. The β-galactosidase activity derived from a plasmid-borne mosA promoter-lacZ fusion (in pPmosA) was found to be ∼10-fold higher in the absence vs. the presence of SXT, suggesting that SXT encodes a repressor of mosA (Figure 6C). Furthermore, reporter activity was elevated to a similar extent in SXT− and mosAT SXT E. coli strains, and reduced to comparable levels in strains containing wild type and mosT SXT (Figure 6C). Together, these data indicate that MosA can function independently of MosT to repress its own expression. Since SXT is vulnerable to loss following its excision, we tested if factors that promote SXT excision also promote mosAT expression. Overexpression of Xis from the arabinose-inducible promoter in pXis augmented the activity of the chromosomal mosA-lacZ fusion more than 4-fold (Figure 6B), whereas addition of arabinose to the reporter strain harboring the control vector, pXis-R did not alter β-galactosidase activity (Figure 6B). Furthermore, overexpression of SetC and SetD, the key transcription activators that control SXT transfer, increased transcription from the mosA promoter (Figure 6B). These observations suggest that expression of mosAT is linked to conditions, such as production of Xis, SetC and SetD, that promote SXT excision. Furthermore, elevations in SXT copy number that may occur with excision [20] would increase mosAT gene dosage, providing more template for their transcription. To test if SXT excision was essential for Xis-mediated induction of mosA transcription, the chromosomal mosA-lacZ fusion was introduced into an int SXT background. In this context, overexpression of Xis still increased expression of mosA (∼2.5 fold) but not to the same extent as in the wt SXT background (∼4.0 fold) (compare Figure 6B and 6D). Since Xis can augment mosA expression independently of SXT excision, it is possible that this RDF can directly influence transcription, as described for several other RDFs [35]. Discussion When integrated in a host genome, SXT and other ICEs are stably maintained, as they are replicated along with the chromosome. However, once excised from the host genome, even with some degree of replication, ICEs are at risk of being lost if cell division occurs prior to element re-integration. Without mechanisms to promote SXT reintegration and/or prevent growth of daughter cells lacking SXT, cells that have lost SXT should be detectable, since SXT excises from the chromosome in more than 1 in 100 cells. Yet our previous attempts to identify cells that have lost SXT using replica plating-based assays did not reveal any SXT loss. In light of our current work, our previous failure to detect SXT loss is understandable. Using the positive selection-based strategy developed here, we detected SXT loss in only 1 in 107 cells. Furthermore, SXT appears to be lost after the ICE excises from the chromosome, since loss doesn't occur when SXT cannot excise. Two genes that lack similarity to genes of known function were found to promote SXT maintenance, although they do not influence SXT excision frequency or conjugation frequency (data not shown). These 2 genes, mosT and mosA, function as a toxin-antitoxin system. Exogenous expression of mosT greatly impaired cell growth, and mosA expression ameliorated MosT toxicity. Basal expression of mosAT is quite low; however, factors that promote SXT excision, like Xis and SetCD, augment mosAT expression. Thus, our observations suggest that when the element is extrachromosomal and vulnerable to loss, SXT activates a TA module to minimize the formation of SXT-free cells. Comprehensive screens for genes that promote ICE maintenance have not previously been carried out and explorations of mechanisms that promote ICE stability have received little attention. To date, there has been only one report of a gene that promotes the stability of an ICE. Qui et al. found that the P. aeruginosa ICE PAPI-1 contains a homologue of the plasmid and chromosome partitioning gene soj (parA). They demonstrated that deletion of the soj homologue from PAPI-1 resulted in complete loss of PAPI-1 from P. aerguinosa [3]. The mechanism by which Soj promotes PAPI-1 maintenance remains to be elucidated; however, it is unlikely that Soj functions as a toxin like MosT. Prior to our study, TA systems have not directly been shown to promote ICE maintenance. Dziewitt et al. proposed that s044 and s045, two SXT genes with similarity to TA genes found in the Paracoccus aminophilus plasmid pAMI2, promote SXT stability [23]. They found that these two SXT genes augmented the stability of a heterologous unstable plasmid [23]; however, our observation that deletion of s044 and s045, (in the Δ7 SXT mutant), did not result in elevated SXT loss argues against the idea that these genes influence SXT maintenance. Unlike previously described TA loci, mosAT are part of a dynamic mobile genetic element that is predominantly found integrated in the chromosome but that can also exist in an extrachromosomal form. As demonstrated by the lacZ transcriptional fusion data (Figure 6), mosAT has low basal transcription due to autorepression by MosA, as described in several other TA loci [33],[34]. Therefore, mosAT likely remains in a repressed state while SXT is integrated in the host chromosome. It is unknown whether these genes have physiologic function when SXT is integrated. However, mosAT appear to be derepressed by the actions of Xis and SetC and SetD, proteins that promote SXT excision. Thus, the activity of mosAT may be limited to the time when SXT is extrachromosomal and vulnerable to loss. Since our current studies are population-based, a more refined understanding of the timing of mosAT expression in relation to SXT excision will be possible if we can develop assays to monitor mosAT expression and SXT excision in single cells. There is controversy about the ordinary physiologic role of toxins that are part of chromosomal toxin antitoxin systems. Some propose that these toxins' physiologic function is to kill host cells whereas others propose that toxins function to limit metabolic processes such as protein synthesis as part of stress responses [29],[36]. MosT could act in either fashion to promote the maintenance of the excised form of SXT. Assuming that mosAT is an operon and MosA is less stable than MosT, then cells from which SXT is absent should be subject to the effects (presumably death) of MosT, similar to many plasmid-encoded toxins that are thought to kill host cells that fail to inherit the plasmid. However, it also possible that MosT is active prior to loss of SXT (e.g., via preferential degradation of MosA, as described for the RelB anti-toxin, [29]), and that it stalls cell growth until SXT has reintegrated and MosT's effects can be turned off. If so, MosT's effects would need to be reversible, so that the cell could resume growth upon SXT re-integration. Future studies to discover the MosT target and its mechanism(s) of action may enable discrimination between these possibilities. If mosAT guards against SXT loss when the element is extrachromosomal, as we propose, then linking expression of these genes to SXT excision makes sense. There are several reports of excised forms of mobile elements increasing expression of genes that act on the excised (and often circular) forms of the elements. For example, expression of the PAPI-1 soj gene is increased in the circular form of the ICE by the joining of a promoter located on the 3′ end of the integrated element to soj (which is found at the 5′ end of the ICE) when PAPI-1 circularizes [3]; a similar mechanism drives the expression of genes required for conjugative transfer of Tn916 [37]. The mosAT locus is found near the middle of the SXT genome, so generation of a promoter through SXT circularization cannot directly influence mosAT expression. Instead, we found that factors that promote SXT excision including Xis and SetC and SetD augmented mosAT expression. Xis may act, at least in part, directly at the mosA promoter to increase mosAT expression, since Xis augmented mosA expression even when SXT was unable to excise. Other RDFs such as the Cox proteins HP1 and P2, have also been shown to act as transcription factors [38]. Currently the factors that govern Xis expression and activity are not known. It is also unclear at this point whether SetC and SetD act directly to promote mosAT expression. Although mosAT expression and function appears to be highly adapted to SXT, these genes are not found in all SXT/R391 family ICEs. A few of these elements, including R391, an ICE originally derived from an African Providencia rettgeri strain [8],[15], and ICEVchMex1, an ICE derived from a Mexican environmental V. cholerae strain [39], lack mosAT. The mosAT locus is found in one of the SXT ‘hot-spots’, regions of hypervariability that are not conserved among SXT/R391 family elements (Beaber et al 2002). As such, mosAT does not represent a universal strategy for the maintenance of the stability of SXT/R391 family ICEs. Preliminary studies suggest that R391 is only slightly less stable than SXT, raising the possibility that R391, like SXT, has acquired additional genes to promote its maintenance. A recent BLASTP search revealed many proteins with sequences similar to MosA and MosT in gram-negative bacteria. Overall, MosT exhibited greater conservation and contains a widely conserved domain of unknown function (DUF1814) present in both bacteria and archaea. However, MosA homologues were routinely found adjacent to MosT homologues. In total, there were 5 proteins whose amino acid sequences are identical or nearly identical to MosT from SXT and 30 proteins whose amino acid sequences bear significant similarity to MosT (E values less than 4×10−50). Proteins with near identity to MosT, from several recently sequenced V. cholerae strains and from Proteus mirabilis HI4320, appear to be part of previously unannotated SXT/R391 family elements. However, with one exception, the proteins with significant similarity to MosT appear to be encoded by chromosomes that do not contain an SXT/R391 family ICE, raising the possibility that they function to promote the stability of a non-SXT-related ICE or perhaps perform another function for the host genome. There is an octopine type Ti plasmid from Agrobacterium tumefaciens that contains genes with similarity to mosA and mosT, suggesting that these genes may be able to promote the stability of plasmids as well as ICEs. Overall, the presence of mosAT-like genes outside of SXT/R391 family of ICEs suggests that these genes have been and perhaps remain transmissible. Materials and Methods Media, Growth Conditions, and Growth Assays Bacterial cultures were routinely grown in Luria-Burtani (LB) broth at 37°C in a shaking incubator. Antibiotics were used at the following concentrations: ampicillin, 100 µg/ml; chloramphenicol, 20 µg/ml; kanamycin, 50 µg/ml; nalidixic acid, 40 µg/ml; sulfamethoxazole, 160 µg/ml; trimethoprim, 32 µg/ml; tetracycline, 6 µg/ml; and spectinomycin 30 µg/ml. 5-bromo-4-chloro-3indolyl-beta-D-galactopyranoside (X-gal) was used at 60 µg/ml, arabinose at 0.02% (vol/vol) and glucose at 0.2% (vol/vol). Strains were maintained at −80°C in LB containing 20% (vol/vol) glycerol. For the growth curves presented in Figure 4, cultures were initially grown overnight in the presence of appropriate antibiotics plus 0.2% glucose. The cells were then washed 2× in equal volumes of fresh LB and then diluted 1∶1000 into LB plus 0.02% arabinose or 0.2% glucose. Each culture was tested in triplicate by applying 200 µl to each of 3 wells of a 96-well culture plate. The cultures were then grown in a Synergy HT microplate reader (BioTek) with shaking at 37°C for10 hours; OD600 measurements were acquired every 20 min. The numbers of colony-forming units were measured by plating serial dilutions of cultures grown under similar conditions on plates containing chloramphenicol and 0.2% glucose. Strain and Plasmid Construction A complete list of the strains and plasmids used in this study can be found in Table 4. 10.1371/journal.pgen.1000439.t004 Table 4 Strains and plasmids used in this study. Strain or plasmid Genotype or phenotype Reference or source MG1655 F-λ, ilvG, rfB50, rpn1 [46] CAG18439 MG1655 lacZU118 lacI42:Tn10 [47] BW25113 lacIq, ΔlacZ, ΔaraBAD, ΔrhaBAD, hsdr, rrnB [24] HK57 F-, ΔlacU169, araD 139, rbsR, rpsL, thiA, relA, secB::Tn5, malTcmalE18-1, srl::Tn10, recA1 [41] HW220 SXT+ exconjugant of CAG18439 [19] RF146 HW220 ΔlacI::kn, ΔgalETKM::Placaad7, 3′traGΩpFRTIq This study RF160 RF146 Δint This study RF184 RF146 Δrum′B-rumA (Δ1) This study RF210 BW25113 ΔlacI::kn, ΔgalETKM::Placaad7, 3′traGΩpFRTIq Δs024-s040 (Δ2) This study RF186 RF146 ΔtraI (Δ3) This study RF212 RF146 ΔtraD-s043 (Δ4) This study RF280 RF146 Δs044-s045 (Δ7) This study RF224 RF146 ΔtraL-traA (Δ8) This study RF147 RF146 Δs052-traN (Δ9) This study RF163 RF146 Δs060-s073 (Δ10) This study RF583 RF146 Δs074-traG (ΔD) This study RF584 RF146 Δeex-s086 (ΔE) This study RF291 RF146 Δs052-s053 (ΔB) This study RF293 RF146 ΔtraC-traN (ΔA) This study RF335 RF146 ΔmosT This study RF336 RF146 Δs054 This study RF413 RF146 recA1 This study RF414 RF335 recA1 This study RF560 RF335 Δint This study RF366 RF146 that subsequently lost SXT3′traGΩpFRTIq This study RF377 SXT3′traGΩpFRTIq exconjugant of RF366 This study RF573 SXTΔmosT 3′traGΩpFRTIq exconjugant of RF366 This study RF404 RF335 that subsequently lost SXTΔmosT 3′traGΩpFRTIq This study RF428 SXT3′traGΩpFRTIq exconjugant of RF404 This study RF429 SXTΔmosT 3′traGΩpFRTIq exconjugant of RF404 This study RF503 CAG18439 SXTΔflorR::kn This study RF513 RF503 ΔmosT-mosA This study RF514 RF503 ΔmosT This study RF561 HW220 P mosA ΩpVIK112 This study RF567 HW220 Δint, P mosA ΩpVIK112 This study pBAD33 CmR, arabinose-inducible vector [32] pBAD18 AmpR, arabinose-inducible vector [32] pBAD-TOPO AmpR, arabinose-inducible vector Invitrogen pAH162 TetR, suicide vector [40] pKD4 KnR PCR template for one-step chromosomal gene activation [24] pVIK112 Suicide vector containing lacZ [42] pCB192 LacZ expression vector [43] pMosT pBAD33 containing mosT This study pMosT′ pMosT containing mosT ORF with a stop codon at amino acid 11 This study pMosA pBAD18 containing mosA ORF through +1 of transcription This study pPmosA pCB192 containing promoter region of mosA This study pSetCD pBAD-TOPO containing setCD [18] pXis pBAD-TOPO containing xis [20] pXis-R pBAD-TOPO containing xis in the reverse orientation This study In the SXT loss reporter strains, ΔlacI::kn and ΔgalETKM::Placspec were introduced into the respective chromosomal loci using the lambda Red recombination system as described [24]. The PCR product used to create the ΔlacI::kn deletion/insertion was generated using the pKD4 plasmid as a template and primers designed to omit the FRT sites. To generate the Placspec PCR product used to create the ΔgalETKM::Placspec deletion/insertion, first a spectinomycin cassette was cloned into pCRII-TOPO (Invitrogen); then, this fragment along with the upstream lac promoter was used as a template to amplify the Placspec fragment. The structure of the engineered ΔlacI::kn and ΔgalETKM::Placspec loci were each confirmed by several PCR assays. The construct used to insert lacIq into SXT (pFRTIq) was constructed by first cloning lacIq and the FRT sequence (GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC) into the suicide vector pAH162 [40]. A FRT site was also introduced into E. coli CAG18439 carrying SXT immediately downstream of traG using lambda Red-based technology in all strains except ΔD and ΔE. Finally, pFRTIq was introduced into this strain and the Flippase encoded on plasmid pCP20 [24] was used to mediate the integration of pFRTIq into SXT immediately 3′ of traG. In ΔD and ΔE, a FRT site was initially introduced into the site of the deletion and then pECA102 (kindly provided by D.E. Cameron), which contains a modified Flippase, was used to mediate the integration of pFRTIq. The correct insertion of pFRTIq was verified using PCR. RecA mutants were created by P1 transduction of the recA allele from HK57, an E. coli strain that contains the RecA1 allele linked to slr::Tn10 [41]. Transductants were selected as tetracycline-resistance cfu and the recA mutation was subsequently confirmed by assessing sensitivity to UV exposure. The arabinose-inducible mosT and mosA expression vectors, pMosT and pMosA, were constructed by amplifying mosT and mosA with flanking restriction sites using PCR and then cloning the PCR products into pBAD33 and pBAD18 [32], respectively. The correct inserts were verified by PCR as well as DNA sequencing. A chromosomal mosA::lacZ fusion was constructed by initially amplifying a fragment encompassing the predicted mosA promoter. Then, the PCR product was cloned into the suicide vector, pVIK112, which contains a lacZ gene downstream from a multiple cloning site [42]. Integration of the plasmid into the chromosome enabled measurement of mosA promoter activity in the presence of an intact copy of the gene. pPmosA was created by subcloning the mosA promoter region into the lacZ fusion vector, pCB192 [43] in order to evaluate the expression of the mosA promoter in the absence of SXT. SXT Loss Calculation Reporter strains were generally grown for 15 hr in LB and then serial dilutions were plated on agar containing spectinomycin and kanamycin. Approximately 100–500 colonies were subsequently replica plated or patched to agar containing chloramphenicol, a marker carried by SXT, to estimate the false positive rate. The false positive rate was calculated by dividing the number of CmR cfu by the number of SpecR cfu. Thus, the frequency of SXT loss was calculated as (SpecR cfu/Total cfu)*(1-frequency of false positives). All loss assays were repeated a minimum of 6 times. A two-tailed, non-paired T-test was used to assess the statistical difference between SXT loss values. P values≤0.05 were considered statistically different. Conjugation Assay Conjugation experiments were conducted as previously described [13]. Briefly, donor and recipient cells were mixed on a LB plate for 2 hours at 37°C. The cells were then resuspended and plated on the appropriate selective media to count the number of donor, recipient and exconjugant cfu. In order to accurately measure loss in the context of mating only, strains were kept on selection for SXT until the start of the experiment. Prior to mixing donor and recipient strains, the cells were washed 2× in fresh LB to remove traces of antibiotics from the liquid media. Miscellaneous Molecular Biology Methods DNA manipulations were carried out using standard techniques [44]. Quantitative Real Time PCR assays were conducted as previously described [20] using primers to amplify attB, and a portion of the 3′ region of prfC. DNA sequencing was done by GeneWiz. 5′RACE was conducted as per the manufacturer's instructions (Invitrogen) to determine the start site for mosA transcription. Assays for β-galactosidase activities in overnight cultures were carried out as previously described [45].

0 comments Cited 100 times – based on 0 reviews      Review now

Bookmark

All references

Author and article information

Contributors

Michael P. Ryan:

ORCID: http://orcid.org/0000-0002-0489-0579

Michael.P.Ryan@ul.ie

Journal

Journal ID (nlm-ta): Sci Rep

Journal ID (iso-abbrev): Sci Rep

Title: Scientific Reports

Publisher: Nature Publishing Group UK (London )

ISSN (Electronic): 2045-2322

Publication date (Electronic): 17 August 2017

Publication date PMC-release: 17 August 2017

Publication date Collection: 2017

Volume: 7

Electronic Location Identifier: 8562

Affiliations

[1 ]ISNI 0000 0004 1936 9692, GRID grid.10049.3c, Department of Chemical Sciences, School of Natural Sciences, , University of Limerick, ; Limerick, Ireland

[2 ]ISNI 0000 0004 1936 9692, GRID grid.10049.3c, Bernal Institute, , University of Limerick, ; Limerick, Ireland

Author information

Michael P. Ryan http://orcid.org/0000-0002-0489-0579

Article

Publisher ID: 8735

DOI: 10.1038/s41598-017-08735-y

PMC ID: 5561048

PubMed ID: 28819148

SO-VID: d081617f-8d89-409d-b5cd-d82ec62cd8fd

License:

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

History

Date received : 23 February 2017

Date accepted : 12 July 2017

Custom metadata

ScienceOpen disciplines: Uncategorized

Data availability:

ScienceOpen disciplines: Uncategorized

Comments

Comment on this article

scite_

Cited by 6

See all cited by

Analysis and comparative genomics of R997, the first SXT/R391 integrative and conjugative element (ICE) of the Indian Sub-Continent

Read this article at

Abstract

Related collections

Trace Elements and Electrolytes

Most cited references 24

Comparative ICE Genomics: Insights into the Evolution of the SXT/R391 Family of ICEs

ICEberg: a web-based resource for integrative and conjugative elements found in Bacteria

A Toxin–Antitoxin System Promotes the Maintenance of an Integrative Conjugative Element

Author and article information

Contributors

Journal

Affiliations

Author information

Article

History

Categories

Custom metadata

Comments

Comment on this article

Similar content 243

Cited by 6