- Record: found
- Abstract: found
- Article: found
Promiscuous DNA synthesis by human DNA polymerase θ
research-article
Publication date (Electronic):
30 November 2011
Journal:
Nucleic Acids Research
Publisher:
Oxford University Press
Read this article at
There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.
Abstract
The biological role of human DNA polymerase θ (POLQ) is not yet clearly defined, but it has been proposed to participate in several cellular processes based on its translesion synthesis capabilities. POLQ is a low-fidelity polymerase capable of efficient bypass of blocking lesions such as abasic sites and thymine glycols as well as extension of mismatched primer termini. Here, we show that POLQ possesses a DNA polymerase activity that appears to be template independent and allows efficient extension of single-stranded DNA as well as duplex DNA with either protruding or multiply mismatched 3′-OH termini. We hypothesize that this DNA synthesis activity is related to the proposed role for POLQ in the repair or tolerance of double-strand breaks.
Related collections
Most cited references44
- Record: found
- Abstract: found
- Article: not found
DNA polymerases and cancer.
Sabine Lange, Kei-ichi Takata, Richard D. Wood (2011)
There are 15 different DNA polymerases encoded in mammalian genomes, which are specialized for replication, repair or the tolerance of DNA damage. New evidence is emerging for lesion-specific and tissue-specific functions of DNA polymerases. Many point mutations that occur in cancer cells arise from the error-generating activities of DNA polymerases. However, the ability of some of these enzymes to bypass DNA damage may actually defend against chromosome instability in cells, and at least one DNA polymerase, Pol ζ, is a suppressor of spontaneous tumorigenesis. Because DNA polymerases can help cancer cells tolerate DNA damage, some of these enzymes might be viable targets for therapeutic strategies.
- Record: found
- Abstract: found
- Article: not found
Activation and regulation of ATM kinase activity in response to DNA double-strand breaks.
Norman Lee, Tanya T. Paull (2007)
The ataxia-telangiectasia-mutated (ATM) protein kinase is rapidly and specifically activated in response to DNA double-strand breaks in eukaryotic cells. In this review, we summarize recent insights into the mechanism of ATM activation, focusing on the role of the Mre11/Rad50/Nbs1 (MRN) complex in this process. We also compare observations of the ATM activation process in different biological systems and highlight potential candidates for cellular factors that may participate in regulating ATM activity in human cells.
- Record: found
- Abstract: found
- Article: found
Dual Roles for DNA Polymerase Theta in Alternative End-Joining Repair of Double-Strand Breaks in Drosophila
Sze Chan, Amy Yu, Mitch McVey (2010)
Introduction DNA double-strand breaks (DSBs) and interstrand crosslinks pose serious threats to cell survival and genome stability. Because these lesions compromise both strands of the double helix, they impede DNA replication and transcription and therefore must be removed in a timely and coordinated manner. Interstrand crosslink repair has been shown to involve a DSB intermediate in some cases (reviewed in [1]). Therefore, there may be substantial mechanistic overlap in the processes used during repair of these two lesions. Error-free repair of DSBs can be accomplished through homologous recombination (HR) with an undamaged homologous template (reviewed in [2]). However, in contexts where suitable templates for HR do not exist, error-prone repair mechanisms are also used. For example, non-homologous end joining (NHEJ) frequently creates small insertions and deletions during DSB repair, particularly in cases where the broken ends cannot be readily ligated (reviewed in [3]). Analogously, the use of translesion DNA polymerases during interstrand crosslink repair can result in mutations, due to the reduced fidelity of these polymerases [4], [5]. Accumulating evidence suggests that NHEJ is composed of at least two genetically distinct mechanisms. Classical NHEJ (C-NHEJ) involves the sequential recruitment of two highly conserved core complexes (reviewed in [6]). First, the Ku70/80 heterodimer recognizes and binds to DNA ends in a sequence-independent manner, thereby protecting them from degradation. In many eukaryotes, Ku70/80 also recruits DNA-PKcs, forming a synaptic complex that can recruit additional processing enzymes such as the Artemis nuclease and the X family DNA polymerases mu and lambda. These proteins expand the spectrum of broken ends that can be rejoined. The second core complex, composed of DNA ligase 4, XRCC4, and XLF/Cernunnos, catalyzes ligation of the processed ends. Depending on the substrate, C-NHEJ can result in perfect repair of broken DNA, or it can result in small deletions of 1–10 nucleotides and/or insertions of 1–3 nucleotides [7]. Although C-NHEJ can repair blunt-ended substrates, a subset of C-NHEJ products appear to involve annealing at 1–4 nucleotide microhomologous sequences on either side of the break. Alternative end-joining (alt-EJ) is defined as end-joining repair that is observed in cells or organisms lacking one or more C-NHEJ components (reviewed in [8]). Alt-EJ in yeast is associated with deletions larger than those typically created by C-NHEJ, together with an increased tendency to repair by annealing at microhomologous sequences. Ku and ligase 4-independent end joining observed in mammalian cells also displays an increased tendency towards use of short microhomologies compared to C-NHEJ [9], [10]. Therefore, alt-EJ is sometimes called microhomology-mediated end joining (MMEJ) [11]. However, the relationship between MMEJ and alt-EJ is still unclear, and alt-EJ may comprise one or more C-NHEJ-independent repair mechanisms [8]. The importance of alt-EJ repair is highlighted by multiple studies that suggest it may promote chromosome instability and carcinogenesis. Alt-EJ produces chromosome translocations in mouse embryonic stem cells lacking Ku70 [12] and the use of alt-EJ during V(D)J recombination in C-NHEJ-deficient murine lymphocytes causes complex chromosome translocations and progenitor B cell lymphomas [13]. Furthermore, alt-EJ has been implicated in various translocations associated with chronic myeloid leukemia and human bladder cancer [14], [15]. Importantly, alt-EJ also operates during V(D)J rejoining in C-NHEJ-proficient B lymphocytes [16], suggesting that its role in DSB repair is not limited to situations where C-NHEJ is defective. However, alt-EJ is frequently masked by more dominant repair processes that are essential for vertebrate development, making it difficult to study. Therefore, its molecular mechanisms and the proteins involved remain largely unknown. Several lines of evidence demonstrate that Drosophila is an excellent model system in which to study alt-EJ in a metazoan. The Drosophila genome lacks several mammalian C-NHEJ components, including DNA-PKcs and Artemis. This may predispose flies towards non-C-NHEJ repair. Consistent with this, we have previously shown that a DSB caused by excision of a P element transposon in flies is readily repaired by a DNA ligase 4-independent end-joining process [17]. Interestingly, although Drosophila orthologs for the Pol X family DNA polymerases mu and lambda have not been identified [18], we and others have found evidence for polymerase activity in Drosophila end-joining repair [17], [19], [20]. Specifically, end joining in flies is often associated with the insertion of nucleotides at repair junctions, frequently involving imperfect repeats of 5–8 nucleotides. Full or partial templates for the insertions, occasionally possessing mismatches, can often be identified in adjacent sequences, suggesting the action of an error-prone polymerase. Similar templated nucleotides (T-nucleotides) have previously been identified at translocation breakpoints in human lymphomas [21]–[23]. Therefore, T-nucleotides could represent a signature of alt-EJ and may be informative regarding its molecular mechanisms. Additional insight into alt-EJ is provided by recent reports suggesting a mechanistic link between alt-EJ and interstrand crosslink repair. For example, a study of two Chinese hamster ovary cell lines sensitive to the crosslinking agent mitomycin C found that they were also deficient in alt-EJ [24]. Furthermore, certain interstrand crosslink-sensitive cell lines from Fanconi Anemia patients are also impaired in DNA-PKcs-independent rejoining of linearized plasmids [25]. Based on these reports, we hypothesized that additional mechanistic insight into both interstrand crosslink repair and alt-EJ could be gained by searching for mutants defective in both processes. To test this, we have screened Drosophila mutants that are sensitive to DNA crosslinking agents for additional defects in alt-EJ repair. In this work, we describe our studies with one such mutant, mus308. The mus308 (mutagen sensitive 308) mutant was originally identified by its extreme sensitivity to interstrand crosslinking agents but normal resistance to alkylating agents [26]. Subsequently, mus308 was found to code for DNA polymerase theta, which is most similar to A family DNA polymerases such as Escherichia coli Pol I [27]. Orthologs of polymerase theta (hereafter referred to as pol θ) are found in many metazoans, including Caenorhabditis elegans, Arabidopsis thaliana, and Homo sapiens, but not in unicellular eukaryotes, including the yeasts [28]–[30]. Several lines of evidence suggest that pol θ may play an important role in maintaining genome stability. Similar to flies, C. elegans with mutations in POLQ-1 are defective in repair of interstrand crosslinks [28]. Mice lacking pol θ (chaos1 mutants) have a high frequency of spontaneous and mitomycin C-induced micronuclei in erythrocytes, consistent with genomic instability [31]. In addition, vertebrate pol θ orthologs have been implicated in a wide range of repair processes, including base excision repair, bypass of abasic sites, and somatic hypermutation of immunoglobulin genes [32]–[36]. Finally, upregulation of pol θ is observed in a variety of human tumors and is associated with a poor clinical outcome, suggesting that its overexpression may contribute to cancer progression [37]. Pol θ is unusual in possessing an N-terminal helicase-like domain and a C-terminal polymerase domain. Although pol θ purified from human cell lines and Drosophila has error-prone polymerase activity and single-stranded DNA-dependent ATPase activity, helicase activity has not been demonstrated in vitro [30], [38], [39]. Therefore, it remains unclear exactly how the structure of pol θ relates to its multiple functions in DNA repair in different organisms. We report here that in addition to its role in DNA interstrand crosslink repair, Drosophila pol θ is involved in end-joining repair of DSBs. This alt-EJ mechanism operates independently of both Rad51-mediated HR and ligase 4-dependent C-NHEJ. Genetic analysis using separation-of-function alleles provides support for distinct roles of both the N- and C-terminal domains of pol θ in alt-EJ. Collectively, our data support a model in which helicase and polymerase activities of Drosophila pol θ cooperate to generate single-stranded microhomologous sequences that are utilized during end alignment in alt-EJ. Results Drosophila pol θ is important for both interstrand crosslink repair and end-joining repair of DNA double-strand breaks Drosophila mus308 mutants were initially identified based on their sensitivity to low doses of chemicals that induce DNA interstrand crosslinks [26]. To confirm this phenotype, we assembled a collection of previously identified mus308 mutant alleles [40], [41] and measured the ability of hemizygous mutant larvae to survive exposure to the crosslinking agent mechlorethamine (nitrogen mustard). Of the mutants that we tested, four were unable to survive exposure to 0.005% mechlorethamine: D2, D5, 2003, and 3294 (data not shown), consistent with their inability to repair interstrand crosslinks. To determine the molecular lesions responsible for mechlorethamine sensitivity, we sequenced the entire mus308 coding region of flies hemizygous for each mutant allele. Pol θ possesses both a conserved N-terminal helicase-like domain and a C-terminal pol I-like polymerase domain (Figure 1, Figure S1) [30]. Three of the four alleles contain unique sequence changes that are predicted to affect pol θ primary structure (Figure 1, Figure S2, and Figure S3). The 2003 allele is a nonsense mutation upstream of the polymerase domain, while the D5 allele is a missense mutation that alters a highly conserved proline in the conserved N-terminus. The 3294 allele changes an invariant glycine in the helicase domain to serine. Interestingly, this residue is conserved in the related mus301 helicase, but not in other DNA helicases (data not shown). No mutations were found in the coding sequence of the D2 allele. Because homozygous D2 flies have undetectable levels of pol θ protein [38], the D2 mutation may affect a regulatory region of mus308. 10.1371/journal.pgen.1001005.g001 Figure 1 Schematic of the mus308 gene. Exons are represented by boxes. The helicase-like domain (light gray shading) and polymerase domain (dark gray shading) are shown. Locations of the D5, 3294, and 2003 point mutations are indicated with arrows (numbers correspond to amino acid positions in the protein). Not shown is the D2 mutation, which results in severely reduced levels of pol θ. One explanation for the extreme sensitivity of mus308 mutants to mechlorethamine could be a defect in the repair of certain types of DSB intermediates that are created during crosslink repair. To test this, we exposed flies hemizygous for each mutant allele to increasing doses of ionizing radiation (IR). Although IR creates many different types of lesions, unrepaired DSBs are thought to be the main cause of cell death following irradiation. All four mus308 mutants survived IR exposures as high as 4000 rads (Figure 2A), although bristle and wing defects characteristic of apoptotic cell death were frequently observed at high doses. Drosophila lig4 mutants, which are completely defective in C-NHEJ, also survive IR doses in excess of 4000 rads [17]. However, spn-A mutants, which lack the Rad51 recombinase required for strand invasion during homologous recombination initiation [42], are highly sensitive to IR [17]. Thus, in Drosophila, HR is the dominant mechanism used to repair IR-induced DSBs. 10.1371/journal.pgen.1001005.g002 Figure 2 Drosophila pol θ is required for repair of IR–induced damage in the absence of Rad51. (A) mus308 mutants are not sensitive to ionizing radiation. Female flies heterozygous for the indicated mus308 alleles were mated to Df(3R)Sz29/TM3 males and third instar larval progeny were irradiated with increasing doses of IR. The percent survival of mus308 hemizygous mutants was calculated relative to an unirradiated control. Each dose was repeated twice; the average of the two experiments is shown. (B) spn-A mus308 double mutants are extremely sensitive to ionizing radiation. Heterozygous spn-A057mus308D5 females were mated to heterozygous spn-A093mus308D5 males and third instar larval progeny were irradiated with increasing doses of IR. The percent survival of spn-A mus308 compound heterozygotes was calculated relative to an unirradiated control. Each dose was repeated at least twice. Error bars represent standard deviations. To test whether pol θ acts to repair IR damage in the absence of HR, we created mus308 spn-A double mutants and exposed them to doses of 125–1000 rads. Strikingly, doses as low as 125 rads resulted in almost complete killing of mus308 spn-A mutants (Figure 2B). In contrast, lig4 spn-A double mutants are only slightly more sensitive than spn-A single mutants to IR [17]. Thus, in the absence of HR, pol θ participates in a process crucial for repair of damage caused by ionizing radiation. Because interstrand crosslink repair and alternative end joining have been shown to have partially overlapping genetic requirements in mammals [24], [25], we hypothesized that the extreme sensitivity of mus308 spn-A mutants to IR might relate to a role of pol θ in an alternative end-joining mechanism. To explore this hypothesis, we tested each mus308 mutant allele using a site-specific double-strand break repair assay that can distinguish between synthesis-dependent strand annealing (SDSA, a specific type of HR) and end joining (EJ) (Figure 3A) [43]. We have previously shown that the majority of end joining observed in this assay occurs independently of DNA ligase 4, and is therefore a form of alt-EJ [17]. In this system, excision of a P element (P{wa}) located on the X chromosome is catalyzed by P transposase, resulting in a 14-kilobase gap relative to an undamaged sister chromatid. The DNA ends remaining after excision each have 17-nucleotide non-complementary 3′ single-stranded overhangs [44]. These ends are highly recombinogenic and repair by SDSA is initially favored. However, because repair synthesis in this system is not highly processive, most repair products that are recovered from wild-type flies result from incomplete repair synthesis from one or both sides of the break, followed by end joining of the nascent DNA (SDSA+EJ events) [45]. To quantitate the percentage of repair events that derive from each mechanism, repair events are recovered from male pre-meiotic germline cells by mating individual males to females homozygous for the P{wa} element. Each of the resulting female progeny represents a single repair event that can be classified by eye color. Red eyed-females inherit a repair event involving homology-dependent synthesis that generated complementary single-stranded regions that subsequently anneal (repair by SDSA). Yellow-eyed females inherit a chromosome that was repaired by EJ or SDSA+EJ mechanisms (these repair events are hereafter referred to as (SDSA)+EJ; for further details, see Materials and Methods). 10.1371/journal.pgen.1001005.g003 Figure 3 Pol θ is involved in end-joining repair. (A) A P element excision assay monitors DSB repair outcomes. The P{wa} transposon is inserted in a 5.2 kb intron of the essential scalloped (sd) gene. A copia retrotransposon flanked by long terminal repeats (LTR) is inserted into an exon of the white gene, causing reduced expression of white. Excision of P{wa} results in a 14-kilobase gap relative to an intact sister chromatid. Following excision, repair events from the male pre-meiotic germline are recovered in female progeny and the method of repair is inferred from their eye color. SDSA = synthesis-dependent strand annealing, SDSA+EJ = SDSA+end joining, EJ = end joining. Accompanying deletion into sd exons (EJ with deletion) results in a scalloped-wing phenotype and/or male lethality. (B) Pol θ mutants are defective specifically in end-joining repair of DSBs. Each bar represents the mean percentage of repair events recovered from independent males possessing the indicated mus308 allele in trans to Df(3R)Sz29. (SDSA)+EJ = repair involving HR initiation followed by end joining or repair involving only end joining. Number of independent males assayed: wild type = 101, D2 = 155, D5 = 161, 2003 = 155, 3294 = 100. Error bars represent SEM. (*** indicates p 0.5 for all comparisons between different mus308 alleles. (C) Synthesis during HR is not impaired in pol θ mutants. Each bar represents the percentage of repair events recovered from yellow-eyed females that showed evidence for repair synthesis of at least the indicated length. Number of independent repair events: wild type = 32, D2 = 28, D5 = 53. (D) Pol θ mutants have an increased frequency of DSB repair events with flanking deletions. For all genotypes, small deletions 4 bp microhomologies are available near the DSB in this system. * indicates P = 0.03, ** indicates P 700 base pairs, data not shown). Our subsequent analysis focused on the characterization of repair events involving smaller deletions. Twenty-three percent of I-SceI repair junctions isolated from wild-type flies possessed insertions of more than 3 base pairs (Figure 6B). This percentage was significantly increased to 46% in lig4 mutants (P<0.01, Fisher's exact test), consistent with increased use of alt-EJ in the absence of C-NHEJ. If pol θ plays a general role in insertional mutagenesis during alt-EJ repair, one would predict that the frequency and length of insertions following I-SceI cutting should decrease in mus308 mutants. Indeed, the percentage of large insertions decreased to 9% in mus308 mutants (P = 0.03, Fisher's exact test). Wild-type flies had an average insertion length of 7.6 base pairs, compared to 4.2 base pairs for mus308 mutants. Strikingly, no mus308 insertion was longer than twelve base pairs, while insertions of more than twenty base pairs occurred in both wild type and lig4 mutants. Because microhomologies of greater than four base pairs are not present near the I-SceI cut site in this construct, repair involving annealing at long microhomologies was not observed. Surprisingly, the total percentage of repair junctions with short, 1–3 base pair insertions was not decreased in lig4 mutants relative to wild type (17% vs. 13%, respectively). Furthermore, the percentage of junctions involving annealing at 1–3 nucleotide microhomologies was also similar between the two genotypes (25% for lig4 mutants vs. 34% for wild type). These two types of junctions have historically been associated with ligase 4-dependent C-NHEJ repair. Our results suggest that this may not be the case. Indeed, a fine-level sequence analysis of I-SceI repair junctions that we have recently conducted suggests that alt-EJ may produce C-NHEJ-like junctions in certain sequence contexts [53]. Nevertheless, our data obtained using two independent site-specific DSB repair assays strongly suggest that C-NHEJ and alt-EJ represent at least partially independent mechanisms for the repair of DSBs and that pol θ plays an important role in the generation of T-nucleotide insertions during alt-EJ repair of both P element and I-SceI-induced breaks. Discussion Several studies have identified proteins important for end-joining repair of DSBs in the absence of C-NHEJ factors in yeasts [11], [54], [55]. More recently, the Mre11 protein has been identified as an important alt-EJ component in vertebrate systems [10], [56]–[59]. However, much remains uncertain about the genetics or mechanisms of alt-EJ in metazoans. Our previous work demonstrated that end-joining repair of P element-induced breaks can occur independently of DNA ligase 4, suggesting the presence of a highly active alternative end-joining mechanism in Drosophila [17]. We have now identified the mus308 gene, encoding DNA polymerase theta, as a critical component of alt-EJ. Pol θ-dependent alt-EJ operates in parallel to C-NHEJ to promote repair of both P element and I-SceI-induced breaks. Because we observed similar alt-EJ defects with four different mus308 mutant alleles, several of which were studied in trans to at least two independently-derived deficiencies, we consider it highly unlikely that the phenotypes we observed are due to second-site mutations or other differences in genetic background. Importantly, pol θ does not appear to participate in homology-directed repair. HR repair of DSBs following P{wa} excision is thought to proceed largely through synthesis-dependent strand annealing (SDSA) [60]. We observed that SDSA frequencies in the P{wa} assay were similar in wild type and mus308 mutants. Although we did not formally test for a role of pol θ in single-strand annealing (SSA), a non-conservative HR pathway that involves annealing at direct repeats larger than 25 nucleotides, a separate study demonstrated that pol θ has no effect on SSA repair [47]. In addition, comparison of the DNA sequences located 3 kilobases to either side of P{wa} by BLAST does not reveal any significant similarities of more than 20 nucleotides. Therefore, it seems unlikely that the repair observed in mus308 mutants arose through an SSA mechanism. Three findings suggest that mus308-dependent alt-EJ is an important repair option for both cell and organism survival in flies, particularly in the absence of homologous recombination. First, spn-A mus308 double mutants are sub-viable and have severe defects in adult abdominal cuticle closure, consistent with a high level of apoptosis in rapidly proliferating histoblasts during pupariation. Second, spn-A mus308 double mutant males undergoing P{wa} excision have up to 30-fold increased sterility relative to spn-A mutants. Third, mus308 mutant males undergoing I-SceI cutting show premature sterility and produce few progeny. The few germline repair events that are recovered from each male are frequently clonal, suggesting extensive germline apoptosis (A. Yu, unpublished data). Evidence for two functions of pol θ in alternative end joining Pol θ orthologs characterized from a variety of metazoans possess both helicase-like and DNA polymerase domains [27]–[31], [35]. Pol θ purified from both Drosophila and human cells has a Pol I-like polymerase activity and single-stranded DNA-dependent ATPase activity [30], [38]. However, DNA helicase activity of the purified protein remains to be demonstrated. Although our experiments did not formally test for helicase activity of pol θ, our results are consistent with pol θ having a DNA unwinding or strand displacement function. Flies with the D5 and 3294 mutations (located in or near the conserved helicase domain) produce repair products with complex T-nucleotide insertions but not products involving annealing at long microhomologies. The D5 and 3294 alleles may therefore encode proteins that retain polymerase activity but lack unwinding activity, resulting in an inability to expose internal microhomologous sequences. Because the microhomologies used in repair following P element excision are often located in the 17-nucleotide 3′ single-stranded tails, pol θ may also be important for the unwinding of secondary structures that form in single-stranded DNA. Alternatively, the DNA-dependent ATPase activity demonstrated by pol θ might represent an annealing function of the protein that is required during alt-EJ. Such an annealing activity was recently described for the human HARP protein, which is able to displace stably bound replication protein A and rewind single-stranded DNA bubbles [61]. One notable aspect of alt-EJ in Drosophila is the large percentage of repair junctions with templated insertions. These insertions may be “synthesis footprints” that are formed during the cell's attempt to create microhomologous sequences that can be used during the annealing stage of alt-EJ when suitable endogenous microhomologies are not present or are not long enough to allow for stable end alignment. Indeed, analysis of the insertions from I-SceI repair junctions suggests a model involving local unwinding of double-stranded DNA and iterative synthesis of 3–8 nucleotide runs [53]. The P{wa} repair junctions isolated from mus308D2/mus3082003 mutants are consistent with an important (but not exclusive) role for the polymerase domain of pol θ in the synthesis of T-nucleotides. We speculate that pol θ may be involved in both DNA unwinding and repair synthesis during alt-EJ (Figure 7). Linking these two activities in one protein would provide a convenient mechanism for creating longer microhomologies that could increase the thermodynamic stability of aligned ends prior to the action of a DNA ligase. Studies based on the crystal structure of a dual function NHEJ polymerase-ligase protein found in Mycobacterium tuberculosis suggest that a synaptic function for an NHEJ polymerase is plausible [62]. Because ligase 4 is not involved in alt-EJ in Drosophila, another ligase must be involved in the ligation step. Studies from mammalian systems have identified DNA ligase 3 as a likely candidate [63], [64]. 10.1371/journal.pgen.1001005.g007 Figure 7 Model for pol θ function in alt–EJ. Pol θ is drawn as a bipartite protein, with a helicase domain and a polymerase domain separated by a flexible linker region. (A) Initially, the helicase activity of pol θ unwinds short stretches of double-stranded DNA to expose pre-existing microhomologous sequences. (B) These microhomologies (MH) are used to align the broken ends to provide a template for pol θ polymerase activity. The unwinding activity could also serve to make the polymerase more processive. (C) Processing of the ends and ligation results in repair accompanied by a deletion. (D) In cases where the ends do not remain stably aligned, annealing at other microhomologies closer to the break site could result in the insertion of T-nucleotides. Multiple rounds of unwinding, synthesis, and alignment could result in the complex insertions that are often observed in alt-EJ in flies. Potential roles of pol θ in DNA interstrand crosslink repair Pol θ was originally identified in Drosophila based on the inability of mus308 mutants to survive exposure to chemicals that induce DNA interstrand crosslinks. A crucial question posed by our findings is whether pol θ performs a common function during the repair of both DSBs and interstrand crosslinks. The C. elegans pol θ ortholog, POLQ-1, is also required for resistance to interstrand crosslinks and acts in a pathway that is distinct from HR but depends on CeBRCA1 [28]. In S. cerevisiae, several repair mechanisms are utilized during interstrand crosslink repair, including nucleotide excision repair (NER), HR, and translesion synthesis [65], [66]. Given our results and the findings from C. elegans, it seems unlikely that the role of pol θ in interstrand crosslink repair involves a function in HR. In human cells, exposure to agents that induce interstrand crosslinks causes a shift in repair mechanisms that leads to increased use of non-conservative pathways associated with complex insertions and deletions [67]. Furthermore, interstrand crosslinks can cause frequent recombination between direct repeats [68], [69], suggesting that single-strand annealing may provide a viable mechanism for interstrand crosslink repair. The single-strand annealing model of interstrand crosslink repair posits that NER-independent recognition and processing of the crosslinked DNA is followed by generation of single-stranded regions flanking the crosslink and annealing at repeated sequences. Because alt-EJ frequently proceeds through annealing at short direct repeats, it is tempting to speculate that the role of pol θ in interstrand crosslink repair might be to expose and/or promote the annealing of microhomologous single-stranded regions that flank the crosslinked DNA. Consistent with this model, the initial incision step made after recognition of the interstrand crosslink remains normal in mus308 mutants [26]. Alternatively, pol θ might utilize its polymerase activity and nearby flanking sequences as a template to synthesize short stretches of DNA that could be used to span a single-stranded gap opposite of a partially excised crosslink. Such a model has been proposed to explain the formation of microindels in human cancers [70]. We are currently testing these two models using helicase- and polymerase-specific mus308 mutant alleles. Pol θ and alternative end joining: promoting genome (in)stability Although it seems counterintuitive, alt-EJ likely functions in some situations to promote genome stability. As evidence of this, we found that DSB repair following P element excision in mus308 mutant flies frequently results in genomic deletions of multiple kilobases. A similar deletion-prone phenotype was previously observed in mus309 mutants, which lack the Drosophila BLM ortholog [43], [71]. Epistasis analysis demonstrated that the mus309 deletion phenotype depends on Rad51, implying that DmBlm acts after strand invasion during HR and that the deletions observed in mus309 mutants are likely a result of failed SDSA [48]. In contrast, the deletions observed in mus308 mutants do not depend on Rad51, demonstrating that the function of pol θ in DSB repair is independent of HR. The deletion phenotype is exacerbated in lig4 mus308 double mutants, suggesting that C-NHEJ and alt-EJ represent two parallel mechanisms to prevent deletions. In the absence of these two end-joining options, resection at the broken ends may continue unchecked, resulting in extensive genomic deletions that are generated by an unknown Rad51-independent repair mechanism. Therefore, both C-NHEJ and alt-EJ function to prevent overprocessing of broken DNA ends and extreme degradation of the genome. Microhomology-mediated end joining, which shares many features with alt-EJ, has been proposed to perform a similar function in urothelial cells [72]. Nonetheless, alternative end-joining repair can also be genome destabilizing, as demonstrated by an increasing number of reports linking it to cancer. We have shown that complex insertions observed in alternative end-joining products are more frequent in flies possessing pol θ. These insertions, which are often combinations of nucleotides derived from several templates inserted in both direct and reverse-complement orientations, are remarkably similar to T-nucleotide insertions found in translocation breakpoints reconstructed from follicular and mantle cell lymphomas (reviewed in [73]). Therefore, if pol θ also functions in alternative end joining and T-nucleotide generation in mammals, it might be an important factor involved in translocation formation. A recent study suggests that pol θ levels are tightly regulated in humans and that loss of this regulation may promote cancer progression [37]. The protein is primarily found in lymphoid tissues but is upregulated in lung, stomach, and colon cancers. Furthermore, high levels of pol θ expression correlate with poorer clinical outcomes. Intriguingly, pol θ is regulated by endogenous siRNAs in Drosophila [74], [75], although the significance of this regulation is currently unclear. We suggest that polθ-mediated alt-EJ serves as a medium-fidelity repair option used by cells when precise repair cannot be carried out for any number of reasons. As such, it prevents extreme loss of genetic information. However, its error-prone nature requires tight regulation, which, when lost, may lead to excessive inaccurate repair and ultimately, carcinogenesis. Conclusions The results described here establish that Drosophila pol θ plays two distinct roles in an alternative end-joining mechanism operating in parallel to canonical DNA ligase 4-mediated C-NHEJ. This novel finding lays the groundwork for future studies focusing on the specific roles of the pol θ helicase-like and polymerase domains in alt-EJ and DNA interstrand crosslink repair. Whether pol θ plays a similar role in alt-EJ in other organisms, including mammals, remains to be determined. Regardless, these studies reveal an unexpected role for DNA polymerase θ that is required for genomic integrity in Drosophila and possibly other metazoans. Materials and Methods Drosophila stocks and mus308 alleles All flies were maintained on standard cornmeal-based agar food and reared at 25°C. The mus308 D2 and D5 stocks were obtained from the Bloomington Stock Center and the 2003 and 3294 stocks were from the Zuker collection [76]. To identify mutations in these stocks, genomic DNA was isolated from flies harboring each allele in trans to Df(3R)Exel6166 and PCR was performed with primers specific to overlapping regions of the entire coding sequence. PCR products were sequenced and the sequence was compared to the Drosophila reference sequence release 5.10. Sequence changes unique to each allele were verified by sequencing in both orientations. The lig4169a [17], spn-A093 and spn-A057 [42] stocks harbor null alleles of DNA ligase 4 and Rad51, respectively. Mutagen sensitivity studies For mechlorethamine sensitivity assays, balanced, heterozygous parents were crossed to Df(3R)Exel6166 and allowed to lay eggs in vials containing 10mL of food for three days, after which they were moved to new vials for two additional days. The first vials were treated with 250µL of 0.005% mechlorethamine dissolved in ddH2O, while the second vials were treated only with ddH2O. Survival was calculated as the number of homozygous mutant adults divided by the total number of adults that eclosed within 10 days of treatment. Ratios were normalized to untreated controls for each set of vials (five to eight sets of vials were counted for each experiment). For ionizing radiation sensitivity assays, heterozygous parents laid eggs on grape-juice agar plates for 12 hr. Embryos developed at 25°C until larvae reached third-instar stage, at which point they were irradiated in a Gammator 1000 irradiator at a dose rate of 800 rads/min and larvae were transferred to food-containing bottles. Relative survival rates were calculated as above. P{wa} assay Repair of DNA double-strand breaks was monitored after excision of the P{wa} transposon as described previously [43], [77]. P{wa} was excised in males using a second chromosome transposase source (CyO, H{w+,Δ2–3}) and individual repair events were recovered in female progeny over an intact copy of P{wa}. Females with two copies of P{wa} have apricot eyes [78]. Progeny with red eyes possess a repair event involving HR with annealing of the copia LTRs. A fraction of apricot-eyed females also possess HR repair events, but these cannot be distinguished from chromosomes in which no excision event occurred (using the CyO, H{w+,Δ2–3} transposase source, ∼80% of apricot-eyed female progeny inherit a non-excised P{wa} element). Yellow-eyed females harbor a repair event in which repair is completed by end joining. For each genotype, at least 50 individual male crosses were scored for eye color of female progeny lacking transposase. The percentage of progeny from each repair class was calculated on a per vial basis, with each vial representing a separate experiment. Statistical comparisons were done with a Kruskal-Wallis non-parametric ANOVA followed by Dunn's multiple comparisons test using InStat3 (GraphPad). For analysis of HR synthesis tract lengths, genomic DNA was purified and PCR reactions were performed as in [43], using primer pairs with the internal primer located 250, 2420, and 4674 base pairs from the cut site at the 5′ end of P{wa}. For deletion analysis, the percentage of females with scalloped wings was calculated relative to all yellow-eyed females counted. The percentage of male lethal and small (0.1–3.6 kb) deletions was calculated based on a subset of yellow-eyed females (one from each original male parent) that were individually crossed to males bearing the FM7w balancer. Vials for which no white-eyed male progeny were recovered were scored as male lethal. Some of the male lethal events also caused a scalloped-wing phenotype in heterozygous females. For those that did not, testing to ensure that the male lethality was due to deletion of scalloped coding sequence was performed by recovering the repaired chromosomes in trans to the hypomorphic sd1 mutation [79] and scoring for a scalloped-wing phenotype. Repair events which could be recovered in males were subjected to PCR analysis, using primers internal to P{wa} [43], to detect small deletions into one or both introns of sd. I-SceI break repair assay Repair of I-SceI mediated DNA double strand breaks was studied in the context of the chromosomally integrated [Iw]7 construct [52], which contains a single target site for the I-SceI endonuclease. DSBs were induced in the male pre-meiotic germline by crossing females harboring [Iw]7 to males expressing the I-SceI endonuclease from a second chromosomal location under the control of either the hsp70 promoter (70[I-SceI]1A) [52] or the ubiquitin promoter (UIE[I-SceI]2R) [50]. Independent inaccurate end-joining repair events from the male pre-meiotic germline were recovered in male progeny and DNA was isolated for analysis [80]. PCR was performed using primers PE5′ (GATAGCCGAAGCTTACCGAAGT) and jn3′b (GGACATTGACGCTATCGACCTA) to amplify a 1.3 kb fragment of the [Iw]7 construct including the I-SceI target site. Products were gel purified (GenScript) and sequencing of PCR products was performed using the PE5′ primer. Sequences were aligned using ClustalW or by manual inspection against sequence obtained from an uncut [Iw]7 construct. Statistical comparisons were done using Excel and SPSS. Supporting Information Figure S1 Polymerase theta orthologues from various metazoans. The conserved helicase-like (blue oval) and polymerase (pink box) domains are indicated. All of the orthologs have additional conserved regions in the N and C-termini (white boxes), separated by a variable-length linker region. (0.51 MB PPT) Click here for additional data file. Figure S2 Sequence changes in different mus308 mutant alleles, compared to the Drosophila reference genome sequence. Allele-specific changes are highlighted in yellow. 1 +1 corresponds to the ‘A’ in the start codon of mus308. (0.11 MB PPT) Click here for additional data file. Figure S3 Alignment of conserved N-terminus of mus308 orthologs. Dmel, Drosophila melanogaster; Agam, Anopheles gambia; Mmus, Mus musculus; Hsap, Homo sapiens; Drer, Danio rerio; Atha, Arabidopsis thaliana; Cele, Caenorhabditis elegans. Conserved amino acids are indicated below each alignment. The red arrow corresponds to the G621S substitution in the 3294 allele, the blue arrow corresponds to the P781L substitution in the D5 allele. (0.19 MB PPT) Click here for additional data file.
Author and article information
Journal
Journal ID (nlm-ta): Nucleic Acids Res
Journal ID (iso-abbrev): Nucleic Acids Res
Journal ID (publisher-id): nar
Journal ID (hwp): nar
Title:
Nucleic Acids Research
Publisher:
Oxford University Press
ISSN
(Print):
0305-1048
ISSN
(Electronic):
1362-4962
Publication date Collection:
March
2012
Publication date
(Print):
March
2012
Publication date
(Electronic):
30
November
2011
Publication date PMC-release: 30
November
2011
Volume: 40
Issue: 6
Pages: 2611-2622
Affiliations
Author notes
*To whom correspondence should be addressed. Tel: + 46 90 7866638; Fax: +46 90 7869795;
Email:
erik.johansson@
123456medchem.umu.se
Article
Publisher ID: gkr1102DOI: 10.1093/nar/gkr1102
PMC ID: 3315306
PubMed ID: 22135286
SO-VID: d313c526-bf6c-456b-9217-fc6f0efeed0c
Copyright © © The Author(s) 2011. Published by Oxford University Press.
License:
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( http://creativecommons.org/licenses/by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
History
Date
received
: 21
July
2011
Date
revision received
: 3
November
2011
Date
accepted
: 4
November
2011
Page count
Pages: 12
Categories
Subject:
Nucleic Acid Enzymes
ScienceOpen disciplines: Genetics
Data availability:
ScienceOpen disciplines: Genetics