4
views
0
recommends
+1 Recommend
0 collections
    0
    shares
      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome : A case report and review of Chinese cases

      , BS a , b , , MD, PhD a , b , , MS c , , MD, PhD a , , MS d , , MD, PhD d , , , MD, PhD a , b ,

      Medicine

      Wolters Kluwer Health

      KCNH2 gene, long QT syndrome, LQT2, mutation, next-generation sequencing

      Read this article at

      Bookmark
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          Introduction:

          Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2.

          Patient concerns:

          A Chinese Han family with LQTS phenotypes was examined.

          Diagnosis:

          A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made.

          Interventions:

          Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day.

          Outcomes:

          This novel heterozygous mutation results in a frameshift mutation after the 128 th residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156).

          Conclusion:

          This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.

          Related collections

          Most cited references 29

          • Record: found
          • Abstract: found
          • Article: not found

          Spectrum and prevalence of mutations from the first 2,500 consecutive unrelated patients referred for the FAMILION long QT syndrome genetic test.

          Long QT syndrome (LQTS) is a potentially lethal, highly treatable cardiac channelopathy for which genetic testing has matured from discovery to translation and now clinical implementation. Here we examine the spectrum and prevalence of mutations found in the first 2,500 unrelated cases referred for the FAMILION LQTS clinical genetic test. Retrospective analysis of the first 2,500 cases (1,515 female patients, average age at testing 23 +/- 17 years, range 0 to 90 years) scanned for mutations in 5 of the LQTS-susceptibility genes: KCNQ1 (LQT1), KCNH2 (LQT2), SCN5A (LQT3), KCNE1 (LQT5), and KCNE2 (LQT6). Overall, 903 referral cases (36%) hosted a possible LQTS-causing mutation that was absent in >2,600 reference alleles; 821 (91%) of the mutation-positive cases had single genotypes, whereas the remaining 82 patients (9%) had >1 mutation in > or =1 gene, including 52 cases that were compound heterozygous with mutations in >1 gene. Of the 562 distinct mutations, 394 (70%) were missense, 428 (76%) were seen once, and 336 (60%) are novel, including 92 of 199 in KCNQ1, 159 of 226 in KCNH2, and 70 of 110 in SCN5A. This cohort increases the publicly available compendium of putative LQTS-associated mutations by >50%, and approximately one-third of the most recently detected mutations continue to be novel. Although control population data suggest that the great majority of these mutations are pathogenic, expert interpretation of genetic test results will remain critical for effective clinical use of LQTS genetic test results.
            Bookmark
            • Record: found
            • Abstract: found
            • Article: not found

            Crystal structure and functional analysis of the HERG potassium channel N terminus: a eukaryotic PAS domain.

            The HERG voltage-dependent K+ channel plays a role in cardiac electrical excitability, and when defective, it underlies one form of the long QT syndrome. We have determined the crystal structure of the HERG K+ channel N-terminal domain and studied its role as a modifier of gating using electrophysiological methods. The domain is similar in structure to a bacterial light sensor photoactive yellow protein and provides the first three-dimensional model of a eukaryotic PAS domain. Scanning mutagenesis of the domain surface has allowed the identification of a hydrophobic "hot spot" forming a putative interface with the body of the K+ channel to which it tightly binds. The presence of the domain attached to the channel slows the rate of deactivation. Given the roles of PAS domains in biology, we propose that the HERG N-terminal domain has a regulatory function.
              Bookmark
              • Record: found
              • Abstract: found
              • Article: not found

              Increased risk of arrhythmic events in long-QT syndrome with mutations in the pore region of the human ether-a-go-go-related gene potassium channel.

              The hereditary long-QT syndrome is characterized by prolonged ventricular repolarization and a variable clinical course with arrhythmia-related syncope and sudden death. Mutations involving the human ether-a-go-go-related gene (HERG) channel are responsible for the LQT2 form of long-QT syndrome, and in cellular expression studies these mutations are associated with reduction in the rapid component of the delayed rectifier repolarizing current (I(Kr)). We investigated the clinical features and prognostic implications of mutations involving pore and nonpore regions of the HERG channel in the LQT2 form of this disorder. A total of 44 different HERG mutations were identified in 201 subjects, with 14 mutations located in the pore region (amino acid residues 550 through 650). Thirty-five subjects had mutations in the pore region and 166 in nonpore regions. Follow-up extended through age 40 years. Subjects with pore mutations had more severe clinical manifestations of the genetic disorder and experienced a higher frequency (74% versus 35%; P<0.001) of arrhythmia-related cardiac events occurring at earlier age than did subjects with nonpore mutations. Multivariate Cox proportional hazard regression analysis revealed that pore mutations dominated the risk, with hazard ratios in the range of 11 (P<0.0001) for QTc at 500 ms, with a 16% increase in the pore hazard ratio for each 10-ms increase in QTc. Patients with mutations in the pore region of the HERG gene are at markedly increased risk for arrhythmia-related cardiac events compared with patients with nonpore mutations.
                Bookmark

                Author and article information

                Journal
                Medicine (Baltimore)
                Medicine (Baltimore)
                MEDI
                Medicine
                Wolters Kluwer Health
                0025-7974
                1536-5964
                April 2020
                17 April 2020
                : 99
                : 16
                Affiliations
                [a ]Institute of Translational Medicine, Jinan Central Hospital Affiliated to Shandong University
                [b ]Department of Postgraduate, Shandong First Medical University, Jinan, Shandong
                [c ]Department of Biomedical Sciences, City University of Hong Kong, Hong Kong SAR, China
                [d ]Department of Cardiology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong, China.
                Author notes
                []Correspondence: Guohai Su, Institute of Translational Medicine, Jinan Central Hospital Affiliated to Shandong University, No. 105 Jiefang Road, Jinan, Shandong, 250013, China (e-mail: gttstg@ 123456163.com ); Wei Zhang, Department of Cardiology, Jinan Central Hospital Affiliated to Shandong University, No. 105 Jiefang Road, Jinan, Shandong, 250013, China (e-mail: wei.229@ 123456163.com ).
                Article
                MD-D-19-06958 19749
                10.1097/MD.0000000000019749
                7220270
                32311972
                Copyright © 2020 the Author(s). Published by Wolters Kluwer Health, Inc.

                This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0

                Product
                Categories
                3400
                Research Article
                Clinical Case Report
                Custom metadata
                TRUE

                Comments

                Comment on this article