Trans ‐3,5,4´‐trimethoxystilbene reduced gefitinib resistance in  NSCLC s via suppressing  MAPK /Akt/Bcl‐2 pathway by upregulation of miR‐345 and miR‐498

There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

Abstract

Despite initial dramatic efficacy of epidermal growth factor receptor ( EGFR) tyrosine kinase inhibitors ( EGFR‐ TKIs) in EGFR‐mutant lung cancer patients, subsequent emergence of acquired resistance is almost inevitable. Resveratrol and its derivatives have been found to exert some effects on EGFR‐ TKI resistance in non‐small cell lung cancer ( NSCLC), but the underlying mechanisms remain unclear. We screened several NSCLC cell lines with gefitinib resistance by MTT assay and analysed the miR‐345/miR‐498 expression levels. NSCLC cells were pre‐treated with a resveratrol derivative, trans‐3,5,4‐trimethoxystilbene ( TMS) and subsequently challenged with gefitinib treatment. The changes in apoptosis and miR‐345/miR‐498 expression were analysed by flow cytometry and q‐ PCR respectively. The functions of miR‐345/miR‐498 were verified by CCK‐8 assay, cell cycle analysis, dual‐luciferase reporter gene assay and immunoblotting analysis. Our results showed that the expression of miR‐345 and miR‐498 significantly decreased in gefitinib resistant NSCLC cells. TMS pre‐treatment significantly upregulated the expression of miR‐345 and miR‐498 increasing the sensitivity of NSCLC cells to gefitinib and inducing apoptosis. MiR‐345 and miR‐498 were verified to inhibit proliferation by cell cycle arrest and regulate the MAPK/c‐Fos and AKT/Bcl‐2 signalling pathways by directly targeting MAPK1 and PIK3R1 respectively. The combination of TMS and gefitinib promoted apoptosis also by miR‐345 and miR‐498 targeting the MAPK/c‐Fos and AKT/Bcl‐2 signalling pathways. Our study demonstrated that TMS reduced gefitinib resistance in NSCLCs via suppression of the MAPK/Akt/Bcl‐2 pathway by upregulation of miR‐345/498. These findings would lay the theoretical basis for the future study of TMS for the treatment of EGFR‐ TKI resistance in NSCLCs.

Related collections

Most cited references 27

Record: found
Abstract: found
Article: not found

Acquired Resistance of Lung Adenocarcinomas to Gefitinib or Erlotinib Is Associated with a Second Mutation in the EGFR Kinase Domain

William Pao, Vincent A. Miller, Katerina Politi … (2005)

Introduction Somatic gain-of-function mutations in exons encoding the epidermal growth factor receptor (EGFR) tyrosine kinase domain are found in about 10% of non-small cell lung cancers (NSCLCs) from the United States [1,2,3], with higher percentages observed in east Asia [2,4,5,6]. Some 90% of NSCLC-associated mutations occur as either multi-nucleotide in-frame deletions in exon 19, involving elimination of four amino acids, Leu-Arg-Glu-Ala, or as a single nucleotide substitution at nucleotide 2573 (T→G) in exon 21, resulting in substitution of arginine for leucine at position 858 (L858R). Both of these mutations are associated with sensitivity to the small-molecule kinase inhibitors gefitinib or erlotinib [1,2,3]. Unfortunately, nearly all patients who experience marked improvement on these drugs eventually develop progression of disease. While KRAS mutations have been associated with some cases of primary resistance to gefitinib or erlotinib [7], mechanisms underlying “acquired” or “secondary” resistance are unknown. Acquired resistance to kinase-targeted anticancer therapy has been most extensively studied with imatinib, an inhibitor of the aberrant BCR-ABL kinase, in chronic myelogenous leukemia (CML). Mutations in the ABL kinase domain are found in 50%–90% of patients with secondary resistance to the drug (reviewed in [8]). Such mutations, which cluster in four distinct regions of the ABL kinase domain (the ATP binding loop, T315, M351, and the activation loop), interfere with binding of imatinib to ABL [9,10,11]. Crystallographic studies of various ABL mutants predict that most should remain sensitive to inhibitors that bind ABL with less stringent structural requirements. Using this insight, new small-molecule inhibitors have been identified that retain activity against the majority of imatinib-resistant BCR-ABL mutants [12,13]. Although imatinib inhibits different kinases in various diseases (BCR-ABL in CML, KIT or PDGFR-alpha in gastrointestinal stromal tumors [GISTs], and PDGFR-alpha in hypereosinophilic syndrome [HES]) (reviewed in [14]), some tumors that become refractory to treatment with imatinib appear to have analogous secondary mutations in the kinase-coding domain of the genes encoding these three enzymes. For example, in CML, a commonly found mutation is a C→T single nucleotide change that replaces threonine with isoleucine at position 315 (T315I) in the ABL kinase domain [9,10,11]. In GIST and HES, respectively, the analogous T670I mutation in KIT and T674I mutation in PDGFR-alpha have been associated with acquired resistance to this drug [15,16]. To determine whether lung cancers that acquire clinical resistance to either gefitinib or erlotinib display additional mutations in the EGFR kinase domain, we have examined the status of EGFR exons 18 to 24 in tumors from five patients who initially responded but subsequently progressed while on these drugs. These exons were also assessed in tumor cells from a sixth patient whose disease rapidly recurred while on gefitinib therapy after complete gross tumor resection. Because of the association of KRAS mutations with primary resistance to gefitinib and erlotinib [7], we also examined the status of KRAS in tumor cells from these six patients. In an effort to explain the selective advantage of cells with a newly identified “resistance” mutation in EGFR—a T790M amino acid substitution—we further characterized the drug sensitivity of putatively resistant EGFR mutants versus wild-type or drug-sensitive EGFR mutants, using both a NSCLC cell line fortuitously found to contain the T790M mutation and lysates from cells transiently transfected with wild-type and mutant EGFR cDNAs. Methods Tissue Procurement Tumor specimens, including paraffin blocks, fine needle biopsies, and pleural effusions, were obtained through protocols approved by the Institutional Review Board of Memorial Sloan-Kettering Cancer Center (protocol 92–055 [7] and protocol 04–103 [Protocol S1]). All patients provided informed consent. Mutational Analyses of EGFR and KRAS in Lung Tumors Genomic DNA was extracted from tumor specimens, and primers for EGFR (exons 18–24) and KRAS2 (exon 2) analyses were as published [3,7]. All sequencing reactions were performed in both forward and reverse directions, and all mutations were confirmed at least twice from independent PCR isolates. A specific exon 20 mutation (T790M) was also detected by length analysis of fluorescently labeled (FAM) PCR products on a capillary electrophoresis device (ABI 3100 Avant, Applied Biosystems, Foster City, California, United States), based on a new NlaIII restriction site created by the T790M mutation (2369 C→T), using the following primers: EGFR Ex20F, 5′-FAM- CTCCCTCCAGGAAGCCTACGTGAT-3′ and EGFR Ex20R 5′- TTTGCGATCTGCACACACCA-3′. Using serially mixed dilutions of DNA from NSCLC cell lines (H1975, L858R- and T790M-positive; H-2030, EGFR wild-type) for calibration, this assay detects the presence of the T790M mutation when H1975 DNA comprises 3% or more of the total DNA tested, compared to a sensitivity of 6% for direct sequencing (data not shown). RT-PCR The following primers were used to generate EGFR cDNA fragments spanning exon 20: EGFR 2095F 5′- CCCAACCAAGCTCTCTTGAG-3′ and EGFR 2943R 5′- ATGACAAGGTAGCGCTGGGGG-3′. PCR products were ligated into plasmids using the TOPO TA-cloning kit (Invitrogen, Carlsbad, California, United States), as per manufacturer's instructions. Minipreps of DNA from individual clones were sequenced using the T7 priming site of the cloning vector. Functional Analyses of Mutant EGFRs Two numbering systems are used for EGFR. The first denotes the initiating methionine in the signal sequence as amino acid −24. The second, used here, denotes the methionine as amino acid +1. Commercial suppliers of antibodies, such as the Y1068-specific anti-phospho-EGFR, use the first nomenclature. To be consistent, we consider Y1068 as Y1092. Likewise, the T790M mutation reported here has also been called T766M. Mutations were introduced into full-length wild-type and mutant EGFR cDNAs using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California, United States) and cloned into expression vectors as described [3]. The following primers were used to generate the deletion (del) L747–E749;A750P mutant: forward 5′- TAAAATTCCCGTCGCTATCAAGGAGCCAACATCTCCGAAAGCCAACAAGG-3′ and reverse 5′- CCTTGTTGGCTTTCGGAGATGTTGGCTCCTTGATAGCGACGGGAATTTTA-3′. The following primers were used to introduce the T790M mutation: forward 5′- AGCTCATCATGCAGCTCAT-3′ and reverse 5′- ATGAGCTGCATGATGAGCT-3′. The L858R mutant cDNA was generated previously [3]. All mutant clones were fully re-sequenced bidirectionally to ensure that no additional mutations were introduced. Various EGFRs were transiently expressed in 293T human embryonic kidney cells as published [3]. Cells were treated with different concentrations of gefitinib or erlotinib. Immunoblotting See Methods and supplementary methods in [3] for details on cell lysis, immunoblotting, and antibody reagents. At least three independent experiments were performed for all analyses. Cell Culture The NSCLC cell lines H1650, H1975, H2030, H2347, H2444, H358, and H1734 were purchased from American Type Culture Collection (Manassas, Virginia, United States). H3255 was a gift of B. Johnson and P. Janne. Cells were grown in complete growth medium (RPMI-1640; American Type Culture Collection catalog no. 30–2001) supplemented with 10% fetal calf serum, 10 units/ml penicillin, and 10 μg/ml streptomycin) at 37 °C and 5% CO2. For viability studies, cells were seeded in complete growth medium in black 96-well clear bottom ViewPlates (PerkinElmer, Wellesley, Massachusetts, United States) at a density of 5,000 (H1975 and H2030) or 7,500 cells per well (H3255). Following overnight incubation, cells were grown for 24 h in the supplemented RPMI-1640 medium with 0.1% serum. Cells (in supplemented RPMI-1640 medium containing 0.1% serum) were then incubated for 48 h in the continued presence of gefitinib or erlotinib. Viability Assay Cell viability was assayed using Calcein AM (acetoxymethyl ester of Calcein, Molecular Probes, Eugene, Oregon, United States). Following incubation with gefitinib or erlotinib, monolayers were washed twice with PBS (containing calcium and magnesium) and incubated with 7.5 μmol Calcein AM in supplemented RPMI-1640 (no serum) for 30 min. Labeling medium was removed, and cells were washed three times with PBS. Calcein fluorescence (Ex, 485 nm; Em, 535 nM) was detected immediately using a Victor V multi-label plate reader (PerkinElmer). Three independent experiments were performed for each cell line; each experiment included four to eight replicates per condition. Results Case Reports We identified secondary EGFR mutations in three of six individuals whose disease progressed on either gefitinib or erlotinib (Table 1). Brief case histories of these three patients are presented below. Patient 1 This 63-y-old female “never smoker” (smoked less than 100 cigarettes in her lifetime) initially presented with bilateral diffuse chest opacities and a right-sided pleural effusion. Transbronchial biopsy revealed adenocarcinoma. Disease progressed on two cycles of systemic chemotherapy, after which gefitinib, 250 mg daily, was started. Comparison of chest radiographs obtained prior to starting gefitinib (Figure S1A, left panel) and 2 wk later (Figure S1A, middle panel) showed dramatic improvement. Nine months later, a chest radiograph revealed progression of disease (Figure S1A, right panel). Subsequently, the patient underwent a computed tomography (CT)–guided biopsy of an area in the right lung base (Figure 1A, left panel). Despite continued treatment with gefitinib, either with chemotherapy or at 500 mg daily, the pleural effusion recurred, 12 mo after initiating gefitinib (Figure 1A, right panel). Pleural fluid was obtained for molecular studies. In total, this patient had three tumor specimens available for analysis: the original lung tumor biopsy, a biopsy of the progressing lung lesion, and pleural fluid. However, re-review of the original transbronchial biopsy showed that it had scant tumor cells (Table 1). Patient 2. This 55-y-old woman with a nine pack-year history of smoking underwent two surgical resections within 2 y (right lower and left upper lobectomies) for bronchioloalveolar carcinoma with focal invasion. Two years later, her disease recurred with bilateral pulmonary nodules and further progressed on systemic chemotherapy. Thereafter, the patient began erlotinib, 150 mg daily. A baseline CT scan of the chest demonstrated innumerable bilateral nodules (Figure S1B, left panel), which were markedly reduced in number and size 4 mo after treatment (Figure S1B, middle panel). After 14 mo of therapy, the patient's dose of erlotinib was decreased to 100 mg daily owing to fatigue. At 23 mo of treatment with erlotinib, a CT scan demonstrated an enlarging sclerotic lesion in the thoracic spine. The patient underwent CT-guided biopsy of this lesion (Figure 1B, left panel), and the erlotinib dose was increased to 150 mg daily. After 25 mo of treatment, she progressed within the lung (Figure S1B, right panel). Erlotinib was discontinued, and a fluoroscopically guided core needle biopsy was performed at a site of progressive disease in the lung (Figure 1B, right panel). In total, this patient had three tumor specimens available for analysis: the original resected lung tumor, the biopsy of the enlarging spinal lesion, and the biopsy of the progressing lung lesion (Table 1). Patient 3 This 55-y-old female “never smoker” was treated for nearly 4.5 y with weekly paclitaxel and trastuzumab [17] for adenocarcinoma with bronchioloalveolar carcinoma features involving her left lower lobe, pleura, and mediastinal lymph nodes. Treatment was discontinued owing to fatigue. Subsequently, the patient underwent surgical resection. Because of metastatic involvement of multiple mediastinal lymph nodes and clinical features known at that time to be predictive of response to gefitinib (female, never smoker, bronchioloalveolar variant histology), she was placed on “adjuvant” gefitinib 1 mo later (Figure S1C, left panel). This drug was discontinued after 3 mo when she developed a new left-sided malignant pleural effusion (Figure S1C, middle panel). Despite drainage and systemic chemotherapy, the pleural effusion recurred 4 mo later (Figure S1C, right panel), at which time pleural fluid was collected for analysis. In total, this patient had two clinical specimens available for analysis: tumor from the surgical resection and pleural fluid (Table 1). Patients' Tumors Contain EGFR Tyrosine Kinase Domain Mutations Associated with Sensitivity to EGFR Tyrosine Kinase Inhibitors We screened all available tumor samples from these three patients for previously described drug-sensitive EGFR mutations, by direct DNA sequencing of exons 19 and 21 [3]. Tumor samples from patient 1 showed a T→G change at nucleotide 2573, resulting in the exon 21 L858R amino acid substitution commonly observed in drug-responsive tumors. This mutation was present in the biopsy material from the progressing lung lesion (Figure S2A, upper panels) and from cells from the pleural effusion (Figure S2A, lower panels), both of which on cytopathologic examination consisted of a majority of tumor cells (Table 1). Interestingly, comparisons of the tracings suggest that an increase in copy number of the mutant allele may have occurred. Specifically, while the ratio of wild-type (nucleotide T) to mutant (nucleotide G) peaks at position 2573 was approximately 1:1 or 1:2 in the lung biopsy specimen (Figure S2A, upper panels), sequencing of DNA from the pleural fluid cells demonstrated a dominant mutant G peak (Figure S2A, lower panels). Consistent with this, a single nucleotide polymorphism (SNP) noted at nucleotide 2361 (A or G) demonstrated a corresponding change in the ratios of A:G, with a 1:1 ratio in the transbronchial biopsy, and a nearly 5:1 ratio in the pleural fluid (Figure 2A). Notably, we did not detect the 2573 T→G mutation in the original transbronchial biopsy specimen (Table 1; data not shown). As stated above, this latter specimen contained scant tumor cells, most likely fewer than needed for detection of an EGFR mutation by direct sequencing (see [7]). All three specimens from patient 2, including the original lung tumor and the two metastatic samples from bone and lung, showed an exon 19 deletion involving elimination of 11 nucleotides (2238–2248) and insertion of two nucleotides, G and C (Figure S2B, all panels; Table 1). These nucleotide changes delete amino acids L747–E749 and change amino acid 750 from alanine to proline (A750P). A del L747–E749;A750P mutation was previously reported with different nucleotide changes [2]. In all samples from patient 2, the wild-type sequence predominated at a ratio of about 3:1 over the mutant sequence. Both of the available tumor samples from patient 3 contained a deletion of 15 nucleotides (2236–2250) in exon 19 (Table 1; data not shown), resulting in elimination of five amino acids (del E746–A750). This specific deletion has been previously reported [3]. The ratio of mutant to wild-type peaks was approximately 1:1 in both specimens (data not shown). Collectively, these results demonstrate that tumors from all three patients contain EGFR mutations associated with sensitivity to the tyrosine kinase inhibitors gefitinib and erlotinib. In addition, these data show that within individual patients, metastatic or recurrent lesions to the spine, lung, and pleural fluid contain the same mutations. These latter observations support the idea that relapsing and metastatic tumor cells within individuals are derived from original progenitor clones. A Secondary Missense Mutation in the EGFR Kinase Domain Detected in Lesions That Progressed while on Treatment with Either Gefitinib or Erlotinib To determine whether additional mutations in the EGFR kinase domain were associated with progression of disease in these patients, we performed direct sequencing of all of the exons (18 through 24) encoding the EGFR catalytic region in the available tumor specimens. Analysis of patient 1's pre-gefitinib specimen, which contained scant tumor cells (Table 1; see above), not surprisingly showed only wild-type EGFR sequence (Table 1; data not shown). However, careful analysis of the exon 20 sequence chromatograms in both forward and reverse directions from this patient's lung biopsy specimen obtained after disease progression on gefitinib demonstrated an additional small peak at nucleotide 2369, suggesting a C→T mutation (Figure 2A, upper panels; Table 1). This nucleotide change leads to substitution of methionine for threonine at position 790 (T790M). The 2369 C→T mutant peak was even more prominent in cells from the patient's pleural fluid, which were obtained after further disease progression on gefitinib (Figure 2A, lower panels; Table 1). The increase in the ratio of mutant to wild-type peaks obtained from analyses of the lung specimen and pleural fluid paralleled the increase in the ratio of the mutant G peak (leading to the L858R mutation) to the wild-type T peak at nucleotide 2573 (see above; Figure S2A), as well as the increase in the ratio of the A:G SNP at position 2361 (Figure 2A). Collectively, these findings imply that the exon 20 T790M mutation was present on the same allele as the exon 21 L858R mutation, and that a subclone of cells harboring these mutations emerged during drug treatment. In patient 2, the tumor-rich sample obtained prior to treatment with erlotinib did not contain any additional mutations in the exons encoding the EGFR tyrosine kinase domain (Figure 2B, upper panels; Table 1). By contrast, her progressing bone and lung lesions contained an additional small peak at nucleotide 2369, suggesting the existence of a subclone of tumor cells with the same C→T mutation observed in patient 1 (Figure 2B, middle and lower panels; Table 1). The relative sizes of the 2369 T mutant peaks seen in these latter two samples appeared to correlate with the relative size of the corresponding peaks of the exon 19 deletion (Figure S2B). Interestingly, the SNP at nucleotide 2361 (A or G) was detected in specimens from patient 2 before but not after treatment with erlotinib, suggesting that one EGFR allele underwent amplification or deletion during the course of treatment (Figure S2B). Patient 3 showed results analogous to those of patient 2. A tumor-rich pre-treatment specimen did not demonstrate EGFR mutations other than the del E746–A750 exon 19 deletion; specifically, in exon 20, no secondary changes were detected (Figure 2C, upper panels; Table 1). However, analysis of DNA from cells in the pleural effusion that developed after treatment with gefitinib showed the C→T mutation at nucleotide 2369 in exon 20 (Figure 2C, lower panels; Table 1), corresponding to the T790M mutation described above. There was no dramatic change between the two samples in the ratio of the A:G SNP at position 2361. The mutant 2369 T peak was small, possibly because gefitinib had been discontinued in this patient for 4 mo at the time pleural fluid tumor cells were collected; thus, there was no selective advantage conferred upon cells bearing the T790M mutation. To determine whether the 2369 C→T mutation was a previously overlooked EGFR mutation found in NSCLCs, we re-reviewed exon 20 sequence tracings derived from analysis of 96 fresh-frozen resected tumors [3] and 59 paraffin-embedded tumors [7], all of which were removed from patients prior to treatment with an EGFR tyrosine kinase inhibitor. We did not detect any evidence of the T790M mutation in these 155 tumors (data not shown; see Discussion). Collectively, our results suggest that the T790M mutation is associated with lesions that progress while on gefitinib or erlotinib. Moreover, at least in patients 1 and 2, the subclones of tumor cells bearing this mutation probably emerged between the time of initial treatment with a tyrosine kinase inhibitor and the appearance of drug resistance. In three additional patients (case histories not described here) with lung adenocarcinomas who improved but subsequently progressed on therapy with either gefitinib or erlotinib, we examined DNA from tumor specimens obtained during disease progression. In all three patients, we found EGFR mutations associated with drug sensitivity (all exon 19 deletions). However, we did not find any additional mutations in exons 18 to 24 of EGFR, including the C→T change at position 2369 (data not shown). These results imply that alternative mechanisms of acquired drug resistance exist. Patients' Progressive Tumors Lack KRAS Mutations Mutations in exon 2 of KRAS2 occur in about one-fourth of NSCLCs. Such mutations rarely, if ever, accompany EGFR mutations and are associated with primary resistance to gefitinib or erlotinib [7]. To evaluate the possibility that secondary KRAS mutations confer acquired resistance to these drugs, we performed mutational profiling of KRAS2 exon 2 from tumor specimens from patients 1 to 3, as well as the three additional patients lacking evidence of the T790M mutation. None of the specimens contained any changes in KRAS (Table 1; data not shown), indicating that KRAS mutations were not responsible for drug resistance and tumor progression in these six patients. An Established NSCLC Cell Line Also Contains Both T790M and L858R Mutations We profiled the EGFR tyrosine kinase domain (exons 18 to 24) and KRAS exon 2 in eight established NSCLC lines (Table 2). Surprisingly, one cell line—H1975—contained the same C→T mutation at position 2369 (T790M) as described above (Figure 2D, lower panel). This cell line had previously been shown by others to contain a 2573 T→G mutation in exon 21 (L858R) [18], which we confirmed (Figure 2D, upper panel); in addition, H1975 was reported to be more sensitive to gefitinib inhibition than other lung cancer cell lines bearing wild-type EGFR [18]. Only exons 19 and 21 were apparently examined in this published study. In our own analysis of H1975 (exons 18 to 24), the mutant 2369 T peak resulting in the T790M amino acid substitution was dominant, suggesting an increase in copy number of the mutant allele in comparison to the wild-type allele. The ratio of mutant to wild-type peaks was similar to that of the mutant 2573 G (corresponding to the L858R amino acid substitution) to wild-type T peaks (Figure 2D, all panels), implying that the T790M and L858R mutations were in the same amplified allele. To further investigate this possibility, we performed RT-PCR to generate cDNAs that spanned exon 20 of EGFR and included sequences from exon 19 and 21. PCR products were then cloned, and individual colonies were analyzed for EGFR mutations. Sequencing chromatograms of DNA from four of four clones showed both the 2369 C→T and 2573 T→G mutations, confirming that both mutations were in the same allele (data not shown). Other NSCLC cell lines carried either EGFR or KRAS mutations, but none had both (Table 2). As reported, H3255 contained an L858R mutation [19] and H1650 contained an exon 19 deletion [18]. No other cell lines analyzed contained additional mutations in the exons encoding the EGFR tyrosine kinase domain. A Novel PCR Restriction Fragment Length Polymorphism Assay Independently Confirms the Absence or Presence of the T790M Mutation As stated above, the mutant peaks suggestive of a T790M mutation in exon 20 were small in some sequence chromatograms. To eliminate the possibility that these peaks were due to background “noise,” we sought to confirm the presence of the 2369 C→T mutation in specific samples, by developing an independent test, based on a fluorescence detection assay that takes advantage of a PCR restriction fragment length polymorphism (PCR-RFLP) generated by the specific missense mutation. After PCR amplification with exon-20-specific primers spanning nucleotide 2369, wild-type sequence contains specific NlaIII sites, which upon digestion yield a 106-bp product (see Methods; Figure 3A). Presence of the mutant 2369 T nucleotide creates a new NlaIII restriction digest site, yielding a slightly shorter product (97 bp), readily detected by fluorescent capillary electrophoresis. This test is about 2 -fold more sensitive than direct sequencing (see Methods; data not shown). We first used DNA from the H1975 cell line (which contains both T790M and L858R mutations) to confirm the specificity of the PCR-RFLP assay. As expected, analysis of these cells produced both the 97- and 106-bp fragments. By contrast, analysis of DNA from H2030 (which contains wild-type EGFR; Table 2) showed only the 106-bp fragment (Figure 3A). These data show that this test can readily indicate the absence or presence of the mutant allele in DNA samples. However, this test was only semi-quantitative, as the ratio of the mutant 97-bp product versus the wild-type 106-bp product varied in independent experiments from approximately 1:1 to 2:1. We next used this PCR-RFLP assay to assess various patient samples for the presence of the specific 2369 C→T mutation corresponding to the T790M amino acid substitution. DNA from the progressing bone and lung lesions in patient 1 produced both the 97- and 106-bp fragments, but DNA from the original lung tumor did not (Figure 3B). The ratio of mutant to wild-type products was higher in the cells from the pleural fluid, consistent with the higher peaks seen on the chromatograms from direct sequencing of exon 20 (see Figure 2A). Likewise, DNA from progressive lesions from patients 2 and 3 yielded both 97- and 106-bp fragments in the PCR-RFLP assay (Figure 3B), whereas the pre-treatment specimens did not produce the 97-bp product. Collectively, these data from an independent assay confirm that the T790M mutation was present in progressing lesions from all three patients. We were also unable to detect the T790M mutation in any specimens from the three additional patients with acquired resistance that failed to demonstrate secondary mutations in EGFR exons 18 to 24 by direct sequencing (data not shown). Biochemical Properties of EGFR Mutants To determine how the T790M mutation would affect EGFR proteins already containing mutations associated with sensitivity to EGFR tyrosine kinase inhibitors, we introduced the specific mutation into EGFR cDNAs that encoded the exon 21 and 19 mutations found in patients 1 and 2, respectively. Corresponding proteins ([i] L858R and L858R plus T790M, [ii] del L747–E749;A750P and del L747–E749;A750P plus T790M, and [iii] wild-type EGFR and wild-type EGFR plus T790M) were then produced by transient transfection with expression vectors in 293T cells, which have very low levels of endogenous EGFR [3]. Various lysates from cells that were serum-starved and pre-treated with gefitinib or erlotinib were analyzed by immunoblotting. Amounts of total EGFR (t-EGFR) were determined using an anti-EGFR monoclonal antibody, and actin served as an indicator of relative levels of protein per sample. To assess the drug sensitivity of the various EGFR kinases in surrogate assays, we used a Y1092-phosphate-specific antibody (i.e., phospho-EGFR [p-EGFR]) to measure the levels of “autophosphorylated” Tyr-1092 on EGFR in relation to levels of t-EGFR protein. We also assessed the global pattern and levels of induced tyrosine phosphorylation of cell proteins by using a generalized anti-phosphotyrosine reagent (RC-20). Gefitinib inhibited the activity of wild-type and L858R EGFRs progressively with increasing concentrations of drug, as demonstrated by a reduction of tyrosine-phosphorylated proteins (Figure 4A) and a decrease in p-EGFR:t-EGFR ratios (Figure 4B). By contrast, wild-type and mutant EGFRs containing the T790M mutation did not display a significant change in either phosphotyrosine induction or p-EGFR:t-EGFR ratios (Figure 4A and 4B). Similar results were obtained using erlotinib against wild-type and del E747–L747;A750P EGFRs in comparison to the corresponding mutants containing the T790M mutation (Figure 4C). These results suggest that the T790M mutation may impair the ability of gefitinib or erlotinib to inhibit EGFR tyrosine kinase activity, even in EGFR mutants (i.e., L858R or an exon 19 deletion) that are clinically associated with drug sensitivity. Resistance of a NSCLC Cell Line Harboring Both T790M and L858R Mutations to Gefitinib or Erlotinib To further explore the functional consequences of the T790M mutation, we determined the sensitivity of various NSCLC cells lines grown in the presence of either gefitinib or erlotinib, using an assay based upon Calcein AM. Uptake and retention of this fluorogenic esterase substrate by vehicle- versus drug-treated live cells allows for a comparison of relative cell viability among cell lines [20]. The H3255 cell line, which harbors the L858R mutation and no other EGFR TK domain mutations (Table 2), was sensitive to treatment with gefitinib, with an IC50 of about 0.01 μmol (Figure 5). By contrast, the H1975 cell line, which contains both L858R and T790M mutations (Table 2), was approximately 100-fold less sensitive to drug, with an IC50 of about 1 μmol (Figure 5). In fact, the sensitivity of H1975 cells was more similar to that of H2030, which contains wild-type EGFR (exons 18 to 24) and mutant KRAS (Figure 5). Very similar results were obtained with erlotinib (Figure S3). Discussion Specific mutations in the tyrosine kinase domain of EGFR are associated with sensitivity to either gefitinib or erlotinib, but mechanisms of acquired resistance have not yet been reported. Based upon analogous studies in other diseases with another kinase inhibitor, imatinib, a single amino acid substitution from threonine to methionine at position 790 in the wild-type EGFR kinase domain was predicted to lead to drug resistance, even before the association of exon 19 and 21 mutations of EGFR with drug responsiveness in NSCLC was reported. The T790M mutation was shown in vitro in the context of wild-type EGFR to confer resistance to gefitinib [21] and a related quinazoline inhibitor, PD153035 [22]. We show here, through molecular analysis of tumor material from three patients and one NSCLC cell line, as well as additional biochemical studies, that acquired clinical drug resistance to gefitinib or erlotinib is indeed associated with the T790M mutation. Importantly, we find that the T790M mutation confers drug resistance not just to wild-type EGFR but also to mutant EGFRs associated with clinical responsiveness to EGFR tyrosine kinase inhibitors [1,2,3]. Our results further demonstrate that an analogous mechanism of acquired resistance exists for imatinib and EGFR tyrosine kinase inhibitors (Table 3), despite the fact that the various agents target different kinases in distinct diseases. In tumors from patients not treated with either gefitinib or erlotinib, the 2369 C→T mutation (T790M) appears to be extremely rare. We have not identified this mutation in 155 tumors (see above), and among nearly 1,300 lung cancers in which analysis of EGFR exons 18 to 21 has been performed [1,2,3,4,5,6], only one tumor (which also harbored an L858R mutation) was reported to contain the T790M mutation. Whether the patient from which this tumor was resected had received gefitinib or erlotinib is unclear, and the report did not note an association with acquired resistance to either drug [5]. How tumor cells bearing the T790M mutation emerge within gefitinib- or erlotinib-treated patients is a matter of investigation. Subclones bearing this mutation could arise de novo during treatment. However, based upon analogous studies in CML, it is also possible that NSCLC subclones bearing this secondary mutation pre-exist within the primary tumor clone in individual patients, albeit at low frequency [23]. In either scenario, treatment with gefitinib or erlotinib subsequently allows these resistant subclones to become apparent, because most cells bearing sensitivity-conferring mutations die, while cells with the T790M mutation persist. From analysis of the crystal structure of the EGFR kinase domain bound to erlotinib, it is has been shown that the wild-type threonine residue at position 790 is located in the hydrophobic ATP-binding pocket of the catalytic region, where it forms a critical hydrogen bond with the drug [24]. The related compound, gefitinib, is predicted to interact with this threonine residue as well. Substitution of the threonine at position 790 by a larger residue like methionine would probably result in steric clash with the aromatic moieties on these two drugs [25]. By contrast, ATP would likely not depend on the accessibility of the same hydrophobic cavity and is therefore probably not affected by the incorporation of a bulky methionine side chain [25]. Consistent with this, the T790M mutation has been shown not to abrogate the catalytic activity of wild-type EGFR [22]. The T790M mutation could also affect the kinase activity or alter the substrate specificity of mutant EGFRs, such that a proliferative advantage would be conferred upon cells bearing the mutation. Consistent with this, the H1975 NSCLC cell line reported here to contain both T790M and L858R did not to our knowledge undergo any prior treatment with gefitinib or erlotinib; the doubly mutated cells must have become dominant over time through multiple passages in vitro. This scenario could explain the seemingly contradictory report by others who found the H1975 cell line to be highly sensitive to gefitinib [18]; our H1975 cells could represent a subclone that emerged over time. Analysis of earlier passages of H1975 cells for the T790M mutation would be informative in this regard. Recently, new small-molecule inhibitors have been identified that retain activity against the majority of imatinib-resistant BCR-ABL mutants. The new drugs bind to ABL in an “open” conformation, as opposed to imatinib, which binds ABL in a “closed” conformation [12,13]. Analogously, it may be possible to find EGFR tyrosine kinase inhibitors that bind to the EGFR kinase domain in different ways than gefitinib and erlotinib. For example, the crystal structure of another EGFR inhibitor, lapatinib (GW572016), was recently solved bound to EGFR [26]. This study revealed that the quinazoline rings of erlotinib and lapatinib interact differently with the EGFR kinase domain, suggesting that while the T790M mutation may affect inhibition by erlotinib and gefitinib, it may not affect inhibition of EGFR by compounds similar to lapatinib. To our knowledge, no NSCLC patient who initially responded to but then progressed on either gefitinib or erlotinib has yet been treated with lapatinib. In some of the patient specimens analyzed, the actual sequencing peaks demonstrating the T790M mutation were smaller than originally anticipated. These results differ from those of acquired resistance mutation in CML [10], GIST [15,27], and HES [16]. However, in contrast to all of these diseases, in which tumor cells are readily accessible, lung-cancer-related tumors are more difficult to access, as illustrated by the limited manner in which we were able to obtain tumor cells from various sites of disease (see Figure 1). Moreover, re-biopsy of patients with lung cancer is not routinely performed. The use of position emission tomography scans to identify the most metabolically active lesions for biopsy could possibly circumvent this factor in the future, as long as such lesions are resectable. Additionally, as more molecularly tailored treatment options become available for lung cancer, re-biopsy of progressive sites of disease should become a standard procedure, especially for patients on clinical trials of targeted agents. Since tumor specimens from three additional patients with acquired resistance to EGFR tyrosine kinase inhibitors did not demonstrate the T790M mutation, this specific lesion does not account for all mechanisms of acquired resistance to gefitinib or erlotinib. Given the paradigm established with imatinib, other drug-resistance mutations in EGFR, either within or outside the tyrosine kinase domain, are likely to exist. It is also possible that EGFR amplification itself plays a role in acquired resistance, since imatinib-resistant clones have been shown to lack resistance mutations but contain amplified copies of BCR-ABL [11,28]. Nonetheless, studies presented here provide a basis for the rational development of “second generation” kinase inhibitors for use in NSCLC. Supporting Information Figure S1 Imaging Studies from Patients 1, 2, and 3 (A) Patient 1. Serial chest radiographs from before (day 0) and during gefitinib treatment (14 d and 9 mo), demonstrating initial response and subsequent progression. (B) Patient 2. Serial CT studies of the chest before (day 0) and during erlotinib treatment (4 mo and 25 mo), demonstrating initial response and subsequent progression. (C) Patient 3. Serial chest radiographs before (day 0) and during adjuvant gefitinib treatment (3 mo), following complete resection of grossly visible disease. The left-sided pleural effusion seen at 3 mo recurred 4 mo later, at which time fluid was collected for molecular analysis. (951 KB PPT). Click here for additional data file. Figure S2 Sequencing Chromatograms with the EGFR Exon 19 and 21 Mutations Identified in Patients 1 and 2 (A) Status of EGFR exon 21 in tumor specimens from patient 1. DNA from the growing lung lesion and the pleural effusion demonstrated a heterozygous T→G mutation at position 2573, leading to the common L858R amino acid substitution. (B) All three specimens from patient 2 showed the same heterozygous exon 19 deletion, removing residues 747–749 and changing the alanine at position 750 to proline. (104 KB PPT). Click here for additional data file. Figure S3 Sensitivity to Erlotinib Differs among NSCLC Cell Lines Containing Various Mutations in EGFR or KRAS See legend for Figure 5. (153 KB PPT). Click here for additional data file. Protocol S1 Memorial Sloan-Kettering Cancer Center IRB Protocol 04–103 (566 KB PDF). Click here for additional data file. Accession Numbers The LocusLink (http://www.ncbi.nlm.nih.gov/LocusLink/) accession number for the KRAS2 sequence discussed in this paper is 3845; the GenBank (http://www.ncbi.nlm.nih.gov/Genbank/) accession number for the KRAS2 sequence discussed in this paper is NT_009714.16. Reference EGFR sequence was obtained from LocusLink accession number 1956 and GenBank accession number NT_033968. Patient Summary Background Normal cells in our body have safety mechanisms that keep them from growing out of control. Tumor cells have somehow found ways around these safety mechanisms, in some cases through activating particular growth-promoting genes. One of these, the EGFR gene, is often activated in lung cancer. Two drugs, gefitinib (also known as Iressa) and erlotinib (also called Tarceva), have been developed to inhibit activated EGFR, and studies have shown that they can shrink tumors in some patients. Most patients who respond to these drugs have tumors that carry an alteration (or mutation) in the EGFR gene, which somehow makes their tumors responsive to the drugs. Why Was This Study Done? In those patients in whom the drugs work, the tumors shrink initially, but after a while they stop responding and the cancer comes back. The cancer has, as researchers describe it, become resistant to the drugs. Understanding how tumors become resistant is important to develop new and better drugs. What Did the Researchers Do? They asked patients who initially responded to erlotinib or gefitinib but then became resistant to consent to studies allowing further analysis of tumor tissue during and after drug treatment. They then re-examined the EGFR gene in these tumor samples. What Did They Find? They found that tumors from all patients carried mutations in the EGFR gene that are known to make them responsive to the drugs. In addition, three of the post-treatment tumors had an identical second mutation in their EGFR gene. Biochemical studies showed that these secondary alterations made the original drug-sensitive EGFR less sensitive to drug treatment. The numbers are small but suggest that this secondary resistance mutation could be quite common. Tumor cells from the three other patients didn't have this mutation, which suggests that there are other ways for lung cancers to become resistant to gefitinib and erlotinib. What Next? Larger studies are needed to confirm that this particular mutation is a major cause of resistance against the two drugs. It is also important to find out what causes resistance in the other cases. And knowing about this resistance mutation will help researchers to develop drugs that will work even against tumors with the mutation. More Information Online The following pages contain some information on the EGFR kinase inhibitors. U. S. Food and Drug Administration information page on Iressa (gefitinib): http://www.fda.gov/cder/drug/infopage/iressa/iressaQ&A.htm Cancer Research UK information page about erlotinib (Tarceva): http://www.cancerhelp.org.uk/help/default.asp?page=10296

0 comments Cited 828 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: not found

Clinical definition of acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors in non-small-cell lung cancer.

David A. Jackman, William Pao, Gregory J. Riely … (2010)

Ten percent of North American patients with non-small-cell lung cancer have tumors with somatic mutations in the gene for the epidermal growth factor receptor (EGFR). Approximately 70% of patients whose lung cancers harbor somatic mutations in exons encoding the tyrosine kinase domain of EGFR experience significant tumor regressions when treated with the EGFR tyrosine kinase inhibitors (TKIs) gefitinib or erlotinib. However, the overwhelming majority of these patients inevitably acquire resistance to either drug. Currently, the clinical definition of such secondary or acquired resistance is not clear. We propose the following criteria be used to define more precisely acquired resistance to EGFR TKIs. All patients should have the following criteria: previous treatment with a single-agent EGFR TKI (eg, gefitinib or erlotinib); either or both of the following: a tumor that harbors an EGFR mutation known to be associated with drug sensitivity or objective clinical benefit from treatment with an EGFR TKI; systemic progression of disease (Response Evaluation Criteria in Solid Tumors [RECIST] or WHO) while on continuous treatment with gefitinib or erlotinib within the last 30 days; and no intervening systemic therapy between cessation of gefitinib or erlotinib and initiation of new therapy. The relatively simple definition proposed here will lead to a more uniform approach to investigating the problem of acquired resistance to EGFR TKIs in this unique patient population. These guidelines should minimize reporting of false-positive and false-negative activity in these clinical trials and would facilitate the identification of agents that truly overcome acquired resistance to gefitinib and erlotinib.

0 comments Cited 258 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: not found

Gefitinib-Induced Killing of NSCLC Cell Lines Expressing Mutant EGFR Requires BIM and Can Be Enhanced by BH3 Mimetics

Mark S. Cragg, Junya Kuroda, Hamsa Puthalakath … (2007)

Introduction The epidermal growth factor receptor (EGFR) is a type I surface-bound receptor tyrosine kinase of the ErbB receptor family. Its activation by physiological ligands (e.g., EGF) causes EGFR homodimerization or heterodimerization of EGFR with other members of the ErbB family, resulting in activation of diverse signaling molecules such as extracellular signal-regulated protein kinase 1/2 (ERK1/2), protein kinase B (AKT), and signal transducer and activator of transcription proteins (STATs), which regulate cellular proliferation, survival, differentiation, and migration (reviewed in [1]). EGFR function is commonly dysregulated in a range of solid cancers (e.g., breast, lung, ovarian, bladder, brain, and colon) due to either gene amplification, mutations (resulting in a constitutively active EGFR), or abnormally increased ligand production (reviewed in [1]). Moreover, enforced expression of mutant EGFR in transgenic mice promoted development of lung carcinomas [2,3]. These observations prompted the development of EGFR inhibitory drugs for cancer therapy. The EGFR tyrosine kinase inhibitors gefitinib (Iressa, AstraZeneca) and erlotinib (Tarceva, Genentech) as well as the monoclonal antibody cetuximab (Erbitux, Merck), which blocks ligand binding, cause substantial regression of a small proportion of non-small cell lung cancers (NSCLCs), particularly those with EGFR mutations that give rise to hyperactive kinases [1,4–6]. Signaling from mutant but not wild-type (WT) EGFR was shown to activate anti-apoptotic pathways, and small interfering RNA-mediated down-regulation of mutant EGFR resulted in the death of these cells [7], but the mechanisms for tumor cell killing were not examined. Mammals have two distinct but ultimately converging apoptosis signaling pathways [8], the extrinsic pathway, which is activated by “death receptors,” and the intrinsic (also called “mitochondrial” or “BCL-2-regulated”) pathway [9]. The BCL-2 family of proteins regulate the intrinsic apoptosis signaling pathway, and according to their structure and function they can be divided into three groups. The BAX- and BAK-like proteins, which share three regions of homology (BCL-2-homology [BH] domains), are proapoptotic and perturb the mitochondrial membrane potential when activated, resulting in release of cytochrome c, activation of the caspase cascade, and cellular destruction [10]. To prevent cell death, BAX and BAK are bound and inhibited by the antiapoptotic members of the BCL-2 family (BCL-2, BCL-xL, BCL-w, MCL-1, and A1), which share up to four BH regions [10]. The third subgroup, the BH3-only proteins (BAD, BID, BIK [also called BLK or NBK], HRK [also called DP5], BIM [also called BOD], NOXA, PUMA [also called BBC3], and BMF), share with each other and the remainder of the BCL-2 family only the 9- to 16-amino acid BH3 domain. The BH3-only proteins initiate apoptosis signaling by binding and antagonizing the prosurvival BCL-2 family members, thereby causing activation of BAX and BAK [11]. BH3-only proteins can be regulated by a range of transcriptional and post-translational mechanisms [12], and experiments with gene-targeted mice have shown that different members of this subgroup are required for the execution of different death stimuli. For example, PUMA and to a lesser extent NOXA are critical for DNA damage-induced apoptosis [13–15], whereas BIM is essential for hematopoietic cell homeostasis and cytokine deprivation-induced apoptosis [16]. Here, we studied the molecular mechanisms through which certain NSCLC tumor cell lines expressing mutant but not wild-type (WT) EGFR undergo apoptosis after treatment with the EGFR inhibitor gefitinib. Methods Cell Lines, Expression Vectors, and Cell Transfection The NSCLC cell lines NCI-H358, NCI-441, NCI-H1650, and NCI-H1975 were all obtained from ATCC. NCI-H3255 cells were obtained from Drs. Bruce Johnson and Kreshnik Zejnullahu (Dana Faber, Boston). (NCI is left out from the nomenclature hereafter). HCC827 cells were a kind gift of Dr. Dan Costa (Department of Medicine, Harvard Medical School, Boston, MA). H358 and H441 cells express WT EGFR, whereas H1650 and HCC827 cells harbor an exon 19 mutation (DelE746A750) and H3255 cells possess a single amino acid substitution mutation (L858R) in the EGFR gene. H1975 cells harbor two mutations (L858R and T790M) in the EGFR gene. All cells were maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal calf serum (FCS, JRH Biosciences, Lenexa, Kansas). The caspase inhibitor QVD-OPH (MP Biomedicals, Aurora, Ohio) was used at 25 μM and added to cells 30 min prior to treatment with gefitinib. Kinase inhibitors UO126, PD98059 (CST, Beverley, MA), SP6, LY294002, AKT inhibitor Akti1/2 (Merck), ABT-737, gefitinib (AstraZeneca), erlotinib, and cetuximab (gifts from Dr. Thomas Valerius, University of Schleswig-Holstein, Germany) were dissolved in DMSO and used as indicated. The anti-BIM short hairpin RNA construct, cloned into pSUPER with the neomycin-resistant gene, has been described previously [17]. Transfection with Fugene (Roche, Indianapolis, IN) was performed according to the manufacturer's instructions and vector-transfected clones were selected with 1 mg/ml Geneticin (Gibco BRL, Grand Island, NY). Cell lines were single cell-cloned by limiting dilution. Western Blotting Protein samples were separated by SDS-PAGE and then electroblotted onto a PVDF membrane (Hybond P, Amersham Biosciences). Antibodies against BCL-w (clone 13F9; Alexis), BCL-xL (BD/Pharmingen), BIM (clone 3C5, Alexis; or polyclonal antibodies from Stressgen), BAD (Stressgen), phospho-BAD (phosphorylated at Ser112), phospho-BAD (Ser136), phospho-ERK1/2 (Thr202/Tyr204), total ERK1/2, phospho-AKT (193H12, Ser473), total AKT, phospho-EGFR (Tyr1068), total EGFR (all from CST), BAX (Upstate), human BMF (polyclonal antibody from Alexis), HSP70 (N6; gift from Dr. R Anderson, Peter MacCallum Cancer Institute, Melbourne, Australia), MCL-1 (Dako), PARP (Alexis), PUMA (NT, Pro-Sci), and β-actin (Sigma) were used as indicated by the manufacturers. Detection was performed with horseradish peroxidase-conjugated secondary antibodies (specific to rat, mouse, hamster, or rabbit IgG) and enhanced chemiluminescence (Amersham Biosciences). Two-Dimensional Gel Electrophoresis Two-dimensional protein gel electrophoresis was performed using the IPGphor isoelectric focusing system (Amersham Biosciences). BIM was isolated from cell lysates by immunoaffinity chromatography using mAb 3C5 (Alexis). Samples were then loaded onto IPG gels, rehydrated at 20 °C for 12 h, and subjected to isoelectric focusing for at least 22 h. After equilibration with SDS-PAGE buffer for 15 min at room temperature, the IPG gel was subjected to SDS-PAGE. Transfer, immunoblotting and visualization were performed as described above. Reverse Transcriptase Polymerase Chain Reaction Total RNA was extracted using the Micro-to-Midi Total RNA Extraction Kit (Invitrogen), and total RNA subjected to reverse transcription. For semiquantitative analysis, cDNA was subjected to PCR, using primers for BIM, with samples removed after a given number of cycles. Primers for BIM were used as previously described [18]. β-actin was used as a control for the quality and abundance of RNA. For quantitative PCR analysis of BIM and PUMA expression, TaqMan probes were used in conjunction with an ABI-PRISM 7900 thermal cycler (Applied Biosystems) according to the manufacturer's instructions. β2 microglobulin was used as a control for the quality and abundance of RNA. Fold induction of BIM and PUMA was calculated by comparing Ct values of treated and untreated samples after first correcting for RNA abundance. Cell Death Assays Cell death was assessed following release of the cells from the culture dish through trypsinization. Cell death was assessed by flow cytometric analysis in a FACScan (Becton Dickinson), either by staining with propidium iodide (PI) plus Annexin V-FITC or by assessing the extent of DNA fragmentation as detailed previously [19]. The latter technique was also performed to assess changes in cell cycle distribution. Assays for BAX Activation Activation status of BAX was assessed using the activation-specific mAb for BAX, followed by flow cytometric analysis as detailed previously [20]. Alternatively, BAX activation was assessed by following its redistribution from the cytosolic to the membrane fraction by subcellular fractionation using digitonin lysis followed by SDS-PAGE and Western blotting, as detailed previously [20]. Membranes were also probed to determine whether cytochrome c had been released from the mitochondria (redistribution from the membrane to the cytosolic fraction) and for BAK (membrane-resident) as well as HSP70 (cytosol-resident) as controls for the quality of subcellular fractionation and protein loading. Results Varying Sensitivities of NSCLC Cell Lines to Gefitinib-Induced Apoptosis The NSCLC cell lines H358 (WT EGFR), H1650, HCC827 (Del E746A750 deletions) and H3255 (L858R mutation) [5,7,21,22] were chosen for initial studies on the effects of gefitinib. Gefitinib potently inhibited the activation of ERK1/2 in all three cell lines expressing mutant EGFR, as judged by its dephosphorylation, whereas the H358 cells expressing WT EGFR were unaffected, as previously reported (Figure 1A) [5,7,21,22]. Extensive apoptosis was observed only in H3255 and HCC827 cells (Figure 1B). H1650 cells displayed only a low level of apoptosis and H358 cells were refractory. In addition, we also examined H1975 cells, which were originally reported as gefitinib sensitive [7]. However, we found that gefitinib treatment of these cells did not result in dephosphorylation of ERK1/2 (Figure 1A) or substantial apoptosis (Figure 1B), presumably due to the presence of the additional (T790M) mutation, known to reduce the kinase activity of EGFR, rendering it effectively wild type [23]. Next, we assessed the mechanism of cell death in the highly sensitive H3255 cells. Figure 1 Effect of Gefitinib on NSCLC Cells Expressing WT or Mutant EGFR NSCLC cells expressing WT (H358) or mutant (HCC827, H1975, H1650, H3255) EGFR were treated with varying concentrations of gefitinib for 24 h (A) or 72 h (B). Cells were then either assessed for the phosphorylation status of ERK (A) or cell death (B). Western blotting (A) was performed to determine the phosphorylation status of ERK1/2 before and after treatment with gefitinib. An actin loading control is also shown. Cell death was assessed by Annexin V-FITC plus PI staining (B). Results represent mean ± standard error of the mean (SEM) of at least three experiments. NT, no treatment. Mechanisms of Gefitinib-Induced Apoptosis Apoptosis after treatment of H3255 cells with gefitinib featured PARP cleavage and phosphatidylserine exposure (as detected by staining with FITC-coupled Annexin V), was caspase dependent and involved activation of BAX and mitochondrial release of cytochrome c (Figure S1). BAX activation was revealed both by flow cytometric analysis using antibodies that recognize activated BAX and by subcellular fractionation, which showed that a substantial proportion of BAX redistributed from the cytosol to the mitochondrial fraction after treatment with gefitinib (Figure S1D and S1E). BAX and BAK are activated when prosurvival BCL-2 family members are antagonized by the proapoptotic BH3-only proteins [11]. In all three mutant EGFR-expressing cell lines, gefitinib caused a significant induction of BIM in a time- and dose-dependent manner (Figures 2A, S2, and S3). BIM has a number of isoforms, the major ones designated BIMEL (extra long), BIML (long), and BIMS (short), which are generated through alternative splicing and therefore differ in molecular weight [24]. We routinely observed BIMEL and BIML isoforms in our gefitinib-treated cells, with BIMEL the most highly expressed (Figure 2A). In accordance with the differential sensitivity of the cell lines to gefitinib-induced apoptosis, BIM induction was more prominent in H3255 cells compared to the HCC827 and H1650 cells (Figure 2A). The expression of other BH3-only proteins (BMF, BAD, and PUMA) and the prosurvival BCL-2 family members BCL-w, BCL-xL, and MCL-1 did not change significantly in either the H3255 or H1650 cells after treatment with gefitinib (Figure 2B). Notably, BIM was not strongly induced in two NSCLC cell lines expressing WT EGFR or in the H1975 cells expressing the L858R and T790M mutant EGFR (Figure S4). Therefore, the extent of BIM induction after gefitinib treatment correlated directly with the extent of apoptosis induced in the NSCLC cells. Figure 2 Induction and Dephosphorylation of BIM after Gefitinib Treatment in NSCLC Cells Expressing Mutant EGFR (A) In the blot on the left, H1650 cells were left untreated (NT) or treated with 1 μM gefitinib (G) for 24, 48, or 72 h and the cells harvested, lysed, and assessed by Western blotting for the expression of BIM. HCC827 or H3255 cells (center and right, respectively) were treated for 16 h with a range of concentrations of gefitinib (10–0.08 μM) and the expression of BIM analyzed as above. Actin is shown as a loading control. (B) H1650 or H3255 cells were treated as in (A) and then BH3-only proteins, prosurvival BCL-2 family members, or β-actin (loading control) assessed by Western blotting. (C) H3255 cells were left untreated (NT) or treated for 16 h with 1 μM gefitinib (Gef) and the cells harvested and lysed. Portions of the samples were then treated with λ-phosphatase (+) or left untreated (−) and then assessed by Western blotting for BIM (labeled BimEL and BimL). (D) H3255 cells were left untreated or treated for 16 h with 1 μM gefitinib and the cells harvested and lysed. BIM (labeled BimEL and BimL) was isolated by immunoaffinity chromatography and subjected to two-dimensional gel SDS-PAGE followed by Western blotting for BIM. BIM Is Essential for Gefitinib-Induced Apoptosis of NSCLC Cells To examine the role of BIM in gefitinib-induced cell killing, we generated multiple subclones of H3255 cells stably expressing a BIM RNA interference (RNAi) construct. In these transfectants BIM expression was reduced, even after treatment with gefitinib (Figure 3A and 3B). BIM knockdown protected H3255 cells potently against gefitinib over a range of concentrations, and the level of protection correlated with the extent of BIM reduction in these subclones (Figure 3C and 3D). The BIM RNAi transfectants still responded to gefitinib, as judged by its ability to elicit dephosphorylation of EGFR as well as its downstream targets ERK1/2 and to induce G1 cell cycle arrest (Figure 3B and unpublished data). Figure 3 BIM Knockdown by RNAi Protects H3255 Cells against Gefitinib-Induced Killing (A) Western blot analysis documents the level of BIM expression in parental and BIM RNAi knockdown subclones of H3255 cells. Probing with an antibody to total ERK (T ERK) was used as a loading control. (B and C) Parental and BIM RNAi knockdown subclone #21 of H3255 cells were left untreated (NT) or treated for 18 h with gefitinib (1–0.04 μM) prior to cell lysis and Western blotting (B) or assessment of cell death (C). Blots (B) were probed with antibodies specific to phosphorylated EGFR (pEGFR), phosphorylated ERK (pERK), BIM or β-actin (loading control). Cell viability (C) was determined by staining with Annexin V-FITC plus PI, followed by flow cytometric analysis. (D) Parental and BIM RNAi knockdown subclones (#21, #27, and #42) of H3255 cells were treated for 24 h with DMSO (vehicle control; NT) or 1 μM gefitinib and cell death assessed as above. Data represent means ± SEM of three experiments. Gefitinib Causes Increased BIM Transcription as well as Post-translational Modifications in BIM The proapoptotic activity of BIM can be regulated by a range of transcriptional and post-translational mechanisms [12]. Semiquantitative reverse transcriptase PCR and quantitative PCR analyses demonstrated that gefitinib induced a substantial (∼3-fold) increase in BIM mRNA in H3255 cells and to a lesser extent in H1650 cells (Figures S5A and S5B). The induction of BIM was specific, as expression of other BH3-only genes was not elevated and the levels of PUMA mRNA actually fell after gefitinib treatment (Figure S5C). The electrophoretic mobility of BIMEL changed rapidly (within 15–60 min) after gefitinib treatment of H3255 cells, coinciding with loss of ERK1/2 activity (Figure S6A). BIMEL has multiple phosphorylation sites and its proapoptotic activity can be down-regulated through ERK-mediated phosphorylation, which targets it for ubiquitination and proteasomal degradation [12,25,26]. Treatment of cell lysates with λ phosphatase showed that BIMEL and BIML are phosphorylated in healthy but not in gefitinib-treated cells (Figure 2C). Two-dimensional gel electrophoresis and Western blotting demonstrated that BIMEL and BIML immunoprecipitated from gefitinib-treated H3255 cells had less negative charge than BIM from untreated cells, confirming the accumulation of dephosphorylated forms of BIM (Figure 2D). The levels of phosphorylated BAD (Ser136 but not Ser112) dropped after gefitinib treatment (Figure S6B), likely as a consequence of shutdown of the AKT and/or ERK1/2 pathways, which are known to promote phosphorylation of BAD and thereby inhibit its proapoptotic activity [27]. However, significant BAD dephosphorylation occurred only when apoptosis was already underway, perhaps indicating that it is a consequence rather than an initiator of cell death. Unfortunately, our attempts to decrease BAD expression in the H3225 cells by RNAi have so far failed, so the importance of BAD in gefitinib-induced death remains to be determined. Signal Transduction Pathways Leading to BIM Activation That Are Affected by Gefitinib To identify the critical pathways responsible for BIM transcriptional induction and BIM dephosphorylation after gefitinib treatment, we employed a range of specific inhibitors to block MEK (UO126 or PD98059), PI3K (LY294002), or JNK (SP6). These studies revealed that MEK inhibition alone was sufficient to induce rapid (within 1 h) dephosphorylation of BIMEL and BIML, whereas PI3K and JNK inhibitors had no effect (Figure 4A). Although the extent of BIM induction after 16 h of treatment correlated with the potency of MEK inhibition (UO126 is a more potent inhibitor than PD98059 [28]), it was not able to cause BIM up-regulation to the extent seen with gefitinib (Figure 4B). Similar results were also observed in H1650 and HCC827 cells (Figure 4C) in which MEK inhibition caused an increase in the expression and dephosphorylation of BIMEL but to a lesser extent than that induced with gefitinib. Therefore, although MEK–ERK1/2 inhibition appears important for BIM dephosphorylation and accumulation, other signaling pathways are involved to achieve maximal BIM induction. The obvious candidate would be the PI3K–AKT pathway. Surprisingly, the well-established PI3K inhibitor LY294002 caused only incomplete AKT dephosphorylation in the H3255 cells, in contrast to gefitinib, which achieved almost complete AKT dephosphorylation (Figure 4A). Therefore, to explore the importance of the PI3K/AKT pathway further, we employed a number of additional inhibitors of PI3K (Wortmannin), mTor (rapamycin), or AKT (Akti1/2) [29]. Although Wortmannin and the AKT inhibitor induced complete AKT dephosphorylation, they did not result in BIM accumulation (Figure 4D). This indicates that effects of gefitinib on the PI3K–AKT pathway may not be required for full BIM induction in NSCLC cells, but it remains possible that AKT triggers other antiapoptotic pathways (e.g., BAD inactivation) in these cells. This suggestion is supported by the observation that although BIM levels did not rise substantially upon treatment with either PI3K or AKT inhibitors, both induced apoptosis (unpublished data). Figure 4 Role of Shutdown of the MEK, JNK, PI3K, and AKT Signaling Pathways in BIM Dephosphorylation and Accumulation (A and B) H3255 cells were treated with UO126 (UO, 20 μM), PD98059 (PD, 20 μM), LY294002 (LY, 25 μM), Sp6 (20 μM), or gefitinib (Gef, 1 μM) for 1 h (A) or 16 h (B) and then harvested, lysed, and assessed by Western blotting. Blots were probed for phosphorylated AKT (pAKT), total AKT (T AKT), phosphorylated ERK (pERK), total ERK (T ERK) and BIM. (C) H1650 and HCC827 cells were treated for 24 h with either UO126 (20 μM) or gefitinib (1 μM) and then harvested, lysed, and assessed by Western blotting for the levels of BIM, phosphorylated ERK (pERK), and total ERK (T ERK). (D) H3255 cells were treated for 16 h with gefitinib (Gef, 1 μM), LY294002 (LY, 25 μM), Wortmannin (Wm, 1 μM), AKT inhibitor (AI, 20 μM), or rapamycin (Ra, 100 ng/ml) and then harvested, lysed, and assessed by Western blotting as in (A). (E) H3255 cells were treated for 16 h with various combinations of cetuximab (C, 10 μg/ml), UO126 (20 μM), erlotinib (E, 1 μM), or gefitinib (Gef, 1 μM) and then harvested, lysed, and assessed by Western blotting as in (A). (F) H3255 cells were treated for 48 h with various combinations of cetuximab (C, 10 μg/ml), UO126 (20 μM), or gefitinib (Gef, 1 μM) and then cell death assessed as previously. Data represent means ± SEM of at least three experiments. EGFR Inhibitors Other than Gefitinib also Cause BIM Induction in NSCLC Cell Lines Since gefitinib caused activation of BIM in NSCLC cells harboring EGFR mutations, we investigated whether other EGFR inhibitors had similar effects. Addition of cetuximab (a monoclonal antibody inhibitor of EGFR) resulted in the induction of BIM, although to a lower extent compared to treatment with gefitinib. This correlated with lower levels of inactivation (dephosphorylation) of EGFR and ERK1/2 (Figure 4E) and also less cell killing (Figure 4F), in line with recent reports [30]. In contrast, a second EGFR tyrosine kinase inhibitor, erlotinib, achieved levels of inactivation of EGFR, AKT, and ERK similar to gefitinib and resulted in comparable levels of BIM induction, BIM dephosphorylation (Figure 4E), and cell death (unpublished data). Combining the MEK inhibitor UO126 with cetuximab resulted in increased levels of BIM (Figure 4E) and cell death (Figure 4F) compared to treatment with cetuximab alone, illustrating the importance of inhibiting the ERK1/2 signaling pathway for efficient BIM accumulation. However, it should be noted that gefitinib reproducibly induced more cell death than did the combination of cetuximab and UO126 (Figure 4F), indicating that other MEK-ERK–independent signaling pathways also contribute to cell death after gefitinib treatment. EGFR Inhibitors and the BH3-Mimetic ABT-737 Synergize in the Killing of NSCLC Cell Lines On their own, EGFR inhibitors such as gefitinib or erlotinib are unlikely to provide cures in the majority of NSCLC patients, even those harboring mutant EGFR. Therefore, we explored how to augment the effects of these drugs. BH3 mimetics such as ABT-737 bind with high affinity to BCL-2, BCL-xL, and BCL-w, and kill certain tumor cells when used alone or in combination with chemotherapeutic drugs or γ-irradiation [31]. We found that ABT-737 substantially enhanced gefitinib-induced apoptosis in H3255 cells and even in the relatively insensitive H1650 cells (Figure 5). Furthermore, ABT-737 modestly enhanced the gefitinib-induced apoptosis of the H1975 cells. These results therefore demonstrate that EGFR inhibitors and the BH3 mimetic ABT-737 synergize in the killing of NSCLC cell lines. Figure 5 Synergy between Gefitinib and ABT-737 in Killing of NSCLC Cells Expressing Activating Mutations of EGFR H358, H1650, H1975, and H3255 cells were treated with gefitinib (H358, H1975, and H1650, 10 μM gefitinib; H3255, 1 μM gefitinib) in the presence or absence of ABT-737 (1 μM) for 32 h (H3255 cells) or 48 h (H358, H1650, H1975 cells). Cells were then harvested and survival measured as in Figure 1B. Data represent means ± SEM of three experiments indicating percentage of cell death compared to untreated cells. Discussion In this paper, we demonstrate that activation of the proapoptotic BH3-only protein BIM is essential for tumor cell killing and that shutdown of the EGFR–MEK–ERK signaling cascade is critical for BIM activation. Moreover, we demonstrate that addition of a BH3 mimetic significantly enhances killing of NSCLC cells by the EGFR tyrosine kinase inhibitor gefitinib. Recent data have highlighted the fact that inhibitors directed to critical receptors, kinases, and enzymes that are dysregulated during tumorigenesis present unique and powerful targets for cancer therapy. A prime example is the BCR-ABL fusion product, which results from the reciprocal t(9;22)(q34;q22) chromosomal translocation (Philadelphia [Ph1] chromosome), essential for development and sustained growth of chronic myelogenous leukemia and Ph1-positive (Ph1+) acute lymphoblastic leukemias [32]. Inhibition of BCR-ABL using the specific kinase inhibitor imatinib (Gleevec) results in cell death and tumor regression [33]. Recently, we showed that the cell death pathway evoked is critically dependent on BIM with supporting roles for BAD and BMF [34]. Here, we show that inhibition of the mutant EGFR found in certain NSCLC cells triggers cell death through a similar mechanism. We also show that three NSCLC cell lines expressing activating mutants of EGFR, but not cell lines expressing wild-type EGFR or mutant EGFR with wild-type signaling potential (H1975), are sensitive to apoptosis induced by the EGFR inhibitor gefitinib. Of the three cell lines with the hyperactive EGFR, H1650 cells were much less sensitive than the H3255 and HCC827 cells, and apparently much less sensitive to EGFR inhibition than previously reported, where 90% cell death was induced after small interfering RNA knockdown of the mutant EGFR [7]. Two independent vials of H1650 (obtained from ATCC) displayed the same sensitivity to gefitinib. For this reason we can only assume that genetic drift has occurred from the original cells reported in the earlier work. Notably, similar gefitinib resistance of this cell line has been reported independently (Costa and Kobayashi, personal communication). Potentially, protection from gefitinib-induced apoptosis in H1650 cells relates to its higher level of pAKT and/or pERK1/2 (unpublished data), since an inability of gefitinib to block AKT and/or ERK1/2 activation has previously been linked to apoptosis resistance in NSCLC cells [21,35]. Death of the sensitive H3255 cells was associated with the subcellular redistribution and activation of BAX, and was caspase dependent as judged by the clear PARP cleavage and inhibition of apoptosis by the caspase inhibitor QVD-OPH. Activation of BAX was more readily apparent in the presence of QVD-OPH, presumably due to the inhibition of cell destruction and consequent BAX degradation. This result is consistent with the view that BAX is activated through a caspase-independent pathway and is situated upstream of caspase activation in the cell death pathway. Western blot analysis revealed that gefitinib consistently induced BIM in all three NSCLC lines expressing mutant EGFR. The level of BIM induction was higher in the H3255 and HCC827 cells, in accordance with their greater sensitivity to apoptosis than the H1650 cells. BIM induction preceded apoptosis, and RNAi-mediated BIM knockdown protected H3255 cells potently from gefitinib with the level of protection correlated with the extent of BIM reduction in various subclones. These results demonstrate that BIM is essential for the initiation of gefitinib-induced apoptosis in these cells. Similar dependence on BIM for gefitinib-induced apoptosis of HCC827 cells has been observed independently (Costa and Kobayashi, personal communication). The induction of BIM was a consequence of both transcriptional induction and post-translational modification. Post-translational regulation of BIM after gefitinib treatment involved rapid dephosphorylation and was a result of ERK1/2 inhibition, downstream of MEK shutdown. ERK1/2 kinases are known to phosphorylate BIM and regulate its turnover in cells by targeting it for ubiquitination and subsequent proteasomal degradation [26,36,37]. Therefore, inhibition of ERK1/2 provides a mechanism through which EGFR blockade by gefitinib elicits BIM accumulation. Although gefitinib-induced dephosphorylation of BIM could be mimicked by treatment with MEK inhibitors, this did not cause BIM up-regulation (or apoptosis) to the extent seen with gefitinib. Therefore, although MEK–ERK1/2 inhibition appears critical for BIM dephosphorylation and accumulation, other signaling pathways must contribute to achieve maximal BIM induction and apoptosis. The identity of these pathways remains to be determined. Imatinib-induced transcriptional up-regulation of BIM in BCR-ABL transformed cells was previously reported to be mediated by FOXO3A [38] and linked to the shutdown of PI3K–AKT signaling [39]. Because mutant EGFR potently stimulates the AKT pathway [7], we anticipated that a similar mechanism of BIM induction would be activated after gefitinib treatment of NSCLC cells expressing hyperactive mutant EGFR. However, although AKT phosphorylation was abrogated as a component of the response to gefitinib treatment, our data using pathway-specific inhibitors indicate that PI3K–AKT may not be involved. As such, neither the PI3K inhibitors LY294002 and Wortmannin nor a specific AKT inhibitor had any effect on BIM induction in NSCLC cells expressing mutant EGFR. This finding indicates that the PI3K–AKT–FOXO3 pathway is not critical for BIM induction after gefitinib treatment in these cells. However, this finding does not preclude the possibility that PI3K–AKT inactivation and consequent FOXO3A activation might play a role in the apoptosis observed after gefitinib treatment, as these inhibitors all triggered apoptosis in NSCLC cells (unpublished data). The downstream effectors of this apoptosis are unknown but are likely to include the BH3-only proteins BAD and PUMA, known targets of AKT [27] and FOXO3A [40], respectively. With regard to LY294002, it is noteworthy that this PI3K inhibitor did not substantially reduce AKT phosphorylation in these NSCLC cells, but still evoked apoptosis. Although surprising, this was a reproducible finding (with two different sources of the inhibitor), which indicates the presence of a signaling pathway regulated by PI3K but independent of AKT (and BIM). This pathway may involve the above-mentioned FOXO3A-mediated induction of the BH3-only protein PUMA [40]. A monoclonal antibody inhibitor of EGFR, cetuximab, induced BIM in H3255 cells, although to a lesser extent and with less dephosphorylation than that seen after treatment with either gefitinib or erlotinib. This effect correlated with a lower level of ERK1/2 dephosphorylation and less cell killing elicited by cetuximab than that achieved by gefitinib (Figure 4F). In agreement with this observation, cetuximab was previously shown to be less potent than gefitinib at inducing apoptosis in other EGFR-mutant NSCLC cells [30]. Accordingly, the combination of a MEK inhibitor with cetuximab resulted in increased BIM induction, comparable to that achieved by treatment with gefitinib, supporting the observation that MEK–ERK signaling is critical for BIM up-regulation in these cells. This combination of cetuximab plus MEK inhibitor also substantially enhanced apoptosis of the H3255 cells compared to either agent alone, but not to the level induced by gefitinib. This result supports the suggestion that other MEK–ERK-independent signaling pathways (likely those regulated by PI3K–AKT discussed above) also contribute to apoptosis induced by gefitinib in NSCLC harboring activating mutations of EGFR. More generally, these data reveal important differences between the signaling pathways triggered by EGFR kinase inhibitors and those induced by antagonistic monoclonal antibodies, and present a rational means for improving clinical responses to cetuximab - by combining it with MEK inhibitors. Although initially promising it is now clear that EGFR inhibitors such as gefitinib or erlotinib are unlikely to provide cures in the majority of patients with NSCLC, even in those with cancers expressing mutant EGFR. However, understanding how these drugs work will provide critical information to help design strategies to augment their efficacy. Here we have shown that BIM up-regulation is essential for the apoptosis elicited by EGFR inhibitors in NSCLC cells harboring EGFR activating mutations, and detailed a number of the important mechanisms responsible. The next step will be to find strategies to augment the effects of the EGFR-inhibitory drugs. For example, blockade of signaling molecules within the Ras/MEK or PI3K/mTOR pathways might augment the effects of EGFR therapeutics, similar to their effects on chronic myelogenous leukemia cells when used in conjunction with the BCR-ABL inhibitor imatinib [41]. However, it should be noted that concurrent treatment of H3255, HCC827, or H1650 cells with gefitinib and a MEK inhibitor did not result in substantially enhanced apoptosis (unpublished data), presumably because gefitinib already efficiently inactivates ERK1/2 in these cells. Therefore, drugs that target the PI3K/mTOR pathways may be more successful. Another therapeutic option is the use of BH3 mimetics, such as ABT-737 [31]. Here we showed that ABT-737 substantially enhanced gefitinib-induced apoptosis in all of the NSCLC cells tested, albeit most prominently in those harboring the EGFR activating mutations. This activity is reminiscent of the ability of ABT-737 to increase imatinib-induced apoptosis of BCR-ABL transformed cells [34]. We are currently assessing the efficacy of these combinations in suitable in vivo models in an attempt to inform subsequent clinical trials. In conclusion, our results demonstrate that BIM is essential for gefitinib-induced killing of NSCLC cells expressing mutant EGFR. Shutdown of the MEK–ERK1/2 pathway appears critical for BIM up-regulation, but other signaling pathways may also contribute. Finally, we have shown that combining gefitinib with BH3 mimetics, such as ABT-737, may be a potent strategy for enhancing the currently suboptimal clinical responses seen in NSCLC. Supporting Information Figure S1 Mechanism of Apoptosis Induced in H3255 Cells after Gefitinib Treatment (A) H3255 NSCLC cells were left untreated (NT) or treated with 1 μM gefitinib (Gef) or for 18 h. Cells were then harvested, lysed and Western blotted for PARP. (B and C) H3255 cells were left untreated or incubated for 30 min with the caspase inhibitor QVD-OPH (25 μM) prior to the addition of gefitinib, and cell samples were assessed for cell death at 16 h or 24 h by Annexin V-FITC plus PI staining and flow cytometric analysis. Flow cytometry data from a representative experiment (B); mean ± standard deviation of three independent experiments (C). (D and E) H3255 cells were left untreated (NT) or incubated for 30 min with QVD-OPH prior to the addition of gefitinib (Gef, 1μM) and cell samples assessed for BAX activation by flow cytometry at 16 or 24 h (D) or by subcellular localization (E) at 18 h assessing membrane (M) and cytosolic (C) compartments. Each fraction was assessed by Western blotting for cytochrome c, BAX, BAK, and HSP70 (the latter as a loading control). (569 KB JPG) Click here for additional data file. Figure S2 BIM but not PUMA, BAX, or BAK Is Induced after Gefitinib Treatment in H3225 Cells and Is Coincident with PARP Cleavage H3255 cells were treated with 1 μM gefitinib for 5–15 h and the cells harvested, lysed and assessed by Western blotting for expression of PARP, PUMA, BIM, BAK, BAX, and actin (loading control). (156 KB JPG) Click here for additional data file. Figure S3 Kinetics of BIM Induction after Gefitinib Treatment in HCC827 Cells Bim is induced after gefitinib treatment in HCC827 cells and is coincident with ERK dephosphorylation. HCC827 cells were treated with 1 μM gefitinib for 2–28 h and the cells harvested, lysed and assessed by Western blotting for expression of BIM, pERK, and actin (loading control). (119 KB JPG) Click here for additional data file. Figure S4 Effect of Gefitinib on NSCLC Cells H358 and H441 cells expressing WT EGFR or H1975 cells expressing L858R and T790M mutant EGFR were left untreated (NT) or treated for 24 h with gefitinib (10, 2, 0.4, 0.08 μM) or DMSO (D). The cells were then assessed by Western blotting for the phosphorylation status of ERK1/2 and the level of BIM and actin (loading control). (234 KB JPG) Click here for additional data file. Figure S5 BIM but Not PUMA mRNA Is Induced after Gefitinib Treatment in NSCLC Cells Expressing Mutant EGFR NSCLC cells were treated with 1 μM gefitinib for 2, 6, or 24 h (H3255) or 24 h only (H1650). The cells were then harvested, total RNA isolated and converted to cDNA. Semiquantitative PCR (A) or quantitative PCR (B and C) analysis was then performed to determine the levels of BIM or PUMA. Bars represent the mean ± standard deviation of three independent experiments. (410 KB JPG) Click here for additional data file. Figure S6 Inhibition of EGFR Results in the Up-regulation and Dephosphorlyation of BIM but Not BAD in H3225 Cells H3255 cells were left untreated (NT) or were treated with inhibitors of EGFR (1 μM gefitinib) for times ranging from 1 min to 16 h. The cells were then harvested, lysed and assessed by Western blotting for phosphorylated ERK1/2 (pERK1/2), BIM, phosphorylated BAD136, phosphorylated BAD112, total BAD, PARP, BCL-xL, or actin (loading control). (A) The rapid kinetics of pERK loss and coincident decrease in BIM mobility on SDS-PAGE, indicative of dephosphorylation. (B) The phosphorylation status of BAD and induction of BIMEL and BIML over a 16 h time course. These data show that BAD136 but not BAD112 is dephosphorylated after 16 h treatment with gefitinib, coincident with PARP cleavage. (379 KB JPG) Click here for additional data file.

0 comments Cited 90 times – based on 0 reviews      Review now

Bookmark

All references

Author and article information

Contributors

Ping Liu:

ORCID: http://orcid.org/0000-0002-2899-3732

liuping3600@csu.edu.cn

Journal

Journal ID (nlm-ta): J Cell Mol Med

Journal ID (iso-abbrev): J. Cell. Mol. Med

Journal ID (doi): 10.1111/(ISSN)1582-4934

Journal ID (publisher-id): JCMM

Title: Journal of Cellular and Molecular Medicine

Publisher: John Wiley and Sons Inc. (Hoboken )

ISSN (Print): 1582-1838

ISSN (Electronic): 1582-4934

Publication date (Electronic): 30 January 2019

Publication date (Print): April 2019

Volume: 23

Issue: 4 ( doiID: 10.1111/jcmm.2019.23.issue-4 )

Pages: 2431-2441

Affiliations

[ ¹ ] Department of Oncology The Second Xiangya Hospital Central South University Changsha Hunan China

Author notes

[*] [* ] Correspondence

Ping Liu, Department of Oncology, The Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, China.

Email: liuping3600@ 123456csu.edu.cn

Author information

Ping Liu http://orcid.org/0000-0002-2899-3732

Article

Publisher ID: JCMM14086

DOI: 10.1111/jcmm.14086

PMC ID: 6433677

PubMed ID: 30701693

SO-VID: fcb1d568-00a8-4f14-964e-f54afffd92fc

License:

This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

History

Date received : 05 February 2018

Date revision received : 20 August 2018

Date accepted : 17 November 2018

Page count

Figures: 6, Tables: 1, Pages: 11, Words: 6264

Custom metadata

source-schema-version-number 2.0

component-id jcmm14086

cover-date April 2019

details-of-publishers-convertor Converter:WILEY_ML3GV2_TO_NLMPMC version:5.6.1 mode:remove_FC converted:25.03.2019

ScienceOpen disciplines: Molecular medicine

Keywords: apoptosis,gefitinib resistance,mir‐345 and mir‐498,nsclc,tms

Data availability:

ScienceOpen disciplines: Molecular medicine

Keywords: apoptosis, gefitinib resistance, mir‐345 and mir‐498, nsclc, tms

Comments

Comment on this article

scite_

Cited by 14

See all cited by

Most referenced authors 386

See all reference authors

Trans‐3,5,4´‐trimethoxystilbene reduced gefitinib resistance in NSCLCs via suppressing MAPK/Akt/Bcl‐2 pathway by upregulation of miR‐345 and miR‐498

Read this article at

Abstract

Related collections

Network and Systems Medicine

Most cited references 27

Acquired Resistance of Lung Adenocarcinomas to Gefitinib or Erlotinib Is Associated with a Second Mutation in the EGFR Kinase Domain

Clinical definition of acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors in non-small-cell lung cancer.

Gefitinib-Induced Killing of NSCLC Cell Lines Expressing Mutant EGFR Requires BIM and Can Be Enhanced by BH3 Mimetics

Author and article information

Contributors

Journal

Affiliations

Author notes

Author information

Article

History

Page count

Categories

Custom metadata

Comments

Comment on this article

Similar content 111

Cited by 14

Most referenced authors 386