13
views
0
recommends
+1 Recommend
1 collections
    0
    shares
       
      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      A clustered regularly interspaced short palindromic repeats knockout method to reveal methyl-CpG binding domain 4 function

      Preprint
      In review
      research-article
        1 ,
      ScienceOpen Preprints
      ScienceOpen
      Bookmark

            Abstract

            DNA methylation is an epigenetic mechanism tailored for DNA repression, engineered for regulating genetic expression without direct manipulation of the nucleotide sequence. One component of this process includes methyl-binding proteins (MBD), which have an affinity for methyl groups, and they competitively inhibit transcription factors from binding with genetic promoters. Interestingly, MBD4 is unique because, as opposed to transcriptional repression, it promotes gene repair & demethylation and is associated with various methylation-related diseases, such as Autism. By further studying MBD4, we can identify a potential therapeutic target for MRD and further understand the role of methylation on the epigenome in regards to seasonal plasticity. Therefore, this paper describes a CRISPR Knockout screen to isolate & repress MBD4 from its customary functionality with gRNA targets GGAAGGGGGUGCUUGUGAUG and GGAAGGGGGTGCTTGTGATGTGG in Astatotilapia burtoni Cichlid. I expect a morphological change in the Cichlid’s skin color (such change can be identified with computer vision COCO-Style-Dataset-Generator-GUI), which substantiates our belief that MBD4 does, in fact, play a significant role in seasonally-regulated epigenetic switches and can be targeted in methylation treatments. However, the exogenous factors relating to MBD4’s role in methylation remain to be investigated.

            Content

            Author and article information

            Journal
            ScienceOpen Preprints
            ScienceOpen
            12 November 2022
            Affiliations
            [1 ] Bronx High School of Science
            Author notes
            Article
            10.14293/S2199-1006.1.SOR-.PPRDUYU.v1
            5d5a4e96-81d9-467f-88c3-543cee88e161

            This work has been published open access under Creative Commons Attribution License CC BY 4.0 , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Conditions, terms of use and publishing policy can be found at www.scienceopen.com .


            Data sharing not applicable to this article as no datasets were generated or analysed during the current study.
            Life sciences

            Comments

            Comment on this article