3,053
views
1
recommends
+1 Recommend
1 collections
    4
    shares

      Acta Materia Medica now indexed by SCOPUS from May 2024. Interested in becoming an AMM published author?

      • Platinum Open Access with no APCs.
      • Fast peer review/Fast publication online after article acceptance.

      Check out the call for papers on our website https://amm-journal.org/index.php/2023/04/26/acta-materia-medica-call-for-papers-2/

      scite_
       
      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      STING agonist delivery by lipid calcium phosphate nanoparticles enhances immune activation for neuroblastoma

      Published
      research-article

            Abstract

            Neuroblastoma (NB) is a common solid tumor in children and infants, the formation and regression of which is closely linked to the tumor-host immune relationship. Stimulator of interferon genes (STING) agonists, particularly cyclic dinucleotide (CDN), have promising potential in NB therapy by generating innate and adaptive immune stimulation, thus leading to tumor control. CDN delivery in vivo is challenging due to the negative charge, hydrophilicity, and susceptibility to degradation by phosphodiesterase, which hinders the effectiveness of CDN. Thus, our study proposed four methods to load CDN into liposomes, using 2′,3′-cGAMP as the model drug. Lipid nanoparticles were prepared, followed by physicochemical characterization. Subsequently, cellular inhibition and immune stimulation were investigated. As a result, lipid calcium phosphate nanoparticles (LCP-NPs) possessed the highest encapsulation efficiency among the four preparation methods, with a diameter of 82.57±3.72 nm. LCP-NPs maintained size stability under refrigeration conditions at 4°C within 48 h. The surface of the liposome was positively charged. Compared to free cGAMP, LCP-NPs resulted in a slower release, enhanced cytotoxicity against tumor cells, greater activation of the cGAS-STING pathway, and increased expression of the immune factors. Taken together, these findings clearly demonstrated the effectiveness of the liposomal delivery system for cGAMP and provided a promising strategy for the treatment of NB.

            Main article text

            1. INTRODUCTION

            Neuroblastoma (NB) is one of the most common extracranial solid tumors in children and infants. NB occurs in approximately 25-50 cases per million and accounts for 10%-20% of pediatric malignancy deaths [1]. High-risk NB (HRNB) is diagnosed when MYCN amplification is greater than stage 1 or age ≥ 18 months with stage 4 disease. Approximately 50% of NB cases are classified as HRNB [2]. The MYCN gene is a critical regulator of cell growth and proliferation. Amplification of MYCN is a common genetic alteration in NB that is associated with poor prognosis, advanced disease stage, aggressive tumor behavior, and poor patient outcomes [3].

            Treatment of NB involves three phases: induction; consolidation; and maintenance therapy. Treatment options include chemotherapy, surgery, high-dose chemotherapy with autologous stem cell rescue, radiotherapy, and immunotherapy [4]. Low- and intermediate-risk patients have a 5-year survival rate of 85%-90% [5]; however, high-risk patients have a significantly lower 5-year survival rate, averaging 50% [6]. Most HRNB patients relapse and die of drug-resistant disease despite initial chemotherapy [4]. Therefore, new treatment options are urgently needed for HRNB patients.

            Various immunotherapies have shown promise for treating NB, but T-cell infiltration in the tumor microenvironment (TME) remains a challenge for effective treatment [7]. Although immune checkpoint blocking (ICB) antibodies targeting PD-L1 have shown efficacy for low- and intermediate-risk NB, the effectiveness is limited for high-risk cases due to the lack of T-cell infiltration in the TME [8]. Monoclonal antibody (mAb) therapy targeting disialoganglioside (GD2), which is overexpressed on NB cells, has been shown to improve the prognosis of NB patients [9]; however, despite this improvement, the 5-year survival rate for HRNB remains < 50% [10]. New immunotherapy approaches are being researched to address these challenges.

            Stimulator of interferon genes (STING) agonists have captured wide attention with respect to immunotherapy of NB. Notably, the STING agonist response is not dependent on T cells within the TME [5]. Microbial-released DNA or DNA shed by dying tumor cells, or STING agonists are detected by intracellular DNA sensors, such as cyclic GMP-AMP synthase (cGAS), leading to activation of the STING signaling pathway in dendritic cells [6]. This results in phenotypic maturation. After activation, downstream signaling pathways, such as IRF3 and NF-κB, are activated, resulting in the production of type I interferons and other cytokines, such as CXCL10, which activate CD8+T cells through a cascade of events [4]. STING agonists stimulate antigen presentation by activating dendritic cells and promote T cell activation as well [6]. Previous studies have shown that STING agonists can be used in NB immunotherapy. Lihong Wang-Bishop et al. [4] reported that STING-NPs incorporating PEG-DBP co-polymer inhibit the growth of mouse MB, extend survival, and induce immune memory to prevent tumor recurrence [4]. As a result, STING agonists exhibit great promise for the treatment of NB.

            The main challenge in the use of STING agonists involves the in vivo delivery. For example, CDN is a negatively-charged hydrophilic small molecule that limits entry of STING agonists into the cytoplasm. CDN is easily degraded and inactivated by ectonucleotide pyrophosphatase/phosphodiesterase, which adversely affects its efficacy. To overcome these problems, researchers have designed various CDN delivery systems based on biomaterials, such as cationic silica nanoparticles for local drug delivery [11] and poly (β-amino ester) polymer nanoparticles [12]. The clinical application of polymer nanoparticles, however, is limited based on the complex design and synthesis process, side effects induced by the added organic solvent, and insufficient biocompatibility [13].

            By way of comparison, liposomes can effectively entrap water-soluble molecules, improve drug stability, and reduce drug toxicity. Moreover, the industrial production technology for liposomes is much more mature, and various liposomal drug delivery systems have been approved for clinical use. For example, liposome-encapsulated doxorubicin hydrochloride (Doxil) was approved for marketing by the US Food and Drug Administration (FDA) for the first time in 1995, the safety of which has been extensively verified [14].

            We have developed a liposome delivery system for an active, natural, STING agonist (2′,3′-cGAMP) to improve cellular delivery efficiency. Specifically, we prepared liposomes loaded with 2′,3′-cGAMP by four methods: thin-film dispersion; ammonium sulfate gradient; calcium acetate gradient; and lipid calcium phosphate nanoparticle. Among these four methods, lipid calcium phosphate nanoparticles (LCP-NPs) achieved the highest encapsulation efficiency. Hence, more detailed physicochemical characterization was performed and in vitro experiments were conducted using LCP-NPs. LCP-NPs can maintain a stable particle size at 4°C for 48 h and the surface is positively charged. Compared with free cGAMP, LCP-NPs resulted in a slower release, enhanced cytotoxicity against tumor cells, greater activation of the cGAS-STING pathway, and increased expression of immune factors, such as CXCL9, TNF-α, and IFN-β. This study provides a perspective on the delivery of STING agonists.

            2. MATERIALS AND METHODS

            2.1 Materials

            The following materials were purchased for the current study: 2′,3′-cGAMP (MedChemExpress, Shanghai, China); Igepal (Shanghai Macklin Biochemical Co., Ltd., Shanghai, China); 1,2-dioleoyl-3-trimethylammoniumpropane, monochloride ([DOTAP]; Shanghai Kanglang Biotechnology Co., Ltd., Shanghai, China); 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy (polyethylene glycol)-2000] ([DSPE-PEG2000]; A.V.T. Pharmaceutical Co., Ltd., Shanghai, China); Na2HPO4, (NH4)2SO4, CaCL2, egg phosphatidylcholine (EPC), cholesterol, and the Cell Counting Kit-8 [CCK8] (Solarbio Technology Co., Ltd., Beijing, China); TRIeasy™ Total RNA Extraction Reagent, Hifair® III 1st Strand cDNA Synthesis SuperMix for qPCR, and Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix (Yeasen Biotechnology Co., Ltd., Shanghai, China); fetal bovine serum ([FBS]; PAN-Biotech GmbH, Adenbach, Germany); and Quanti-Blue™ Solution (InvivoGen, San Diego, CA, USA).

            2.2 Preparation of cGAMP liposomes using four different methods
            2.2.1 Thin-film dispersion method

            The recipe ingredients were accurately weighed and added to an eggplant-shaped bottle, followed by the addition of an appropriate amount of chloroform to ensure full dissolution. The solvent was then removed via rotary evaporation under reduced pressure at a 40°C water bath to produce a homogeneous film. Next, 330 μL of the aqueous cGAMP solution was added and the mixture was vigorously vortexed. The drug was loaded in a water bath at 70°C for 1 h. The mixture was ultrasonicated for 4 min until a light blue opalescence appeared. The obtained nanoparticles were abbreviated as TFD-NPs.

            2.2.2 Ammonium sulfate gradient method

            The recipe materials were accurately weighed and placed into an eggplant-shaped bottle. Chloroform was added to dissolve the materials, and the solvent was evaporated under reduced pressure in a 40°C water bath to form a uniform film. The film was hydrated with 1 mL of aqueous ammonium sulfate solution (120 mmol/L), followed by vortexing and ultrasound treatment until a light blue opalescence appeared. After cooling to room temperature, free ammonium sulfate was removed via a Sephadex G-50 gel column to obtain blank liposomes. The liposomes were then mixed with 330 μL of a cGAMP aqueous solution and loaded in a water bath at 70°C for 1 h. After the solution was cooled to room temperature, the free cGAMP was removed via a Sephadex G-50 gel column to obtain cGAMP-liposomes. The obtained nanoparticles were referred to as ASG-NPs.

            2.2.3 Calcium acetate gradient method

            Each recipe ingredient was accurately weighed and added to an eggplant-shaped bottle. Chloroform was added to achieve full dissolution, and the resulting solution was evaporated under reduced pressure in a 40°C water bath to form a uniform film. Next, a 130 mmol/L calcium acetate aqueous solution (adjusted to pH = 6 with glacial acetic acid) was added, followed by vortexing and hydration at 70°C for 15 min. The mixture was ultrasonicated for 4 min until a light blue opalescence appeared. Free calcium acetate was removed via a Sephadex G-50 gel column to obtain blank liposomes, which were then mixed with 330 μL of a cGAMP aqueous solution. The drug was loaded in a water bath at 70°C for 1 h. After the solution was cooled to room temperature, the free cGAMP was removed via a Sephadex G-50 gel column to obtain cGAMP-liposomes. The nanoparticles are abbreviated as CAG-NPs.

            2.2.4 Lipid calcium phosphate nanoparticle method

            Na2HPO4 (300 μL) was meticulously added to a mixture with 15 mL of cyclohexane/Igepal (71:29), followed by the addition of 200 μL of DOPA. The resulting mixture was sonicated to obtain the Na2HPO4 phase microemulsion. Similarly, 300 μL of CaCl2 containing cGAMP was added to 15 mL of cyclohexane/Igepal (71:29) mixture and sonicated. After the ultrasound, the CaCl2 phase microemulsion was obtained. The two-phase microemulsion was thoroughly mixed for 20 min. To break the demulsification, 30 mL of absolute ethanol was added. The mixture was then centrifuged at 16,000 g for 20 min and washed 2-3 times with ethanol. The resulting CaP pellets were dissolved in 1 mL of chloroform for later use. The recipe ingredients were meticulously weighed and mixed with the CaP-core, then the chloroform was evaporated at 40°C. Tris-HCl buffer was added, followed by ultrasonication for 4 min to obtain cGAMP-liposomes, which were named LCP-NPs [1517]. The formulations for all four methods are presented in Table 1 .

            Table 1 |

            Preparation recipes for different methods.

            FormulationDOTAP (mg)EPC (mg)Cholesterol (mg)DSPE-PEG2000 (mg)
            TFD-NPs16.931.07
            ASG-NPs16.931.07
            CAG-NPs16.931.07
            LCP-NPs3.721.934.2
            2.3 Particle size and zeta potential analysis

            The prepared liposomes were subjected to dynamic light scattering (DLS) analysis. Particle size and polydispersity were determined using an NKT-N9 nanoparticle size analyzer (NKT, Shandong Province, China). The wavelength of the NKT-N9 laser beam was set at 633 nm. The refractive index was 1.33. The polydispersity indicated the uniformity of particle size, and the smaller the polydispersity, the more uniform were the particles. Zeta potential was determined using a Malvern Zetasizer Nano ZS instrument (Worcestershire, England). The wavelength of the instrument laser beam was set at 633 nm. The angle between the incident and scattered beams was 90°. Each sample was measured for 15 cycle times, and the measurement temperature was set at 25°C.

            2.4 Determination of liposome encapsulation efficiency

            The content of the drug was determined by HPLC (Shimadzu, Kyoto, Japan). The liposomes were acurrately aspirated, then destroyed by adding 1% Triton X-100 solution, and depolymerized by vortexing to release the encapsulated cGAMP. The content of cGAMP was determined using reverse-phase HPLC. The following chromatographic conditions were used in the analysis: Agilent Zorbax SB-C18 column (4.6 × 250 mm, 5 μm; Little Falls Wilmington, DE, USA) with a detection wavelength of 260 nm; mobile phase, phase A (50 mM TEAA, pH=7.2) and phase B (Acetonitrile); and column temperature, 30°C. The gradient elution process was as follows [18, 19]:

            Time/min020232535
            A Mobile phase1008760100100
            B Mobile phase0134000
            2.5 Particle size stability of liposomes

            The prepared liposomes were placed at 4°C for observation and photography within 48 h after preparation. The stability of the liposomes was investigated by measuring the particle size and polydispersity coefficient of the liposomes.

            2.6 Microscopy characterization and in vitro release of LCP-NPs

            The surface morphology of LCP-NPs was characterized by transmission electron microscopy ([TEM], JEM 2100; JEOL, Kyoto, Japan) after negative staining with 1% uranyl acetate solution at an accelerating voltage of 80 kV.

            Free cGAMP or LCP-NP were added to activated dialysis bags (MWCO3500; BioDee, Beijing, China) for the in vitro release experiment. These bags were then placed into a conical flask containing the appropriate amount of release medium and shaken at a constant temperature of 37°C and 100 rpm/min using an oscillator. At specific time points (0.5, 1, 2, 3, 4, 5, 6, 8, 10, and 24 h), 150 μL of the release solution was collected. Fresh release medium (150 μL) was added to the conical flask after each sampling and the mixture was continued to to be shaken. After 24 h, the dialysis clips clamped at both ends of the dialysis bag were loosened, and a sample was obtained after stirring for an additional 30 min. The cGAMP content was determined using reverse-phase HPLC and the cumulative drug release rate was calculated.

            2.7 CCK8 assay of LCP-NPs

            NB neuro-2a cells were seeded at a density of 1×105 cells/mL in 96-well plates (100 μL per well). To maintain a humid environment, 200 μL of PBS was added to the surrounding wells. Neuro-2a cells were placed in an incubator and cultured overnight. The culture medium was aspirated, and 200 μL of drug-containing serum-free medium was added to each well. The plate was then incubated for 8 h with different concentrations of the drug (0.5, 1, 5, 10, 50, and 100 μM). After removing the medium, 100 μL of the serum-free medium was added to each well, followed by 10 μL of CCK8 solution. The plates were incubated for 1 h in the incubator, and the absorbance at 450 nm was measured using a Spectra MAX 190 microplate reader (Molecular Devices, Sunnyvale, CA, USA). Cell viability and the IC50 were calculated based on the results.

            2.8 Evaluation of cGAS-STING pathway activation in reporter cells

            RAW Blue ISG cells were seeded in 96-well plates. A series of drug concentration gradients were set to 0.1, 0.5, 1, 3, 10, and 30 μM. After adherence, the cells were incubated with LCP-NPs and free cGAMP for 2 h. After the incubation, the drug was discarded and replaced with a serum-containing medium for 22 h to generate secreted embryonic alkaline phosphatase (SEAP). To assess SEAP activity, 50 μL of cell supernatant from each well was transferred into a new 96-well plate. Then, 150 μL of Quanti-Blue™ Solution was added to each well, followed by incubation at 37°C in an incubator. After color development, the absorbance of the supernatant at 620 nm was measured using a microplate reader [20].

            2.9 Gene expression analysis

            RT-qPCR was used to determine the expression of the immune factors in DC2.4 cells treated with different nanoparticle preparations [6]. DC2.4 cells were homogeneously seeded in 6-well plates and incubated overnight. The LCP-NPs and free cGAMP were diluted to 1 μg/mL in serum-free medium and the cells were treated for 6 h. Cellular mRNA was extracted according to the TRIeasy™ Total RNA Extraction Reagent instructions. The RNA concentration was determined using NanoDrop2000 (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription was performed to synthesize cDNA using Hifair® III 1st Strand cDNA Synthesis SuperMix for qPCR according to the manufacturer’s instructions. Real-Time Quantitative PCR (RT-qPCR) was performed using an ABI 7500 Real-Time PCR (Applied Biosystems, Inc., Foster City, CA, USA). GAPDH was used as an internal reference. The relative expression changes were calculated using the ΔΔCt method [21, 22]. The primer sequences were as follows:

            mmu-Gapdh-FAGGTCGGTGTGAACGGATTTG
            mmu--Gapdh-RTGTAGACCATGTAGTTGAGGTCA
            mmu-CXCL9-FGGAGTTCGAGGAACCCTAGTG
            mmu-CXCL9-RGGGATTTGTAGTGGATCGTGC
            mmu-TNF-α-FCCCTCACACTCAGATCATCTTCT
            mmu-TNF-α-RGCTACGACGTGGGCTACAG
            mmu-IFN-β-FCAGCTCCAAGAAAGGACGAAC
            mmu-IFN-β-RGGCAGTGTAACTCTTCTGCAT
            2.10 Statistical analysis

            All data subjected to statistical analysis were obtained from at least three parallel experiments. Multiple groups were analyzed using GraphPad software. A p-value ≤0.05 was considered statistically significant.

            3. RESULTS AND DISCUSSION

            3.1 Characterization of physicochemical properties of four liposomes

            The high hydrophilicity of cGAMP presents challenges when formulating cGAMP into liposomes, such as suboptimal drug encapsulation efficiency and variable drug release kinetics [23]. In addition, the size and distribution of liposomes can be influenced by the preparation method. To address these challenges, we evaluated four different methods for formulating cGAMP-loaded liposomes, with the goal of identifying the optimal method for achieving high-drug encapsulation efficiency. The methods tested included the thin-film dispersion, ammonium sulfate gradient, calcium acetate gradient, and lipid calcium phosphate nanoparticle methods. The corresponding obtained nanoparticles were abbreviated as TFD-NPs, ASG-NPs, CAG-NPs, and LCP-NPs, respectively. As shown in Figure 1 , the liposomes prepared by these four methods were translucent and slightly blue-opalescent.

            Figure 1 |

            Appearance of liposomes prepared by four methods (left-to-right): TFD-NPs; ASG-NPs; CAG-NPs; and LCP-NPs.

            The particle size and zeta potential analysis are shown in Table 2 and Figure 2 . The particle sizes of TFD-NPs and LCP-NPs were between 80 and 100 nm. The particle sizes of ASG-NPs and CAG-NPs were between 100 and 120 nm with a dispersibility < 0.200 and good preparation reproducibility. The zeta potential of ASG-NPs and CAG-NPs was negative, which might oppose cellular uptake due to the electrostatic repulsion to the cell membrane.

            Table 2 |

            Particle size, zeta potential, and encapsulation efficiency analysis.

            NanoparticlesSize (nm)PDIZeta (mV)Encapsulation efficiency (%)
            TFD-NPs85.54 ± 3.860.139 ± 0.0258.1 ± 17.313.63 ± 1.02
            ASG-NPs119.07 ± 5.340.060 ± 0.01-19.7 ± 6.85.84 ± 0.78
            CAG-NPs102.35 ± 4.620.071 ± 0.01-24.7 ± 11.69.15 ± 0.92
            LCP-NPs82.57 ± 3.720.157 ± 0.0315.9 ± 4.321.24 ± 1.28
            Figure 2 |

            Particle size distribution of STING agonist-loaded liposomes.

            (a) TFD-NPs. (b) ASG-NPs. (c) CAG-NPs; (d) LCP-NPs.

            Liposome encapsulation efficiencies are listed in Table 2 . Water-soluble small molecules, such as 2′,3′-cGAMP (solubility of 50 mg/mL), generally exhibit a lower encapsulation efficiency because water-soluble small molecules leak out of the liposomes due to high solubility in water [24]. LCP-NPs had the highest encapsulation among the four methods. As shown in Figure 3 , a pH-sensitive calcium phosphate (CaP) core was prepared using the lipid calcium phosphate nanoparticle method. In this study stable CaP cores were prepared using a water/oil microemulsion. The CaP cores were coated with an inner layer of DOPA and an outer layer of cationic lipids, DOTAP, cholesterol, and DSPE-PEG, thus forming a hollow spherical structure with a lipid bilayer. The hollow structure of the CaP core, which was formed in water droplets provides an opportunity to capture water-soluble drugs, at least in part. The lipid coating prevented the CaP core from aggregating during the centrifuge separation step and made it soluble in chloroform. After adding the outer lipid layer, the chloroform was evaporated, and finally the lipid bilayer was self-assembled in an aqueous solution.

            Figure 3 |

            Preparation outline for LCP-NPs and corresponding lipid bilayer structure.

            CaP-core with GAMP was obtained, followed by lipid addition to prepare LCP-NPs. LCP-NPs: lipid calcium phosphate nanoparticles.

            It has been reported that the LCP-NP method has been used for the encapsulation of nucleic acid drugs in vivo. cGAMP is a small molecule of the cyclodinucleic acid class. This experiment demonstrated the feasibility of LCP-NP for the encapsulation of cGAMP.

            Next, we investigated the particle size stability of liposomes at different time points after formulation. The results are shown in Figure 4 . Under storage conditions of 4°C for 48 h, the appearance of the solution remained unchanged, appearing as a clear, milky blue solution and the particle size of the liposomes remained stable. Predictably, liposomes remain stable during the subsequent cell experiments in which drug treatments were carried out within 48 h.

            Figure 4 |

            Particle size stability of STING agonist-loaded liposomes under refrigeration (4°C) for 48 h.

            (a) TFD-NPs. (b) ASG-NPs. (c) CAG-NPs. (d) LCP-NPs.

            3.2 Microscopic characterization and in vitro release of LCP-NPs

            LCP-NPs had good physicochemical properties and the encapsulation efficiency of LCP-NPs was the highest among the four liposomes. LCP-NPs were selected for detailed morphologic and in vitro release studies. The TEM photograph in Figure 5a shows that LCP-NPs are spherical and the particle size results are similar to those determined by DLS. The in vitro release curve is shown in Figure 5b . The free cGAMP solution released approximately 70% within 0.5 h, whereas LCP-NPs released approximately 50%. In contrast, LCP-NPs had a sustained-release effect. The cumulative release of LCP-NPs was 80% within 24 h.

            Figure 5 |

            (a) Transmission electron microscopy image. (b) The release profile of cGAMP from free cGAMP or LCP-NPs.

            The preparations were added to dialysis bags and released in PBS at 37°C. The cGAMP content in the release medium was periodically measured by HPLC.

            3.3 Cytotoxicity of LCP-NPs

            Given the previous literature reports, it has been documented that STING agonists exhibit immunomodulatory effects at low concentrations, while at high concentrations STING agonists induce tumor cell death [25]. Our objective was to comprehensively investigate the immunomodulatory properties of LCP-NPs and the potential for inhibiting cell growth. Therefore, we examined the formulation inhibitory effects on neuro-2a cell growth at various concentrations. Our experimental findings showed a dose-dependent inhibitory effect of the free cGAMP and LCP-NPs on neuro-2a cell growth, which was consistent with tumor cell growth inhibition. The IC50 of the LCP-NPs was 2.16 μM and the IC50 of the free cGAMP solution was 16.98 μM. Calcium phosphate and DOTAP have been generally considered to be safe [26, 27]. We therefore speculated that the increased neuro-2a cell cytotoxicity of LCP-NPs compared to free cGAMP was due to increased cellular uptake of cGAMP, and likely resulted from the electrostatic interactions onthe surface of LCP-NPs [28]. According to Wang-Bishop [4], STING agonists directly activate caspase-3 in neuro-2a cells and induce tumor cell death. Additionally, Sokolowska [29] highlighted the complexity of the STING pathway in cancer cells; specifically, the response of tumor cells to STING activation might exhibit inhibitory or growth-promoting effects. There is currently no consensus on whether STING activation in cancer cells leads to cell death, necessitating further study to determine the impact of STING activation on cancer cell viability.

            3.4 cGAS-STING pathway activation by LCP-NPs

            To explore the effect of nanoparticle formulations in stimulating type I interferon production, RAW-Blue ISG cells were used to investigate the impact of LCP-NPs on the cGAS-STING pathway because macrophages have a crucial role in cGAMP-mediated antitumor activity in the TME and secrete reporter SEAP upon stimulation of the cGAS-STING pathway by cGAMP. SEAP reacts with Quanti-Blue™ Solution to indicate the level of cGAS-STING pathway activation through a colorimetric assay, where a higher absorbance corresponds to an increased production of SEAP and a stronger activation of the cGAS-STING pathway. Figure 7 illustrates the dose-dependent effect of LCP-NPs on cGAS-STING pathway activation in RAW-Blue ISG. LCP-NPs effectively activate the cGAS-STING pathway in RAW-Blue ISG cells in a dose-dependent manner. Increasing concentrations of LCP-NPs led to a stronger activation of the cGAS-STING pathway. The inability of free cGAMP to activate the cGAS-STING pathway may be due to its limited cellular uptake. LCP-NPs, possessing a positively charged surface, readily penetrate into cells and trigger cGAS-STING pathway activation, as shown in Scheme 1 [28].

            Figure 6 |

            Cytotoxic effect of LCP-NPs on neuro-2a cells.

            Growth inhibition was assessed using a CCK8 assay after 8 h of incubation. Each value represents the mean ± SD (n = 6).

            Figure 7 |

            Dose-response curves of cGAMP preparations on RAW-Blue ISG cells.

            Reporter enzyme production was measured in response to cGAMP stimulation, indicating activation of the cGAS-STING pathway. Each value represents the mean ± SD (n = 3).

            Scheme 1 |

            The schematic diagram of LCP-NPs entering antigen-presenting cells (APCs) and enhancing immune stimulatory effects.

            3.5 Immune factor expression

            It has previously been reported that cGAMP activates the cGAS-STING pathway of APCs, resulting in increased expression of downstream immune factors. In this study we measured the levels of immune factor mRNA expression to further demonstrate the activation of the cGAS-STING pathway by LCP-NPs. After incubating DC2.4 cells with LCP-NPs or free drugs, the expression of immune factors was evaluated using RT-qPCR. The results are shown in Figure 8 . Compared to free cGAMP, LCP-NPs were shown to significantly upregulate the expression of several immune factors, such as CXCL9, TNF-α, and IFN-β. Specifically, LCP-NPs resulted in an 8-fold increase in CXCL9 expression, a 77-fold increase in TNF-α expression, and a 5-fold increase in IFN-β expression. CXCL9 is the key to recruiting effector T cells into tumors. TNF-α is a cytokine that induces rapid destruction of tumor blood vessels after STING agonist is delivered to tumors [21]. IFN-β is essential for the generation of anti-tumor T cell responses. As Scheme 1 depicts, these findings suggest that LCP-NPs effectively deliver cGAMP into the cytoplasm of cells. After LCP-NPs enter cells, the STING agonist released into the cytoplasm enhances the activation of the cGAS-STING pathway in APCs, causing APCs to produce type I interferon and other cytokines, and finally activate CD8+T cells.

            Figure 8 |

            Gene expression levels in DC2.4 cells treated with free cGAMP or LCP-NPs, respectively.

            Each value represents the mean ± SD (n = 3). *p<0.05, **p<0.01 and ***p<0.001.

            These results provide evidence for the potential use of LCP-NPs as an immunotherapeutic agent for the treatment of cancers. Corollary studies are warranted to assess the effectiveness and safety of LCP-NPs in vivo, as well as to determine the underlying mechanisms involved in the cGAS-STING pathway.

            4. CONCLUSIONS

            Liposomes are widely studied nanodrug carriers that are biocompatible and biodegradable. Liposomes effectively protect the encapsulated drugs from degradation and slowly release the drugs. In the current study, cGAMP-loaded liposomes were prepared using four different methods. Lipid calcium phosphate nanoparticles with the highest encapsulation efficiency was selected to perform detailed physicochemical characterization and cellular experiments. The obtained LCP-NPs exhibited ideal particle size and good stability. In vitro studies demonstrated that LCP-NPs increased cytotoxicity against neuro-2a cells, enhanced activation of the cGAS-STING pathway, and upregulated the expression of immune factors. These findings indicated the potential of LCP-NPs for the delivery of cGAMP. This system could provide a new prospect for NB immunotherapy. The in vivo effect is also worthy of further exploration.

            CREDIT AUTHOR STATEMENT

            Bo Feng and Dong Mei designed and conducted the experiments, analyzed and interpreted the data, and participated in writing the manuscript. Dong Mei, Libo Zhao, and Guangqin Zhang provided experimental materials and technical support, and contributed to experimental design and data analysis. Dong Mei and Xiao Lu were responsible for the overall project planning, design, experiment management, data analysis, and manuscript writing.

            DECLARATION OF COMPETING INTEREST

            All authors have reviewed and approved the final version of the manuscript.

            Citation Information

            REFERENCES

            1. Yang R, Zheng S, Dong R. Circulating Tumor Cells in Neuroblastoma: Current Status and Future Perspectives. Cancer Medicine. 2022. Vol. 12:7–19

            2. Dubois SG, Macy ME, Henderson TO. High-risk and Relapsed Neuroblastoma: Toward More Cures and Better Outcomes. American Society of Clinical Oncology Educational Book. 2022. Vol. 42:1–13

            3. Otte J, Dyberg C, Pepich A, Johnsen JI. MYCN Function in Neuroblastoma Development. Frontiers in Oncology. 2020. Vol. 10:624079

            4. Wang-Bishop L, Wehbe M, Shae D, James J, Hacker BC, Garland K, et al.. Potent STING Activation Stimulates Immunogenic Cell Death to Enhance Antitumor Immunity in Neuroblastoma. Journal for Immunotherapy of Cancer. 2020. Vol. 8:e000282

            5. Lu X, Cheng H, Xu Q, Tan X. Encapsulation of STING Agonist cGAMP with Folic Acid-Conjugated Liposomes Significantly Enhances Antitumor Pharmacodynamic Effect. Cancer Biotherapy and Radiopharmaceuticals. 2021.

            6. Wang M, Sooreshjani MA, Mikek C, Opoku-Temeng C, Sintim HO. Suramin Potently Inhibits cGAMP Synthase, cGAS, in THP1 Cells to Modulate IFN-β Levels. Future Medicinal Chemistry. 2018. Vol. 10:1301–1317

            7. Layer JP, Kronmüller MT, Quast T, van den Boorn-Konijnenberg D, Effern M, Hinze D, et al.. Amplification of N-Myc is Associated with a T-cell-poor Microenvironment in Metastatic Neuroblastoma Restraining Interferon Pathway Activity and Chemokine Expression. OncoImmunology. 2017. Vol. 6:e1320626

            8. Srinivasan P, Wu X, Basu M, Rossi C, Sandler AD. PD-L1 Checkpoint Inhibition and Anti-CTLA-4 Whole Tumor Cell Vaccination Counter Adaptive Immune Resistance: A Mouse Neuroblastoma Model that Mimics Human Disease. PLoS Medicine. 2018. Vol. 15:e1002497

            9. Sait S, Modak S. Anti-GD2 Immunotherapy for Neuroblastoma. Expert Review of Anticancer Therapy. 2017. Vol. 17:889–904

            10. Wienke J, Dierselhuis MP, Tytgat G, Künkele A, Nierkens S, Molenaar JJ. The Immune Landscape of Neuroblastoma: Challenges and Opportunities for Novel Therapeutic Strategies in Pediatric Oncology. European Journal of Cancer. 2021. Vol. 144:123–150

            11. An M, Yu C, Xi J, Reyes J, Mao G, Wei WZ, et al.. Induction of Necrotic Cell Death and Activation of STING in the Tumor Microenvironment via Cationic Silica Nanoparticles Leading to Enhanced Antitumor Immunity. Nanoscale. 2018. Vol. 10:9311–9319

            12. Wilson DR, Sen R, Sunshine JC, Pardoll DM, Green JJ, Kim YJ. Biodegradable STING Agonist Nanoparticles for Enhanced Cancer Immunotherapy. Nanomedicine. 2018. Vol. 14:237–246

            13. Zhou Q, Zhou Y, Li T, Ge Z. Nanoparticle-Mediated STING Agonist Delivery for Enhanced Cancer Immunotherapy. Macromolecular Bioscience. 2021. Vol. 21:e2100133

            14. Barenholz Y. Doxil(R)--the First FDA-approved Nano-drug: Lessons Learned. Journal of Controlled Release. 2012. Vol. 160:117–134

            15. Liu Y, Wang L, Song Q, Ali M, Crowe WN, Kucera GL, et al.. Intrapleural Nano-immunotherapy Promotes Innate and Adaptive Immune Responses to Enhance Anti-PD-L1 Therapy for Malignant Pleural Effusion. Nature Nanotechnology. 2022. Vol. 17:206–216

            16. Liu Y, Crowe WN, Wang L, Lu Y, Petty WJ, Habib AA, et al.. An Inhalable Nanoparticulate STING Agonist Synergizes with Radiotherapy to Confer Long-term Control of Lung Metastases. Nature Communications. 2019. Vol. 10:5108

            17. Li J, Yang Y, Huang L. Calcium Phosphate Nanoparticles with an Asymmetric Lipid Bilayer Coating for siRNA Delivery to the Tumor. Journal of Controlled Release. 2012. Vol. 158:108–114

            18. Ablasser A, Goldeck M, Cavlar T, Deimling T, Witte G, Röhl I, et al.. cGAS Produces a 2′-5′-linked Cyclic Dinucleotide Second Messenger that Activates STING. Nature. 2013. Vol. 498:380–384

            19. Gao J, Tao J, Liang W, Zhao M, Du X, Cui S, et al.. Identification and Characterization of Phosphodiesterases that Specifically Degrade 3′3′-cyclic GMP-AMP. Cell Research. 2015. Vol. 25:539–550

            20. Koshy ST, Cheung AS, Gu L, Graveline AR, Mooney DJ. Liposomal Delivery Enhances Immune Activation by STING Agonists for Cancer Immunotherapy. Advanced Biology. 2017. Vol. 1:1600013

            21. Chin EN, Yu C, Vartabedian VF, Jia Y, Kumar M, Gamo AM, et al.. Antitumor Activity of a Systemic STING-activating Non-nucleotide cGAMP Mimetic. Science. 2020. Vol. 369:993–999

            22. Li S, Luo M, Wang Z, Feng Q, Wilhelm J, Wang X, et al.. Prolonged Activation of Innate Immune Pathways by a Polyvalent STING Agonist. Nature Biomedical Engineering. 2021. Vol. 5:455–466

            23. Wehbe M, Wang-Bishop L, Becker KW, Shae D, Baljon JJ, He X, et al.. Nanoparticle Delivery Improves the Pharmacokinetic Properties of Cyclic Dinucleotide STING Agonists to Open a Therapeutic Window for Intravenous Administration. Journal of Controlled Release. 2021. Vol. 330:1118–1129

            24. Eloy JO, Claro DSM, Petrilli R, Barcellos JP, Lee RJ, Marchetti JM. Liposomes as Carriers of Hydrophilic Small Molecule Drugs: Strategies to Enhance Encapsulation and Delivery. Colloids and Surfaces B: Biointerfaces. 2014. Vol. 123:345–363

            25. Chandra D, Quispe-Tintaya W, Jahangir A, Asafu-Adjei D, Ramos I, Sintim HO, et al.. STING Ligand c-di-GMP Improves Cancer Vaccination Against Metastatic Breast Cancer. Cancer Immunology Research. 2014. Vol. 2:901–910

            26. Sun M, Dang UJ, Yuan Y, Psaras AM, Osipitan O, Brooks TA, et al.. Optimization of DOTAP/chol Cationic Lipid Nanoparticles for mRNA, pDNA, and Oligonucleotide Delivery. AAPS PharmSciTech. 2022. Vol. 23:135

            27. Bisht S, Bhakta G, Mitra S, Maitra A. pDNA Loaded Calcium Phosphate Nanoparticles: Highly Efficient Non-viral Vector for Gene Delivery. International Journal of Pharmaceutics. 2005. Vol. 288:157–168

            28. Su T, Zhang Y, Valerie K, Wang XY, Lin S, Zhu G. STING Activation in Cancer Immunotherapy. Theranostics. 2019. Vol. 9:7759–7771

            29. Sokolowska O, Nowis D. STING Signaling in Cancer Cells: Important or Not? Archivum Immunologiae et Therapiae Experimentalis (Warsz). 2018. Vol. 66:125–132

            Graphical abstract

            Highlights
            • LCP-NP achieved the highest encapsulation efficiency among the four methods for STING agonist delivery via lipid-based nanoparticles.

            • LCP-NP, with a mean diameter of 82.57±3.72 nm, exhibited a slower release profile in contrast to free cGAMP.

            • LCP-NP demonstrated enhanced activation of the cGAS-STING pathway and increased expression of immune factors compared to free cGAMP.

            In brief

            LCP-NP, a lipid calcium phosphate nanoparticle encapsulating STING agonist, exhibits efficient delivery of cGAMP and holds promising potential as a delivery system for immunotherapy in neuroblastoma.

            Author and article information

            Journal
            amm
            Acta Materia Medica
            Compuscript (Ireland )
            2737-7946
            17 June 2023
            : 2
            : 2
            : 216-227
            Affiliations
            [a ]Clinical Research Center, Beijing Children’s Hospital, Capital Medical University, National Center for Children’s Health, Beijing, 100045, People’s Republic of China
            [b ]School of Basic Medicine and Clinical Pharmacy, China Pharmaceutical University, Nanjing, 211198, People’s Republic of China
            Author notes
            *Correspondence: meidong11290926@ 123456126.com (M. Dong)
            Article
            10.15212/AMM-2023-0011
            134eac25-d879-4571-a64f-b4cc1874b3ec
            Copyright © 2023 The Authors.

            Creative Commons Attribution 4.0 International License

            History
            : 31 March 2023
            : 19 May 2023
            : 24 May 2023
            Page count
            Figures: 8, Tables: 2, References: 29, Pages: 12
            Funding
            Funded by: Beijing Natural Science Foundation, China
            Award ID: L202048
            Funded by: Beijing Natural Science Foundation, China
            Award ID: L212013
            Funded by: Beijing Natural Science Foundation, China
            Award ID: 7232246
            Funded by: Beijing Nova Program, China
            Award ID: Z201100006820009
            Funded by: Beijing Nova Program, China
            Award ID: 20220484219
            Funded by: Beijing Hospitals Authority Youth Programme
            Award ID: QML20201201
            This work was sponsored by the Beijing Natural Science Foundation, China (Grants L202048, L212013, and 7232246), Beijing Nova Program, China (Grants Z201100006820009 and 20220484219), and Beijing Hospitals Authority Youth Programme (Grant QML20201201).
            Categories
            Research Article

            Toxicology,Pathology,Biochemistry,Clinical chemistry,Pharmaceutical chemistry,Pharmacology & Pharmaceutical medicine
            neuroblastoma,2′,3′-cGAMP,immunity therapy,STING agonists,lipid calcium phosphate nanoparticles

            Comments

            Comment on this article