2,948
views
1
recommends
+1 Recommend
1 collections
    137
    shares

      Zoonoses now indexed by SCOPUS from December 2023. Interested in becoming a Zoonoses published author?

      • Platinum Open Access with no APCs.
      • Fast peer review/Fast publication online after article acceptance.

      Check out the call for papers on our website https://zoonoses-journal.org/index.php/2023/04/26/zoonoses-call-for-papers-2/

      scite_
       
      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      Identification of Novel Mutations Associated with Bedaquiline Resistance in Mycobacterium Marinum

      research-article
      1 , 2 , 1 , 2 , 1 , 2 , * ,
      Zoonoses
      Compuscript
      Mycobacterium marinum, NTM, Bedaquiline, WGS, Drug resistant mutants
      Bookmark

            Abstract

            Objective:

            Because infections caused by nontuberculous mycobacteria (NTM) are rapidly increasing globally, a need exists for developing novel antibiotics and discovering the mechanism of resistance. This research was aimed at understanding the mechanism of bedaquiline resistance in the model NTM species Mycobacterium marinum (M. marinum).

            Methods:

            The Mycobacterium marinum M strain was subjected to mutant selection with different concentrations of BDQ. After three rounds of evolution, 58 BDQ-resistant mutants were isolated and subjected to WGS. The results were confirmed through PCR and Sanger sequencing.

            Results:

            We identified seven genetic mutations among these mutants. The highest drug resistance (6–10× MIC) was associated with a mutation in AtpB, the primary biochemical target of BDQ in Mtb. Numerous mutations and insertions mapped to the gene MMAR_1007(46/58), which encodes the homolog of Rv0678 (MmpR) in Mtb. More than 93% of mutants (54/58) contained a single mutation (G563A) in MMAR_4049, which encodes the integral membrane protein YrbE3A-1.

            Conclusion:

            Both target-based and efflux-based actions contribute to BDQ resistance in M. marinum. Our findings may aid in developing novel potent anti-NTM (BDQ-based) drug regimens and diagnostic assays for the detection of BDQ-resistant M. marinum.

            Main article text

            INTRODUCTION

            Tuberculosis (TB) remains the leading cause of single bacterial infectious disease mortality worldwide, and is responsible for at least 1 million deaths each year [13]. The COVID-19 pandemic has had devastating effects on global TB control efforts, and the consequences are gradually becoming apparent [1]. In the future, infections due to drug sensitive or resistant mycobacteria are expected to increase. Therefore, an urgent need exists to increase understanding of novel mechanisms of drug action and resistance.

            Bedaquiline (BDQ) is a diarylquinoline-based, species-selective chemical inhibitor of the Mycobacterium tuberculosis (Mtb) ATP synthase and the first novel TB drug to be approved by the FDA in 40 years [4, 5]. BDQ exhibits bactericidal activity against Mtb and a series of mycobacteria, such as Mycobacterium bovis, Mycobacterium avium, and Mycobacterium smegmatis [6]. After the clinical introduction of BDQ in 2012, several genetic mutations or resistance-associated variants were identified. For instance, mutations in AtpE (ATP synthase c chain) confer target-based BDQ resistance [6]. Mutations in Rv0678, an MmpR transcriptional repressor of the MmpS5-MmpL5 system, cause efflux-based BDQ resistance [7]. In addition, PepQ (an aminopeptidase) has been linked with low-level BDQ resistance [8].

            Mycobacterium marinum (M. marinum), the closest genetic relative of the M. tuberculosis complex, is a non-tuberculous mycobacterium (NTM) that causes a TB-like disease in fish and can infect humans when damaged skin is exposed to a contaminated aqueous environment. This pathogen spreads through the lymphatic system and causes particularly serious symptoms among immunocompromised patients. Fortunately, previous research has indicated that BDQ efficiently kills M. marinum in vitro and therefore may potentially serve as a powerful weapon in the arsenal for fighting this zoonotic pathogen [9, 10]. Here, to better understand the mechanism of action and resistance of BDQ in M. marinum, we characterized and sequenced 58 BDQ-resistant mutants isolated in vitro from an M. marinum M strain, and discovered several new mutations linked with BDQ resistance that have not previously been reported in Mtb or other mycobacteria.

            MATERIALS AND METHODS

            Bacterial strain and culture conditions

            The Mycobacterium marinum M strain, a kind gift from Professors Qian Gao and Chuan Wang (Fudan University), was used in this research. Wild-type bacteria and BDQ-resistant isolates were cultured in BSL2 at 30°C in regular Middlebrook 7H9 broth supplemented with 0.2% glycerol and 10% ADC, or on 7H10 agar supplemented with 0.5% glycerol and 10% OADC.

            MIC determination

            BDQ was purchased from MedChemExpress Co for MIC testing and isolation of resistant mutants. The wild-type and BDQ-resistant bacteria were first cultured at 30°C for 3–4 days, then adjusted to OD600 of 0.001 as the starting culture to determine MIC values in a 96-well plate. All MIC plates were cultured in aerobic conditions at 30°C for 7 days. The MIC for each bacterium was determined through the regular Alamar Blue assay [11].

            Laboratory-based adaptive evolution of BDQ-resistant mutants

            A 5 mL volume of M. marinum culture (∼1.3×108 CFU) [12] was inoculated onto ten 7H10 agar plates (0.5 mL each) containing 0.1 μg/mL (1× MIC) BDQ, for the first round of laboratory evolution. After incubation at 30°C for 4 weeks, all colonies appearing on the plates were picked and resuspended in 20 μL 7H9 medium, then inoculated on a 7H10 plate with 2× MIC BDQ. After another 4 weeks, the surviving colonies were transferred to 7H10 plates with a higher concentration BDQ (4× MIC), for selection of highly drug-resistant mutants.

            Genomic DNA extraction

            The liquid-cultured M. marinum strain was harvested after a 10 min centrifugation at 12,000×g. The genomic DNA of bacteria was extracted with a Wizard® Genomic DNA Purification Kit (Promega) according to the manufacturer’s protocol. Purified genomic DNA was quantified with a TBS-380 fluorometer (Turner BioSystems Inc., Sunnyvale, CA). High-quality DNA (OD260/280 ≥1.5, ≥150 ng) was used in further experiments.

            Library construction and genome sequencing

            The draft genome sequence analyses of the M. marinum parental strain and resistant isolates were performed on the Illumina NovaSeq6000 sequencing platform (MajorBio Co., Shanghai, China). Briefly, DNA samples were sheared into 400–500 bp fragments with a Covaris M220 Focused Acoustic Shearer according to the manufacturer’s protocol. Illumina sequencing libraries were prepared from the sheared fragments with a NEXTflex™ Rapid DNA-Seq Kit. The 5′ primer ends were first end-repaired and phosphorylated. Next, the 3′ ends were A-tailed and ligated to sequencing adapters. Third, the adapter-ligated products were cloned with PCR. The prepared libraries then were used for paired-end Illumina sequencing (2×150 bp) on the Illumina NovaSeq6000 sequencing platform.

            Genome assembly and annotation

            The data generated from the Illumina platform were used for bioinformatics analysis. All of analyses were performed with the free online Majorbio Cloud Platform (www.majorbio.com) from Shanghai Majorbio Bio-pharm Technology Co., Ltd. The detailed procedures are as follows. Raw reads obtained after sequencing were filtered with fastp software (version 0.19.6) [13] and assembled with SOPA de novo version 2.04 [14]. For each isolate, 1.09–1.94 gigabase (169.6-fold to 306.04-fold genome coverage) sequences were generated after barcodes were trimmed. A total of 324 to 1414 contigs, and 3653376 to 6480401 raw paired reads were generated; the genome sizes were 4.85–6.94 megabases. The WGS data have been submitted to the Sequence Read Archive of the National Center for Biotechnology Information as fastq files (accession number PRJNA903131). Glimmer [15] was used for CDS prediction, tRNA-scan-SE was used for tRNA prediction, and Barrnap was used for rRNA prediction. The predicted CDSs were annotated from the NR, Swiss-Prot, Pfam, GO, COG and KEGG databases with sequence alignment tools such as BLASTP, Diamond and HMMER. Briefly, each set of query proteins was aligned with the databases, and annotations of best-matched hits (e-value < 10–5) were obtained for gene annotation. Mutations in proline-glutamic acid/proline–proline–glutamic acid family genes and in regions with repetitive sequences were excluded from the analysis.

            PCR and DNA sequencing

            The genomic DNA from BDQ-resistant mutants identified in vitro was then used as the PCR template for amplifying the DNA area with genetic variations. The PCR products were next subjected to Sanger sequencing to confirm the observation of WGS.

            RESULTS

            Isolation of M. marinum mutants resistant to BDQ

            First, we determined that the MIC of BDQ for the susceptible M. marinum M parent strain was 0.1 μg/mL, which was close to the original reported value. As shown in Fig 1, to conduct the laboratory evolution for generating the BDQ-resistant mutant, 1.3×108 bacteria were plated onto 7H10 plates containing a 1× MIC concentration of BDQ (0.1 μg/mL). In total, 176 isolates grew and formed visible clones after 4 weeks of antibiotic selection (Fig 1). These 176 resistant isolates were transferred to 7H10 plates containing a 2× MIC concentration of BDQ (0.2 μg/mL). Finally, 57 of 176 isolates survived in this increased stress condition and were transferred to 7H10 plates containing a 4× MIC concentration of BDQ (0.4 μg/mL). Eventually, only one BDQ resistant isolate was recovered. The MIC of this isolate was then determined to be 0.6–1.0 μg/mL with an Alamar Blue assay (Fig 2).

            FIGURE 1 |

            In vitro selection of bedaquiline-resistant isolates in M. marinum.

            FIGURE 2 |

            Liquid MIC tests of representative bedaquiline-resistant isolates.

            WT: wild type. Strain IDs (mutant genes): 002 (MMAR_1007), 016 (YrbE3A-1), 036 (MMAR_1007, YrbE3A-1, MMAR_1793), 059 (MMAR_1007, YrbE3A-1), 067 (MMAR_1007, MMAR_1604), 093 (YrbE3A-1, MMAR_1873), 176 (MMAR_1007, YrbE3A-1, MMAR_1963) and 4×057 (YrbE3A-1, atpB).

            Mutations identified in BDQ-resistant mutants by WGS

            A total of 58 BDQ-resistant mutants as well as the parental M strain were subjected to WGS. As shown in Table 1, we identified seven different gene mutations in total of 58 mutants. These genomic deep sequencing results were confirmed by PCR amplification and DNA sequencing (Table 2). Notably, the highest level of drug resistance (6–10× MIC) was associated with a mutation in AtpB, the primary biochemical target of BDQ in Mtb, thus indicating that BDQ also primarily blocks the functional role of ATP synthase in M. marinum. In contrast, numerous mutations and insertions mapped to the gene MMAR_1007(46/58), which encodes the homolog of Rv0678 (MmpR) in Mtb. This finding suggested that the mechanism of efflux-based low-level BDQ resistance (against 2× MIC) is largely conserved between Mtb and M. marinum.

            TABLE 1 |

            Mutations identified in bedaquiline-resistant mutants of M. marinum by WGS analysis.

            Locus tagGene productNucleotide mutationAmino acid changeFrequencyMtb locus tag (gene/product)
            MMAR_4049 YrbE3A-1G563AG188D54/58 rv1964 (YrbE3A)a
            MMAR_1007 Transcriptional regulatorG269CR90P1/58 rv0678 (MmpR)b
            MMAR_1007 Transcriptional regulatorC296TA99V1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorC394TR132 stop1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG122AG41D1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorT298GF100V1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG404AR135H1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG370 deletion124 codon shift1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorC170AA57E1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG215TR72L1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG110AG37D2/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorT131GL44W3/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorT350CL117P2/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorC247TL83F3/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorT449GL150R1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG310TE104 stop1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG70TG24C1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulator289G insertion97 codon shift1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorC251TA84V3/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG493 deletion165 codon shift1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorA434 deletion145 codon shift1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorA202GS68G2/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulator301C insertion101 codon shift3/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorT299GF100C1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG203AS68N2/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorA494 deletion165 codon shift1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorA488GE163G1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG74AG25E2/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorC265TR89W2/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG197AG66E1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorG361AG121S1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulatorT2Cstart lost1/58 rv0678 (MmpR)
            MMAR_1007 Transcriptional regulator375T insertion126 codon shift1/58 rv0678 (MmpR)
            MMAR_4093 ATP synthase A chain AtpBA511CI171L1/58 rv1304 (AtpB)
            MMAR_1963 Metallo-beta-lactamase superfamily proteinG250TE84 stop1/58 rv2752c
            MMAR_1837 Conserved transmembrane protein214ACATCGCCG insertion71DIA insertion1/58 rv2869c (Rip1)c
            MMAR_1793 Conserved hypothetical proteinG123TW41C1/58 rv2915c
            MMAR_1604 Conserved hypothetical membrane proteinC320TT107I1/58-

            a rv1964 encodes integral membrane protein YrbE3A.

            b rv0678 encodes the MmpS5–MmpL5 efflux pump repressor MmpR.

            c rv2869c gene encodes the regulated intramembrane proteolysis (RIP) metalloprotease Rip1.

            TABLE 2 |

            Primers used to verify gene mutations in bedaquiline-resistant mutants.

            GenePrimerSequence (5′-3′)
            MMAR_4049 YrbE3A-1-FATGGTTGCTCCTGTTGCCGTGGCCA
            YrbE3A-1-RTCACAGCGTCACCTTGATCGCCACC
            MMAR_1007 MMAR-1007-FATGAAGTTGTTGTAGACCTATCGGG
            MMAR-1007-RTCGACAACATCGGGTCGGGCAACAA
            atpB atpB-FATGACTGAGTCGATCCTGGCCGCCC
            atpB-RTTAGTGGTGGTCCTCTTCTAGCTCC
            MMAR_1963 MMAR-1963-FGTGAACGAAGAACTTCCCCCACCAG
            MMAR-1963-RTCAAACTTCAATGACCGTGGGCACG
            MMAR_1837 MMAR-1837-FATGATGTTCGTTGTCGGCATTGTGC
            MMAR-1837-RTTATTGGAACAACCTGATCGGGTTG
            MMAR_1793 MMAR-1793-FGTGCGACTGCACGTGCGGGGGCGGG
            MMAR-1793-RCTAGCGGTGACCTAGTTGGTTGGGG
            MMAR_1604 MMAR-1604-F2TCAATACCAGGCAAGCGCCCCAGG
            MMAR-1604-R2CGCTTGGCCAGCCGGTCCATCCCG

            Interestingly, we also discovered a panel of novel mutations that have not previously been reported in Mtb or other mycobacteria. More than 93% of the mutants (54/58) contained a single mutation (G563A) within MMAR_4049, which encodes the integral membrane protein YrbE3A-1. Both YrbE3A-1 and its Mtb homolog YrbE3A (encoded by rv1964) belong to the YrbE family and are annotated as the ABC transporter permease [16]. Unexpectedly, this enzyme is missing in the genomes of M. bovis, M. bovis BCG (Pasteur) strain and M. smegmatis. We next compared the structural similarity between YrbE3A-1 and YrbE3A and found that the mutation site (glycine to aspartate at residue 188) mapped to the linker region between two critical α helixes, thereby suggesting potential changes in structure-based protein activity (Fig 3). Another four mutations were found at a low frequency (1/58): MMAR_1963 (encoding a metallo-beta-lactamase superfamily protein), MMAR_1837 (encoding a conserved transmembrane protein), MMAR_1793 (encoding a conserved hypothetical protein) and MMAR_1604 (encoding a conserved hypothetical membrane protein). Some of these proteins have structurally conserved transmembrane domains and/or predicted enzymatic activity, but their true biological roles and how they contribute to BDQ resistance remain to be explored.

            FIGURE 3 |

            Overall structure of M. marinum YrbE3A_1.

            Glycine 188, which was changed to aspartate in bedaquiline-resistant isolates, is shown in detail. Different colors in the 3D model represent the per-residue confidence score (pLDDT), ranging between 0 and 100 (dark blue: Plddt > 90; light blue: 90 > pLDDT > 70; yellow: 70 > pLDDT > 50; and orange: pLDDT < 50). Red dots and blue dots represent oxygen and nitrogen, respectively. Hydrogen bonds are represented by blue dotted lines. The 3D model of YrbE3A_1 came from the AlphaFold protein structure database (https://alphafold.com/entry/B2HQG4).

            DISCUSSION

            NTM infections are rapidly increasing worldwide. These bacteria are difficult to kill with many routine antibiotics, owing to their intrinsic drug resistance [17]. M. marinum, an opportunistic zoonotic pathogen, has been recognized as a model species for NTM research. Consequently, understanding of its genome, physiology, and pathogenicity has gradually improved [9]. In this research, we combined a laboratory-based adaptive evolution strategy with a WGS approach to identify the spontaneous chromosomal mutations associated with BDQ resistance in M. marinum.

            A previous study in Mtb has indicated that mutations in the F0 operon (which includes the atpB, atpE, and atpF genes, whose gene products form the entire membrane-bound F0 unit of the ATP synthase) confer high-level BDQ resistance [18]. Our findings regarding atpB confirmed the above model. This specific mutation (I171L) is located at the α-helices aH5 within the a-subunit of M. marinum ATP synthase (Fig 4). This position is part of the key site for proton translocation [19]. Interestingly, the frequency of mutations in ATP synthase was relatively low with respect to that of efflux-based mutations, in contrast to previous reports in Mtb. These findings may suggest a potential bacterial fitness loss under specific environments, although we did not observe a significant growth defect of this M. marinum strain bearing the above atpB point mutation (data not shown). Future investigations on more clinical Mtb or NTM strains are required to further determine the relationship between atpB mutation and BDQ resistance.

            FIGURE 4 |

            Overall structure of M. marinum AtpB.

            Isoleucine 171, which was changed to leucine in bedaquiline-resistant isolates, is shown in detail. The color labeling is as in Fig 3. The 3D model of AtpB came from the AlphaFold protein structure database (https://alphafold.com/entry/B2HQG4).

            The unique findings of this research involved the characterization of a panel of efflux-based resistance mutants. These mutants were found at relatively high frequency but conferred only low-level BDQ resistance. In addition, earlier research has suggested that efflux-based mutations may trigger drug cross-resistance. For example, the Mtb carrying mutation on rv0678 shows a resistance phenotype to both BDQ and clofazimine [20]. In this study, we found that these mutations and insertions of MMAR_1007 (the homolog of rv0678) showed a diverse distribution, thus suggesting the genetic and functional vulnerability of this transcriptional repressor modulated MmpS5-MmpL5 system [7, 20]. Most notably, we identified that MMAR_4049 (encoding an ABC transporter permease) is a novel high-frequency mutation locus linked with BDQ resistance. A recent study has indicated that YrbE3A promotes the host innate immune response by targeting NF-κB/JNK signaling in Mtb [16]. However, further evidence of its functional role in bacterial energy metabolism or drug resistance is lacking. To better understand the role of YrbE3A-1 and the other four genes, genetic manipulation, such as knockout, knockdown or overexpression studies, as well as drug cross-resistance assays, will be necessary in the future.

            In conclusion, we identified novel mutations associated with BDQ resistance in M. marinum. Our findings show that the mechanisms of BDQ resistance in M. marinum are quite complicated, and include both target-based and efflux-based mediators. Our research thus provides a landscape for better understanding of the molecular basis of BDQ resistance, which should aid in the development of novel potent anti-NTM (BDQ-based) drug regimens and facilitate the discovery of new diagnostic assays capable of detecting BDQ-resistance in M. marinum.

            CONFLICTS OF INTEREST

            The authors declare no conflicts of interest.

            REFERENCES

            1. Migliori GB, Thong PM, Alffenaar JW, Denholm J, Tadolini M, Alyaquobi F, et al.. Gauging the impact of the COVID-19 pandemic on tuberculosis services: a global study. Eur Respir J. 2021. Vol. 58(5):2101786

            2. Gagneux S. Ecology and evolution of Mycobacterium tuberculosis. Nat Rev Microbiol. 2018. Vol. 16(4):202–213

            3. WHO. Global tuberculosis report 2021. 2021

            4. Huitric E, Verhasselt P, Andries K, Hoffner SE. In vitro antimycobacterial spectrum of a diarylquinoline ATP synthase inhibitor. Antimicrob Agents Chemother. 2007. Vol. 51(11):4202–4204

            5. Wang Z, Soni V, Marriner G, Kaneko T, Boshoff HIM, Barry CE, et al.. Mode-of-action profiling reveals glutamine synthetase as a collateral metabolic vulnerability of M. tuberculosis to bedaquiline. Proc Natl Acad Sci U S A. 2019. Vol. 116(39):19646–19651

            6. Huitric E, Verhasselt P, Koul A, Andries K, Hoffner S, Andersson DI. Rates and mechanisms of resistance development in Mycobacterium tuberculosis to a novel diarylquinoline ATP synthase inhibitor. Antimicrob Agents Chemother. 2010. Vol. 54(3):1022–1028

            7. Saeed DK, Shakoor S, Razzak SA, Hasan Z, Sabzwari SF, Azizullah Z, et al.. Variants associated with Bedaquiline (BDQ) resistance identified in Rv0678 and efflux pump genes in Mycobacterium tuberculosis isolates from BDQ naïve TB patients in Pakistan. BMC Microbiol. 2022. Vol. 22(1):62

            8. Almeida D, Ioerger T, Tyagi S, Li SY, Mdluli K, Andries K, et al.. Mutations in pepQ Confer Low-Level Resistance to Bedaquiline and Clofazimine in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2016. Vol. 60(8):4590–4599

            9. Aubry A, Mougari F, Reibel F, Cambau E. Mycobacterium marinum. Microbiol Spectr. 2017. Vol. 5(2)[Cross Ref]

            10. Meybeck A, Tetart M, Baclet V, Alcaraz I, Blondiaux N, Peytavin G, et al.. A disseminated Mycobacterium marinum infection in a renal transplant HIV-infected patient successfully treated with a bedaquiline-containing antimycobacterial treatment: a case report. Int J Infect Dis. 2021. Vol. 107:176–178

            11. Wang Q, Boshoff HIM. Determining minimum inhibitory concentrations in liquid cultures or on solid medium. Methods Mol Biol. 2021. Vol. 2314:595–609

            12. Chen J, Zhang S, Cui P, Shi W, Zhang W, Zhang Y. Identification of novel mutations associated with cycloserine resistance in Mycobacterium tuberculosis. J Antimicrob Chemother. 2017. Vol. 72(12):3272–3276

            13. Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018. Vol. 34:i884–i890

            14. Luo R, Liu B, Xie Y, Li Z, Huang W, Yuan J, et al.. SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler. GigaScience. 2012. Vol. 1(1):18

            15. Delcher AL, Bratke KA, Powers EC, Salzberg SL. Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics. 2007. Vol. 23(6):673–679

            16. Wang J, Zhu X, Peng Y, Zhu T, Liu H, Zhu Y, et al.. Mycobacterium tuberculosis YrbE3A Promotes Host Innate Immune Response by Targeting NF-κB/JNK Signaling. Microorganisms. 2020. Vol. 8(4):584

            17. Johansen MD, Herrmann JL, Kremer L. Non-tuberculous mycobacteria and the rise of Mycobacterium abscessus. Nat Rev Microbiol. 2020. Vol. 18(7):392–407

            18. Ismail N, Ismail NA, Omar SV, Peters RPH. In vitro study of stepwise acquisition of rv0678 and atpE mutations conferring bedaquiline resistance. Antimicrob Agents Chemother. 2019. Vol. 63(8):e00292–19

            19. Montgomery MG, Petri J, Spikes TE, Walker JE. Structure of the ATP synthase from Mycobacterium smegmatis provides targets for treating tuberculosis. Proc Natl Acad Sci U S A. 2021. Vol. 118:e2111899118

            20. Villellas C, Coeck N, Meehan CJ, Lounis N, de Jong B, Rigouts L, et al.. Unexpected high prevalence of resistance-associated Rv0678 variants in MDR-TB patients without documented prior use of clofazimine or bedaquiline. J Antimicrob Chemother. 2017. Vol. 72(3):684–690

            Author and article information

            Journal
            Zoonoses
            Zoonoses
            Zoonoses
            Compuscript (Shannon, Ireland )
            2737-7466
            2737-7474
            02 February 2023
            : 3
            : 1
            : e993
            Affiliations
            [1 ]Shanghai Collaborative Innovation Center of Agri-Seeds / School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai 200240, China
            [2 ]Shanghai Key Laboratory of Veterinary Biotechnology, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai 200240, China
            Author notes
            *Corresponding author: E-mail: wangz@ 123456sjtu.edu.cn (ZW)

            Edited by: Yujie Hu, China National Center for Food Safety Risk Assessment, China

            Reviewed by: Reviewer 1, Nabila Ismail, Stellenbosch University, South Africa

            Reviewer 2, Hao Li, College of Veterinary Medicine, China Agricultural University, China

            Reviewer 3, Wei Wang, China National Center for Food Safety Risk Assessment, China

            Reviewer 4 chose to be anonymous

            Article
            10.15212/ZOONOSES-2022-0042
            c1ca2317-31be-4850-b997-de80f6323a22
            Copyright © 2023 The Authors.

            This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY) 4.0, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.

            History
            : 24 October 2022
            : 08 December 2022
            : 17 January 2023
            Page count
            Figures: 4, Tables: 2, References: 20, Pages: 7
            Funding
            Funded by: National Key Research and Development Plans of China
            Award ID: 2021YFD1800401
            Funded by: National Natural Science Foundation of China
            Award ID: 32070128
            Funded by: Shanghai Biomedical Science and Technology Support Special Project
            Award ID: 21S11900200
            This research was kindly supported by grants from the National Key Research and Development Plans of China (No. 2021YFD1800401), the National Natural Science Foundation of China (No. 32070128) and Shanghai Biomedical Science and Technology Support Special Project (No. 21S11900200). We thank Prof. Qian Gao and Prof. Chuan Wang for providing the M. marinum M strain. We thank Prof. Kyu Y. Rhee for critical discussion and document revision.
            Categories
            Original Article

            Parasitology,Animal science & Zoology,Molecular biology,Public health,Microbiology & Virology,Infectious disease & Microbiology
            NTM,Drug resistant mutants,Bedaquiline,Mycobacterium marinum,WGS

            Comments

            Comment on this article