Molecular Characterization of Anaplasma, Ehrlichia, Babesia, and Borrelia in Ticks from Guangdong Province of Southern China

Abstract

Objective:

Tick-borne pathogens have become emerging global health threats in humans and animals. The objective of the present study was to investigate Anaplasma, Ehrlichia, Babesia, and Borrelia in ticks in southern China.

Methods:

Ticks were collected from animals and identified to the species level. Tick-borne Anaplasma, Ehrlichia, Babesia, and Borrelia were tested by PCR assays, and analyzed by sequencing and phylogenetics.

Results:

We collected 747 ticks, including Rhipicephalus microplus (n=225) and R. sanguineus (n=522), from pet dogs in Guangdong Province of southern China. Using PCR and phylogenetic analysis we showed that these ticks carried Anaplasma platys, Ehrlichia canis, Borrelia miyamotoi, Babesia vogeli, and an unclassified Ehrlichia species in Rhipicephalus ticks. Of these pathogens, B. miyamotoi was first found in southern China. A. platys, E. canis, and B. miyamotoi were zoonotic pathogens that infected both R. microplus and R. sanguineus, whereas Ba. vogeli only infected R. sanguineus, with a prevalence of 0.3%-1.5%.

Conclusions:

The results of this study showed diversity and complexity of tick-borne pathogens in Guangdong Province of southern China, implying the importance of tick-borne pathogen surveillance and control.

Main article text

INTRODUCTION

Ticks are important arthropods that transmit many pathogens in both humans and animals, and tick-borne pathogens have become a great threat to human and animal health worldwide [1,2]. In China, many new pathogens, such as severe fever with thrombocytopenia syndrome virus (SFTSV), Alongshan virus, Songling virus, and Tacheng tick virus 1 and 2, have been shown to cause febrile illness in humans [3–8]. Haemaphysalis longicornis ticks have also been demonstrated to carry Nairobi sheep disease virus associated with acute hemorrhagic gastroenteritis in sheep and goats in Jilin and Hubei Provinces [9,10].

Tick-borne bacteria include several members of Anaplasma, Ehrlichia, and Borrelia, with the most important species of E. chaffeensis associated with monocytic ehrlichiosis, A. phagocytophilum associated with granulocytic anaplasmosis, and B. burgdorferi sensu lato (s.l.) causing Lyme disease [11–13]. Less commonly, E. ewingii and E. muris also cause clinical symptoms, such as fevers, headaches, malaise, and lymphopenia [11]. Other species, such as A. marginale, A. centrale, A. ovis, E. canis, and E. minasensis, are associated with animal infections [11]. Of these species, several species, including A. ovis, A. bovis, A. platys, A. centrale, E. canis, and E. chaffeensis, have been reported in China [14]. B. burgdorferi s.l. group includes > 20 genospecies, in which 5 genospecies (B. afzelii, B. garinii, B. burgdorferi sensu stricto, B. bavariensis, and B. spielmanii) are human pathogens, 3 genospecies (B. lusitaniae, B. valaisiana, and B. finlandensis) are suspected human pathogens, and 1 genospecies (B. bissettii) has no clinical relevance to humans [15]. Borrelia miyamotoi is genetically distinct from B. burgdorferi s.l., which belongs to the relapsing fever spirochete and has also been identified to be an emerging human pathogen [16].

Tick-borne babesiois is an emerging disease worldwide, and at least 100 Babesia spp. have been identified to infect a broad spectrum of animals [14]. Three important species infect humans (Ba. microti, Ba. divergens, and Ba. venatorum). Other species, such as Ba. ovis, Ba. major, Ba. bovis, Ba. bigemina, Ba. ovata, Ba. orientalis, Ba. motasi, and Ba. caballi, cause infections in animals. In China, Ba. microti has been found in rodents in Fujian, Zhejiang, Henan, and Heilongjiang Provinces, while Ba. vogeli has been previously found in pet cats in Shenzhen [17]. B. divergens has been reported in I. persulcatus, Haemaphysalis concinna, and H. japonica and striped field mice in Heilongjiang Province, where B. venatorum has also been reported in I. persulcatus [18,19].

South China has a hot and rainy climate and high biodiversity, and is considered to be one of the hotspots of vector-borne diseases [20]. A previous study showed that of the 10 RNA viruses in Rhipicephalus ticks in Guangdong Province, most were genetically related to those reported in other provinces of China or other countries, suggestive of the importance of tick-borne pathogen surveillance [21]. In the present study we performed molecular detection of Anaplasma, Ehrlichia, Babesia, and Borrelia in ticks in Foshan of southern China and found that A. platys, E. canis, B. miyamotoi, Ba. vogeli, and an unclassified Ehrlichia sp. in ticks, in which A. platys, E. canis, and B. miyamotoi were potentially zoonotic, suggesting the importance of tick-borne disease surveillance and control in dogs in Foshan of southern China.

MATERIAL AND METHODS

Tick collection and identification

Between May and June 2020, adult ticks were collected from pet dogs in Foshan City, Guangdong Province, China. Tick species were identified based on the morphologic features and confirmed by a polymerase chain reaction (PCR) targeting the 16S rRNA gene (S1 Fig). The ticks were pooled for further analysis according to their sampling sites and species with 15 ticks for each pool. All tick samples collected were stored at −80°C until use. The study was approved by the Experimental Animals Ethics Committee of Foshan University (FOSU79119).

PCR

Total DNA was extracted from ticks using a QIAamp DNA Mini Kit (Qiagen GmbH, Hilden, Germany). DNA samples were screened for the presence of Anaplasma, Ehrlichia, Babesia, and Borrelia species by PCR. The primers were described in previous studies [3–8], or designed based on the conservative sequence of specific target genes (Table 1). PCRs were performed using a Biometra TRIO Thermal Cycler (Analytik Jena, Jena City, Germany). The reactions were carried out in a total volume of 25 μl, including 12.5 μl of Premix Taq (Ex Taq version 2.0 plus dye; Takara Biomedical Technology (Beijing) Co. Ltd., Beijing, China), 1.0 μl of forward primer, 1.0 μl of reverse primer, 2.0 μl of DNA template (approximately 100 ng), and 8.5 μl of ultrapure water. A negative control PCR was established each time a PCR test was set up. The first-round PCR reaction conditions were as follows: pre-denaturation at 94 °C for 5 min; a total of 35 denaturation cycles at 95 °C for 30 s; annealing at a suitable temperature for 30 s; and extension at 72 °C for 70 s; with one final extension at 72 °C for 7 min. The second-round PCR was similar to the first round, except nested primers and the template that were used were 1 μl of the first-round amplification product.

TABLE 1 |

Primers used in the study.

Pathogen	Target gene	Oligonucleotide primer	Primer sequence (5′ → 3′)	Annealing temperature (°C)	Amplicon size (bp)	Reference
Borrelia	23S rRNA	Bor23s-F53	GAAGAAGGTCGTGGTAAGCTGC	55°C	734	This study
		Bor23S-R786	CTGGCCATAAATAGATCACTCGG		246
		Bor23S-F541	CGTGAGGGAAAGGTGAAAAGAAC
	16S rRNA	bor16s-F20	GGCTTAGAACTAACGCTGGCA	53°C	522	This study
		bor16s-F57	GCAAGTCAAACGGRATGTAG		485
		bor16s-R541	CAATAATCCCGAACAACGCTC
Anaplasma/Ehrlichia	groEL	gro607F	GAAGATGCWGTWGGWTGTACKGC	55°C	688	[22]
		gro1294R	AGMGCTTCWCCTTCWACRTCYTC
		gro677F	ATTACTCAGAGTGCTTCTCARTG	58°C	445
		gro1121R	TGCATACCRTCAGTYTTTTCAAC
	16S rRNA	AE16SF391	ATCCAGCTATGCCGCGTGA	52°C	483	This study
		AE16SR873	CCTTTGAGTTTTAGTCTTGC		365
		AE16SR755	GGGTATCTAATCCTGTTTGC
Babesia	ITS1	BaITS1F374	CTTTCAGCGATGGATGTCTTGG	54°C	380	This study
		BaITS1R753	TCACCCGATTTCAGGAGCG
		BaITS1F398	CACACAACGATGAAGGACGCAG	54°C	287
		BaITS1R684	CCAACAGCCTCGCAGAAGATT
	18S rRNA	BJ1-F1	GTCTTGTAATTGGAATGATGG	53°C	1173	[18,23]
		BL-R1	GAATAATTCACCGGATCACTCG
		BJ1-F2	GTCTTGTAATTGGAATGATGG	58°C	773
		BL-R2	ATTAACCAGACAAATCACTC

Phylogenetic analysis

The second-round PCR products were resolved on a 1.0% agarose gel and sequenced using the Sanger sequencing method at Sangon Biotech (Shanghai, China). Sequences for the gene targets were assembled and trimmed using SeqMan software (Madison, Wisconsin, USA). Nucleotide sequences that were shown to be positive were compared with existing sequences by BLAST on NCBI. Phylogenetic analyses were carried out using MUSCLE algorithm in MEGA software (Tempe, Arizona, USA). The phylogenetic trees were constructed using the Neighbor-Joining method. The reliability of the phylogenetic trees was evaluated using the bootstrap method with 1000 replicates per tree.

RESULTS

Tick samples

A total of 747 ticks, including Rhipicephalus microplus (n=225 [69.8%]) and Rhipicephalus sanguineus (n=522 [30.2%]), were collected from pet dogs in Foshan of southern China, including R. microplus (n=120 [8 pools]) and R. sanguineus (n=269 [19 pools]) from Xingxian Village and R. microplus (n=105 [7 pools]) and R. sanguineus (n=253 [18 pools]) from Xiaotang Village.

Anaplasma DNA in ticks

A total of 747 tick samples collected from different locations in Foshan City, Guangdong Province were assessed by genera-specific primers of Anaplasma groEL and the 16S rRNA gene. A total of 8 positive samples were detected in R. microplus and R. sanguineus in Xingxian Village, but positive results were not obtained from R. microplus or R. sanguineus in Xiaotang Village. Phylogenetic analysis of the groEL and 16S rRNA genes showed that Anaplasma belonged to A. platys (Fig 1). The groEL gene of A. platys was shown to have >97.79% sequence identity and grouped with the sequence found in dogs from Japan (AY077621), R. sanguineus in China (KY581623), and R. sanguineus in the Philippines (JN121382). Moreover, the groEL gene of A. platys was distinct from the other haplotypes, including isolates from Anopheles sinensis in China (KU585930, KU585933; Fig 1A; S1 Table). The 16S rRNA gene of A. platys in this study showed >99.0% sequence identity with those found in dogs from Japan (AY077619) and R. microplus in China (MH762081), which were phylogenetically clustered and different from the A. sinensis isolate in China (KU586168; Fig 1B; S2 Table).

FIGURE 1 |

Phylogenetic analysis of the partial groEL (A) and 16S rRNA (B) genes from Anaplasma spp. in southern China ticks. The phylogenetic trees were constructed by the neighbor-joining method using the Kimura 2-parameter model. A total of 365 bp of the groEL gene and 776 bp of the 16S rRNA gene were included in the final analysis. Sequences are identified by strain name and origin, followed by the GenBank accession number. Anaplasma detected the present study is marked in red bold.

A. platys was only found in Xingxian Village. A high prevalence was detected in R. sanguineus (2.2%) compared to R. microplus (1.7%), but no significant difference between the two species was detected (p > 0.05; Table 2).

TABLE 2 |

Molecular detection of zoonotic and veterinary pathogens in ticks from Guangdong Province.

Pathogen genera	Pathogen species	Number of positive pools/number of ticks	Prevalence (%, 95% CI)	Xingxian, Foshan		Xiaotang, Foshan
				Rhipicephalus sanguineus (%, 95% CI)	Rhipicephalus microplus (%, 95% CI)	Rhipicephalus sanguineus (%, 95% CI)	Rhipicephalus microplus (%, 95% CI)
Anaplasma	Anaplasma platys	8/747	1.1 (0.5-2.1)	6/2.2 (1.0-4.8)	2/1.7 (0.5-5.9)	0	0
Ehrlichia	Ehrlichia canis	2/747	0.3 (0.07-0.97)	1/0.4 (0.1-2.1)	1/0.8 (0.1-4.6)	0	0
	Ehrlichia sp.	4/747	0.5 (0.2-1.4)	2/0.7 (0.2-2.7)	0	1/0.4 (0.1-2.2)	1/0.9 (0.2-5.2)
Babesia	Babesia vogeli	11/747	1.5 (0.8-2.6)	1/0.4 (0.1-2.1) b	1/0.8 (0.1-4.6) a	9/3.6 (1.9-6.6) a,b	0
Borrelia	Borrelia miyamotoi	5/747	0.7 (0.3-1.5)	0	0	2/0.8 (0.2-2.8)	3/2.9 (1.0-8.1)

^a,bSignificant difference between the tick species (p < 0.05) by Fisher’s exact test.

Ehrlichia DNA in ticks

Ehrlichia DNA was detected in R. sanguineus and R. microplus, and the phylogenetic analysis of the groEL and 16S rRNA genes showed that the detected sequences were grouped with E. canis and uncharacterized Ehrlichia spp., respectively (Fig 2).

FIGURE 2 |

Phylogenetic analysis of the partial 16S rRNA (A) and groEL (B) genes from Ehrlichia spp. in southern China ticks. The phylogenetic trees were constructed with the neighbor-joining method using the Kimura 2-parameter model. A total of 504 positions of the 16S rRNA gene and 364 positions of the groEL gene were included in the final analysis. Sequences are identified by strain name and origin, followed by the GenBank accession number. Ehrlichia detected in the present study is marked with green bold.

The 16S rRNA gene was positive for E. canis, the sequences of which completely matched to the E. canis strains isolated from B. microplus in China (KX987326), humans from the USA (M73221), and dogs from Greece (EF011111; S3 Table). The groEL gene of E. canis in this study had >98.1 % sequence identity to dogs from China (CP025749), R. sanguineus from Japan (JN391408), and R. microplus from China (MW428319). The sequences were clustered into the same clade, but distinct from other Ehrlichia spp. (Fig 2; S4 Table). E. canis was tested in R. sanguineus (0.4%) and R. microplus (0.8%) in Xingxian Village, without a significant difference between the two tick species (p > 0.05; Table 2).

The groEL gene of Ehrlichia spp. had the highest similarity (98.9%) and was clustered together with the Ehrlichia spp. detected in ticks from China (KX987387, KY705065), thus forming a separate branch in the phylogenetic tree (S4 Table; Fig 2). Ehrlichia spp. groEL gene sequences were found in R. sanguineus (0.6%) and R. microplus (0.4%), and no significant difference was observed between the two tick species (p > 0.05; Table 2).

Babesia DNA in ticks

Babesia DNA was detected in both R. sanguineus and R. microplus collected from Foshan City of southern China. Phylogenetic analysis showed that the Babesia species in ticks from Xingxian and Xiaotang Villages were clustered together with B. vogeli (Fig 3). The obtained 18S rRNA gene of B. vogeli showed >99.9 % identity to each other and to those found in dogs from China (MK881089) and Japan (AB083374), and were phylogenetically clustered, but distinctive from the other Babesia species (Fig 3A, S5 Table). All the obtained B. vogeli 5.8S rRNA and ITS2 sequences were 100% identical to those isolated from dogs in China (MK881125) and the United States (EU084676; S6 Table). The phylogenetic analysis showed that these isolates were clustered in the same clade (Fig 3B). The overall prevalence of B. vogeli was 1.9% in R. sanguineus, with a prevalence of 0.4% in Xingxian Village and 3.6% in Xiaotang Village (P < 0.05; Table 2).

FIGURE 3 |

Phylogenetic analysis of the partial 18S rRNA (A) and 5.8S rRNA and ITS2 (B) genes from Babesia spp. in ticks of southern China. The phylogenetic trees were constructed with the neighbor-joining method using the Kimura’s 2-parameter model. A total of 773 positions of 18S rRNA gene and 300 positions of 5.8S rRNA and ITS2 gene were included in the final analysis. Sequences are identified by strain name and origin, followed by the GenBank accession number. Babesia detected the present study is marked with yellow bold.

Borrelia DNA in ticks

Borrelia DNA was also detected in R. sanguineus and R. microplus, which were phylogenetically-clustered together with B. miyamotoi (Fig 4). The B. miyamotoi 16S rRNA sequences showed >97.8 % identity to the previously reported sequences from I. ricinus in Austria (OM033639), and I. persulcatus in China (KU749373) and Japan (LC164108; S7 Table). All the obtained 23S rRNA gene sequences of B. miyamotoi were >97.1% identical to B. miyamotoi detected in I. ricinus from Russia (MK961312), I. persulcatus from Japan (AP024398), and Mongolia (AP024395; S8 Table). Phylogenetic analysis showed that the Borrelia in this study was clustered together, and formed a unique haplotype; however, it was distinct from the other haplotypes.

FIGURE 4 |

Phylogenetic analysis of the partial 23S rRNA (A) and 16S rRNA (B) genes from Borrelia spp. in southern China ticks. The phylogenetic trees were constructed with the neighbor-joining method using the Kimura 2-parameter model. A total of 241 23S rRNA gene bp and 505 16S rRNA gene bp were included in the final analysis. Sequences are identified by strain name and origin, followed by the GenBank accession number. Borrelia detected in the present study is marked with blue bold.

Only ticks collected from Xiaotang Village (1.4%) were shown to be infected with B. miyamotoi, with a prevalence of 0.8% in R. sanguineus and 2.9% in R. microplus (p > 0.05; Table 2). Borrelia DNA in ticks from Xingxian Village was negative.

DISCUSSION

In the present study we found there were two tick species (R. microplus and R. sanguineus), which carried A. platys, E. canis, B. miyamotoi, Ba. vogeli, and an unclassified Ehrlichia sp., most of which were potentially zoonotic, including A. platys, E. canis, and B. miyamotoi. These findings of the present study, together with virus diversity in ticks in previous studies, highlight the importance of tick-borne pathogen surveillance and control in dogs in Guangdong Province of southern China.

Both A. platys and E. canis in the Anaplasmataceae family are mainly transmitted by R. sanguineus tick, and can cause acute, self-limiting, and sometimes fatal diseases in dogs [24–26]. A. platys grows in canine platelets and causes canine infectious cyclic thrombocytopenia. Although A. platy is associated with no or few clinical signs in dogs in China, this pathogen is more virulent in Spain, Italy, Croatia, and Tunisia, suggestive of worldwide distribution of the bacterium [27–30]. Recently, A. platys infections have been described in humans, sheep, and cattle [31–33]. Additionally, an A. platys-like organism closely related to A. platys has also been detected in cattle and goats in China, and in deer in Spain [34–36]. Further characterization of this potential zoonotic pathogen is warranted. E. canis is the agent of canine monocytic ehrlichiosis that infects monocytes and causes hematologic complications. E. canis causes in asymptomatic and symptomatic human infections associated with human monocytic ehrlichiosis in Venezuela [37]. Our study identified A. platys and E. canis DNA in R. sanguineus in Guangdong Province of southern China, indicating the potential health threats of these pathogens to dogs and humans. Trans-stadial transmission of A. platys and E. canis in R. sanguineus has been confirmed experimentally [24,26]; however, the genetic diversity of R. sanguineus and its competence as a vector needs to be further investigated.

Parasites of the genus Babesia infect erythrocytes of wild and domestic birds and mammals, and causes a wide spectrum of clinical signs, ranging from subclinical symptoms to high fever, anemia, and splenomegaly or even death [38]. The principal species causing diseases in dogs include Ba. canis, Ba. gibsoni, Ba. rossi, and Ba. vogeli, in which Dermacentor ticks are involved in the transmission of Ba. canis, Haemaphysalis ticks for Ba. gibsoni and Ba. rossi, and R. sanguineus for B. vogeli [39]. B. vogeli DNA has been detected in 11.0 % of dogs in Shenzhen [40], 5.0% in Jiangxi [41], and 0.9% in Hunan [42], suggesting that the wide distribution of B. vogeli infection in dogs in China. In the present investigation, only Ba. vogeli DNA was tested in R. sanguineus collected from pet dogs. A corollary study should be conducted to determine Ba. vogeli infections in pet dogs in southern China.

B. miyamotoi has been shown to cause relapsing fever, with the main symptoms of high fevers, fatigue, headaches, myalgias, arthralgia chills, and nausea in Russian, the USA, Germany, the Netherlands, Norway, Poland, Romania, France, Japan, and China since its first identification in I. persulcatus ticks and rodents in 1994 from Japan [43]. In China B. miyamotoi has been shown to be distributed in Heilongjiang, Inner Mongolia, and Xingjiang, and may be carried by many Ixodes and Haemaphysalis ticks [16,44–46]. Our study detected the relapsing fever spirochete in both R. sanguineus and R. microplus in Guangdong Province, demonstrating that Rhipicephalus ticks may be another potential vector of the emerging pathogen.

In conclusion, our study identified several potentially zoonotic pathogens, including A. platys, E. canis, and B. miyamotoi in both R. microplus and R. sanguineus, and Ba. vogeli in R. sanguineus. The public health significance and the distribution of these tick-borne pathogens deserves further investigation. Physicians should be aware of the presence of tick-borne pathogens in southern China, and the differential diagnosis should be conducted in patients with an exposure to ticks to reach an effective treatment.

Supplementary Material

Supplementary Material can be downloaded here

CONFLICTS OF INTEREST

The authors declare no conflicts of interest.

REFERENCES

1. Fritz CL. Emerging tick-borne diseases. Vet Clin North Am Small Anim Pract. 2009. Vol. 39:265–278

2. Madison-Antenucci S, Kramer LD, Gebhardt LL, Kauffman E. Emerging tick-borne diseases. Clin Microbiol Rev. 2020. Vol. 33:e00083-18

3. Dong Z, Yang M, Wang Z, Zhao S, Xie S, Yang Y, et al.. Human tacheng tick virus 2 infection, China, 2019. Emerg Infect Dis. 2021. Vol. 27:594–598

4. Liu X, Zhang X, Wang Z, Dong Z, Xie S, Jiang M, et al.. A tentative Tamdy orthonairovirus related to febrile illness in Northwestern China. Clin Infect Dis. 2020. Vol. 70:2155–2160

5. Ma J, Lv XL, Zhang X, Han SZ, Wang ZD, Li L, et al.. Identification of a new orthonairovirus associated with human febrile illness in China. Nat Med. 2021. Vol. 27:434–439

6. Wang YC, Wei Z, Lv X, Han S, Wang Z, Fan C, et al.. A new nairo-like virus associated with human febrile illness in China. Emerg. Microbes Infect. 2021. Vol. 10:1200–1208

7. Wang ZD, Wang B, Wei F, Han SZ, Zhang L, Yang ZT, et al.. A new segmented virus associated with human febrile illness in China. N Engl J Med. 2019b. Vol. 380:2116–2125

8. Yu XJ, Liang MF, Zhang SY, Liu Y, Li JD, Sun YL, et al.. Fever with thrombocytopenia associated with a novel bunyavirus in China. N Engl J Med. 2011. Vol. 364:1523–1532

9. Gong S, He B, Wang Z, Shang L, Wei F, Liu Q. Nairobi sheep disease virus RNA in ixodid ticks, China, 2013. Emerg Infect Dis. 2015. Vol. 21:718–720

10. Yang L, Zhao Z, Hou G, Zhang C, Liu J, Xu L, et al.. Genomes and seroprevalence of severe fever with thrombocytopenia syndrome virus and Nairobi sheep disease virus in Haemaphysalis longicornis ticks and goats in Hubei, China. Virology. 2019. Vol. 529:234–245

11. Ismail N, McBride JW. Tick-borne emerging infections: ehrlichiosis and anaplasmosis. Clin Lab Med. 2017. Vol. 37:317–340

12. Paddock CD, Childs JE. Ehrlichia chaffeensis: a prototypical emerging pathogen. Clin Microbiol Rev. 2003. Vol. 16:37–64

13. Stark JH, Li X, Zhang JC, Burn L, Valluri SR, Liang J, et al.. Systematic review and meta-analysis of Lyme disease data and seropositivity for Borrelia burgdorferi, China, 2005–2020. Emerg Infect Dis. 2022. Vol. 28:2389–2397

14. Fang LQ, Liu K, Li XL, Liang S, Yang Y, Yao HW, et al.. Emerging tick-borne infections in mainland China: an increasing public health threat. Lancet Infect Dis. 2015. Vol. 15:1467–1479

15. Wang Y, Li S, Wang Z, Zhang L, Cai Y, Liu Q. Prevalence and Identification of Borrelia burgdorferi Sensu Lato genospecies in ticks from Northeastern China. Vector Borne Zoonotic Dis. 2019a. Vol. 19:309–315

16. Gao Y, Lv XL, Han SZ, Wang W, Liu Q, Song M. First detection of Borrelia miyamotoi infections in ticks and humans from the northeast of Inner Mongolia, China. Acta Trop. 2021. Vol. 217:105857

17. Zhang XL, Li XW, Li WJ, Huang HL, Huang SJ, Shao JW. Molecular evidence of Babesia in pet cats in mainland China. BMC Vet Res. 2019. Vol. 30:476

18. Wei F, Song M, Liu H, Wang B, Wang S, Wang Z, et al.. Molecular detection and characterization of zoonotic and veterinary pathogens in ticks from Northeastern China. Front Microbiol. 2016. Vol. 7:1913

19. Zhao GP, Wang YX, Fan ZW, Ji Y, Liu MJ, Zhang WH, et al.. Mapping ticks and tick-borne pathogens in China. Nat Commun. 2021. Vol. 12:1075

20. Allen T, Murray KA, Zambrana-Torrelio C, Morse SS, Rondinini C, Di Marco M, et al.. Global hotspots and correlates of emerging zoonotic diseases. Nat Commun. 2017. Vol. 8:1124

21. Guo L, Ma J, Lin J, Chen M, Liu W, Zha J, et al.. Virome of Rhipicephalus ticks by metagenomic analysis in Guangdong, southern China. Front Microbiol. 2022. Vol. 13:966735

22. Tabara K, Arai S, Kawabuchi T, Itagaki A, Ishihara C, Satoh H, et al.. Molecular survey of Babesia microti, Ehrlichia species and Candidatus neoehrlichia mikurensis in wild rodents from Shimane Prefecture, Japan. Microbiol Immunol. 2007. Vol. 51:359–367

23. Casati S, Sager H, Gern L, Piffaretti JC. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann Agric Environ Med. 2006. Vol. 13:65–70

24. Aktas M, Ozubek S. Molecular evidence for trans-stadial transmission of Anaplasma platys by Rhipicephalus sanguineus sensu lato under field conditions. Med Vet Entomol. 2018. Vol. 32:78–83

25. Fourie JJ, Stanneck D, Luus HG, Beugnet F, Wijnveld M, Jongejan F. Transmission of Ehrlichia canis by Rhipicephalus sanguineus ticks feeding on dogs and on artificial membranes. Vet Parasitol. 2013. Vol. 197:595–603

26. Ipek NDS, Ozubek S, Aktas M. Molecular evidence for transstadial transmission of Ehrlichia canis by Rhipicephalus sanguineus sensu lato under field conditions. J Med Entomol. 2018. Vol. 28:440–444

27. Aguirre E, Tesouro MA, Ruiz L, Amusategui I, Sainz A. Genetic characterization of Anaplasma (Ehrlichia) platys in dogs in Spain. J Vet Med B Infect Dis Vet Public Health. 2006. Vol. 53(4):197–200

28. Antognoni MT, Veronesi F, Morganti G, Mangili V, Fruganti G, Miglio A. Natural infection of Anaplasma platys in dogs from Umbria region (Central Italy). Vet Ital. 2014. Vol. 50:49–56

29. Dyachenko V, Pantchev N, Balzer HJ, Meyersen A, Straubinger RK. First case of Anaplasma platys infection in a dog from Croatia. Parasit Vectors. 2012. Vol. 5:49

30. M’Ghirbi Y, Ghorbel A, Amouri M, Nebaoui A, Haddad S, Bouattour A. Clinical, serological, and molecular evidence of ehrlichiosis and anaplasmosis in dogs in Tunisia. Parasitol Res. 2009. Vol. 104:767–774

31. Breitschwerdt EB, Hegarty BC, Qurollo BA, Saito TB, Maggi RG, Blanton LS, et al.. Intravascular persistence of Anaplasma platys, Ehrlichia chaffeensis, and Ehrlichia ewingii DNA in the blood of a dog and two family members. Parasit Vectors. 2014. Vol. 7:298

32. Djiba ML, Mediannikov O, Mbengue M, Thiongane Y, Molez JF, Seck MT, et al.. Survey of Anaplasmataceae bacteria in sheep from Senegal. Trop Anim Health Prod. 2013. Vol. 45:1557–1561

33. Zobba R, Anfossi AG, Pinna Parpaglia ML, Dore GM, Chessa B, Spezzigu A, et al.. Molecular investigation and phylogeny of Anaplasma spp. in Mediterranean ruminants reveal the presence of neutrophil-tropic strains closely related to A. platys . Appl Environ Microbiol. 2014. Vol. 80:271–280

34. Remesar S, Prieto A, Garcia-Dios D, Lopez-Lorenzo G, Martinez-Calabuig N, Diaz-Cao JM, et al.. Diversity of Anaplasma species and importance of mixed infections in roe deer from Spain. Transbound Emerg Dis. 2022. Vol. 69:e374–e385

35. Wei W, Li J, Wang YW, Jiang BG, Liu HB, Wei R, et al.. Anaplasma platys-like infection in goats, Beijing, China. Vector Borne Zoonotic Dis. 2020. Vol. 20:755–762

36. Yu P, Liu Z, Niu Q, Yang J, Abdallah MO, Chen Z, et al.. Molecular evidence of tick-borne pathogens in Hyalomma anatolicum ticks infesting cattle in Xinjiang Uygur Autonomous Region, Northwestern China. Exp Appl Acarol. 2017. Vol. 73:269–281

37. Perez M, Bodor M, Zhang C, Xiong Q, Rikihisa Y. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann N Y Acad Sci. 2006. Vol. 1078:110–117

38. Wang J, Zhang J, Kelly P, Zheng X, Li M, You J, et al.. First description of the pathogenicity of Babesia vogeli in experimentally infected dogs. Vet Parasitol. 2018. Vol. 253:1–7

39. Schnittger L, Rodriguez AE, Florin-Christensen M, Morrison DA. Babesia: a world emerging. Infect Genet Evol. 2012. Vol. 12:1788–1809

40. Li XW, Zhang XL, Huang HL, Li WJ, Wang SJ, Huang SJ, et al.. Prevalence and molecular characterization of Babesia in pet dogs in Shenzhen, China. Comp Immunol Microbiol Infect Dis. 2020. Vol. 70:101452

41. Zheng W, Liu M, Moumouni PF, Liu X, Efstratiou A, Liu Z, et al.. First molecular detection of tick-borne pathogens in dogs from Jiangxi, China. J Vet Med Sci. 2017. Vol. 79:248–254

42. Wang J, Wang X, Sun H, Lv Z, Li Y, Luo J, et al.. Molecular evidence of piroplasm infection in companion animals in Hunan Province, China. BMC Vet Res. 2020. Vol. 16:297

43. Fukunaga M, Takahashi Y, Tsuruta Y, Matsushita O, Ralph D, McClelland M, et al.. Genetic and phenotypic analysis of Borrelia miyamotoi sp. nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lyme disease in Japan. Int J Syst Bacteriol. 1995. Vol. 45:804–810

44. Gaowa, Wulantuya, Sato K, Liu D, Cui Y, Yin X, et al.. Surveillance of Borrelia miyamotoi-carrying ticks and genomic analysis of isolates in Inner Mongolia, China. Parasit Vectors. 2021. Vol. 14:368

45. Jiang BG, Jia N, Jiang JF, Zheng YC, Chu YL, Jiang RR, et al.. Borrelia miyamotoi infections in humans and ticks, Northeastern China. Emerg Infect Dis. 2018. Vol. 24:236–241

46. Zhang XA, Tian F, Li Y, Zhang XL, Jiang BG, Liu BC, et al.. Molecular detection and identification of relapsing fever Borrelia in ticks and wild small mammals in China. Emerg Microbes Infect. 2022. Vol. 11:2632–2635