Visual and Rapid Detection of Escherichia coli O157:H7 in Stool Samples by FTA Card-based Loop-mediated Isothermal Amplification

Abstract

Objective:

Escherichia coli O157:H7 (E. coli O157:H7) can induce severe diseases in animals and humans that result in significant public health problems. Therefore, the development of rapid and visual detection methods to diagnose E. coli O157:H7 infections and monitor its prevalence is critical for the prevention and control purposes.

Methods:

A colorimetric loop-mediated isothermal amplification (LAMP) assay was utilized to detect E. coli O157:H7. A DNA extraction kit and Flinders Technology Associates (FTA) cards were used to extract nucleic acid in conjunction with colorimetric LAMP detection.

Results:

The method developed effectively distinguished E. coli O157:H7 from other pathogens with a detection limit of 25 CFU/mL in spiked stool samples. In addition, the nucleic acid of these samples was easily extracted and transported with an FTA card at room temperature. The entire detection process was completed within 35 min using simple constant-temperature equipment.

Conclusion:

The colorimetric LAMP method with FTA card-based nucleic acid purification was shown to rapidly detect E. coli O157:H7 with sensitivity and specificity. This visual method is expected to be widely used to control E. coli O157:H7 infections, particularly in resource-limited settings.

Main article text

INTRODUCTION

Escherichia coli O157:H7 (E. coli O157:H7) poses a significant threat to the health of poultry, such as ducks and chickens, causing a range of diseases, including egg peritonitis, perihepatitis, pericarditis, and salpingitis [1]. Additionally, consumption of foods or water contaminated by E. coli O157:H7 induces severe diseases and symptoms in human beings, such as abdominal pain, inflammation, diarrhea, and hemorrhagic colitis, particularly in vulnerable populations [2,3]. Therefore, it is critical to detect E. coli O157:H7 and monitor its prevalence in susceptible animals and human beings to minimize the adverse effects, which will ensure food safety, protect human and animal health, and avoid financial losses [4].

Various technologies have been established for the detection of E. coli O157:H7, including molecular methods (e.g., polymerase chain reaction [PCR]), cultivation and plant counting, and serologic testing. The PCR method provides exceptional precision and accuracy, but typically requires long temperature cycles, specialized equipment, and well-trained personnel [5,6]. Serologic tests can produce negative results in the acute phase of the disease because antibodies are typically generated 7-14 days after infection. Therefore, these methods are not ideal for the on-site detection of E. coli O157:H7, particularly in resource-limited settings.

Recently, isothermal amplification techniques, such as recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), and nucleic acid sequence-based amplification (NASBA), have been developed with advantages of rapid detection at constant reaction temperature [7,8]. Among the techniques, LAMP is user-friendly and has shown great potential for the detection of E. coli O157:H7 in resource-limited areas [9]. Although several techniques for LAMP results readout have been reported, the most popular readout, gel electrophoresis, is time-consuming and easily induces false-positive results from aerosol contamination of amplicons [7]. To overcome this challenge, fluorescence-based methods have been developed. Specifically, Huang et al. [10] developed a fluorescence-based LAMP assay with high sensitivity to detect E. coli O157:H7 (10 copies/mL) and reported good performance in 150 food samples. Fluorescence methods have good sensitivity, sophisticated and bulky equipment with optical filters to collect detection results are typically required, which is unattainable in resource-limited areas.

Sample preparation, including nucleic acid extraction, is a key point for on-site detection of E. coli O157:H7; however, there are still some challenges in detecting bacterial DNA in complex stool samples [11,12]. For example, stool samples contain complex microbial mixtures, including viruses, bacteria, fungi, and parasites, and the existence of different microbial communities makes it difficult to specifically distinguish target bacteria [12]. In addition, the organic components in stool samples, including complex polysaccharides, urates, bilirubin, and byproducts of bile salt decomposition, interfere with the function of DNA polymerase required for nucleic acid amplification. Many nucleases contained in stool samples can also degrade nucleic acid targets. When transporting samples to the laboratory for storage and analysis in the absence of a stable, available, and reliable power supply, the cold chain may be difficult to maintain, which may lead to a destructive freeze-thaw cycle [11]. To address these issues, the Flinders Technology Associates (FTA) card offers a potential solution [13]. The FTA card is a functional filter paper modified with denatured and chelating agents that not only lyse captured bacteria, but also immobilize the genomic DNA. The FTA card contains chemicals that lysate cells and denature proteins, and protects nucleic acids from oxidative, nuclease, and UV damage. The FTA card is widely used for nucleic acid extraction from bacterial samples and is known for the rapid purification process, ease of use, and versatility [14]. The suitability of the FTA card for the colorimetric LAMP assay of stool samples, however, is not well-established [15]. Consequently, this study aimed to develop straightforward, swift, and rapid detection of E. coli O157:H7 from stool samples using the FTA card-based colorimetric LAMP method.

MATERIALS AND METHODS

Materials and reagents

Luria-Bertani (LB) broth medium, LB agar medium, brain heart infusion (BHI) broth medium, the Whatman FTA card, an FTA purification reagent, 1×TE buffer (10 mM Tris-HCl and 1 mM EDTA; pH=8.0) were purchased from Sigma-Aldrich (Shanghai, China). The WarmStart^® Colorimetric LAMP 2X Master Mix was purchased from New England BioLabs (Ipswich, MA, USA). Rnase/Dnase-free water was purchased from Spark Jade (Shangdong, China). A 2-mm punch was purchased from Dongguan Allwin Stationery Co., Ltd. (Dongguan, China). A Trelief^® Bacteria Genomic DNA kit for bacterial DNA extraction was purchased from Tsingke (Beijing, China). LAMP primers were purchased from Tsingke. E. coli O157:H7, Listeria monocytogenes, Pseudomonas aeruginosa, and Salmonella enteritis were purchased from CICC (Beijing, China). A dry bath was purchased from Coyote Bioscience Yixing Co., Ltd. (Yixing, China). All chemicals used were of analytical grade or better.

Bacterial cultivation and DNA extraction

Single colonies of E. coli O157:H7, L. monocytogenes, P. aeruginosa, and S. enteritis from LB agar plates were incubated in 5 mL of LB broth medium at 37°C with shaking at 200r/min until the OD 600 reached 0.8-1.0. Genomic DNA of E. coli O157:H7, L. monocytogenes, P. aeruginosa, and S. enteritis were extracted from Trelief^® Bacteria Genomic DNA kits (Tsingke, Beijing, China) [16] or the Whatman FTA card, according to the manufacturer’s instructions. The bacterial DNA extracted from the Whatman FTA card was constructed using the following protocols: 1) a 2-mm punch was used to create a circular 2-mm FTA membrane, and the samples were added onto the membrane and dried at room temperature [17] (considering the efficiency of nucleic acid extraction by an FTA card and the suitability with PCR tubes, the most suitable diameter of FTA is 2 mm); 2) the FTA membrane was placed into a 1.5-mL tube and washed with 200 μL of the FTA purification reagent; and 3) the FTA membrane was further washed with 200 μL of 1×TE buffer (10 mM Tris-HCl and 1 mM EDTA; pH = 8.0), then dried at 56°C for 20 min before detection.

LAMP and PCR primers synthesis

The LAMP and PCR primers for the detection of E. coli O157:H7 were synthesized by Tsingke (Nanjing) and are listed in Table 1.

TABLE 1 |

LAMP and PCR primers of uidA.

Target pathogen	Target gene	Primer	Sequence (5′-3′)	Ref.
E. coli O157:H7	uidA	F3(LAMP)	CAGTAGAAACCCCAACCCG	[18]
		B3(LAMP)	ATACGCAGCACGATACGC
		FIP(LAMP)	TAACGCGCTTTCCCACCAACGGCCTGTGGGCATTCAGTC
		BIP(LAMP)	TAACGATCAGTTCGCCGATGCACTGCCCAACCTTTCGGTAT
		LF(LAMP)	TCCACAGTTTTCGCGATCCA
		LB(LAMP)	ACGTCTGGTATCAGCGCGAAGT
		F(PCR)	CAGTAGAAACCCCAACCCG
		R(PCR)	ATACGCAGCACGATACGC

Colorimetric LAMP reaction

The colorimetric LAMP reaction was carried out at 65°C for 35 min with specific LAMP primers in WarmStart^® Colorimetric LAMP 2X Master Mix (New England BioLabs). The images of results from colorimetric LAMP reactions were captured using a cellphone camera and the hue value change of each tube was extracted by applications of hue analysis (e.g., Adobe Photoshop 2021 or our custom Android app-dubbed “Hue Analyzer”), and analyzed by GraphPad Prism 8 [19]. Three sets of parallel repeated LAMP reactions were performed. A one-way ANOVA test of GraphPad Prism 8 was used for statistical analysis. Significance thresholds were as follows: *p < 0.05; **p < 0.01; ***p < 0.001; and ****p < 0.0001.

Sensitivity and specificity

To evaluate the sensitivity of the method developed, E. coli O157:H7 DNA was extracted from FTA membranes at different bacterial concentrations (2.5-2.5×10⁵ CFU/mL), which was quantified by bacterial culture and counting, and detected using the colorimetric LAMP method. To assess the specificity of the method, the DNA from E. coli O157:H7, L. monocytogenes, P. aeruginosa, and S. enteritis extracted from the FTA membrane was detected by the colorimetric LAMP assay with specific LAMP primers to E. coli O157:H7. Rnase/Dnase-free water was used as a negative control.

Pathogen detection using spiked human stool samples

The clinical samples were collected from Ruijin Hospital North (Shanghai Jiao Tong University School of Medicine, Shanghai, China) with Ethics Committee approval (No. 2017-02-01). The stool samples were spiked with different concentrations of E. coli O157:H7 bacteria (2.5-2.5×10⁵ CFU/mL). Then, the stool samples were smeared onto a 2-mm FTA membrane and dried at room temperature before nucleic acid extraction and colorimetric LAMP detection.

RESULTS

Establishment of FTA card-based colorimetric LAMP detection

In this study we utilized the FTA card for pathogen enrichment, cell lysis, collection, and purification of nucleic acids from human stool samples to develop a simple visual method (Fig 1) for the detection of E. coli O157:H7 from human stool samples by combining FTA-based nucleic acid sample preparation with colorimetric LAMP detection.

FIGURE 1 |

Schematic illustration of FTA card-based colorimetric LAMP detection.

E. coli O157:H7 DNA extracted from a commercial DNA extraction kit was first used to test the performance of colorimetric LAMP detection. As shown in Fig 2, the positive group exhibited a color change from pink-to-yellow, while the negative group remained pink. Our previous study demonstrated that hue value-based colorimetric detection outperforms traditional red, green, and blue (RGB)-based colorimetric assays [19]. Therefore, the images after the reaction were first captured by a cellphone camera, and the hue value change of each tube was extracted for analysis.

FIGURE 2 |

Colorimetric LAMP detection of E. coli O157:H7 using the DNA from a commercial extraction kit and FTA card-based assay. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. All the experiments were repeated three times.

Next, the performance of the established FTA-based colorimetric LAMP detection was determined by comparison with the method using a DNA extraction kit. As shown in Fig 2, the detection result was consistent with the LAMP assay based on a commercial DNA extraction kit.

Sensitivity and specificity

The sensitivity of the colorimetric LAMP detection method with FTA card-based DNA extraction was first evaluated by detecting different concentrations of E. coli O157:H7 (2.5-2.5×10⁵ CFU/mL). As shown in Fig 3A, the established FTA card-based colorimetric LAMP detection achieved a sensitivity of 25 CFU/mL within 35 min.

FIGURE 3 |

Sensitivity and specificity of the FTA card-based colorimetric LAMP detection. A. Sensitivity of E. coli O157:H7 detection at different concentrations. B. Selectivity of E. coli O157:H7 detection. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001; NTC, no template control. All the experiments were repeated three times.

To determine the specificity of the FTA card-based colorimetric LAMP method, E. coli O157:H7, L. monocytogenes, P. aeruginosa, and S. enteritis were detected. As shown in Fig 3B, only E. coli O157:H7 was detected with the specific LAMP primers of E. coli O157:H7.

Detection of E. coli O157:H7 in stool samples

The ability of the developed FTA card-based colorimetric LAMP method to detect E. coli O157:H7 in stool samples was determined. The clinical human stool samples collected from Ruijin Hospital North were directly detected or spiked with concentrations of E. coli O157:H7 (2.5-2.5×10⁵ CFU/mL) and detected by the established method. As shown in Fig 4, the simple, rapid, and visual detection of E. coli. O157:H7 was achieved within 35 min, with excellent sensitivity at a limit of detection (LOD) of 25 CFU/mL. In addition, the detection results were in good agreement with the PCR assay results (Table 2), which verified the reliability of the developed method.

FIGURE 4 |

FTA card-based colorimetric LAMP detection of E. coli O157:H7 in spiked human stool samples. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001; NTC, no template control. All the experiments were repeated three times.

TABLE 2 |

Comparison of detection E. coli O157:H7 results in stool samples by PCR and FTA card-based colorimetric LAMP detection.

Stool samples		PCR	LAMP colorimetric assay (this study)
Clinical stool samples	1	-	-
	2	-	-
	3	-	-
	4	-	-
	5	-	-
	6	+	+
	7	+	+
	8	-	-
	9	-	-
	10	-	-
	11	-	-
	12	-	-
	13	-	-
	14	-	-
	15	-	-
	16	+	+
	17	-	-
Spiked stool samples	0 CFU/mL	-	-
	2.5 CFU/mL	-	-
	25 CFU/mL	+	+
	2.5×102 CFU/mL	+	+
	2.5×103 CFU/mL	+	+
	2.5×104 CFU/mL	+	+
	2.5×105 CFU/mL	+	+

+: detected; -: not detected.

DISCUSSION

E. coli O157:H7 is an important zoonotic pathogen that is usually detected by laboratory tests, such as DNA sequencing, enzyme-linked immunosorbent assay (ELISA), and PCR, which typically require well-trained professionals, complicated procedures, and expensive equipment. In addition, sample preparation, such as nucleic acid extraction, is usually constructed by commercial kits with a centrifuge, which is also a major challenge for the rapid, visual, and on-site detection of E. coli O157:H7, especially in resource-limited areas [17]. Of note, the FTA card has recently emerged as a solution for collecting, transporting, and purifying nucleic acids [17,20]. Herein a visual and rapid detection of E. coli O157:H7 method was developed by combining FTA card-based nucleic acid extraction and the LAMP colorimetric assay.

Compared to the gold standard method (PCR) for the detection of E. coli O157:H7 from stool samples, the assay we developed not only achieved higher sensitivity (25 CFU/mL) in a shorter time (35 min) without complex sample preparation, operation, reaction, and analysis steps, but was also tolerant to PCR inhibitors and reduced interference to the reaction [18,21]. Remarkably, our approach only requires a compact, portable, and lightweight dry bath, eliminating the requirement for cumbersome and complicated equipment. Furthermore, the FTA card-based bacteria concentration and DNA extraction effectively lysed and deactivated cells, denatured proteins, and stabilized nucleic acids, allowing for long-term storage at room temperature [15]. Therefore, the FTA card-based colorimetric detection shows great potential for clinical screening and monitoring of E. coli O157:H7, particularly in recourse-limited settings.

CONCLUSIONS

In conclusion, an FTA card-based colorimetric LAMP assay has been successfully developed for the simple and rapid detection of E. coli O157:H7 with satisfactory sensitivity and selectivity. This method offers several advantages, including the ability to perform nucleic acid extraction and transport without complex equipment, as well as the ability to read the results visually. Moreover, this method achieved high sensitivity (LOD=25 CFU/mL) and excellent specificity within 35 min; in contrast, the conventional PCR requires 1.5 h. In addition, the detection results of FTA card-based colorimetric LAMP detection agreed well with the results from the PCR assay. With the design of specific primers, the method can also be applied for the detection of other pathogens in the stool. In the future this study is expected to align with the recent advances in the detection of E. coli O157:H7, including digital [22], integrated [23], and portable analysis systems [24]. This method shows promise as a valuable diagnostic tool for the clinical detection and monitoring of zoonotic infections, which also offers significant potential for on-site detection, particularly in resource-limited settings.

CONFLICTS OF INTEREST

The authors declare no conflicts of interest.

REFERENCES

1. Kathayat D, Lokesh D, Ranjit S, Rajashekara G. Avian pathogenic Escherichia coli (APEC): an overview of virulence and pathogenesis factors, zoonotic potential, and control strategies. Pathogens. 2021. Vol. 10(4):467

2. Bai Z, Xu X, Wang C, Wang T, Sun C, Liu S, et al.. A comprehensive review of detection methods for Escherichia coli O157:H7. TrAC Trends Anal Chem. 2022. Vol. 152:116646

3. Zhang XX, Liu JS, Han LF, Xia S, Li SZ, Li OY, et al.. Towards a global One Health index: a potential assessment tool for One Health performance. Infect Dis Poverty. 2022. Vol. 11(1):57

4. Chen F, Hu Q, Li H, Xie Y, Xiu L, Zhang Y, et al.. Multiplex detection of infectious diseases on microfluidic platforms. Biosensors (Basel). 2023. Vol. 13(3):410

5. Xie Y, Li H, Chen F, Srisruthi Udayakumar S, Arora K, Chen H, et al.. Clustered regularly interspaced short palindromic repeats-based microfluidic system in infectious diseases diagnosis: current status, challenges, and perspectives. Adv Sci. 2022. Vol. 9:2204172

6. Li H, Xie Y, Chen F, Bai H, Xiu L, Zhou X, et al.. Amplification-free CRISPR/Cas detection technology: challenges, strategies, and perspectives. Chem Soc Rev. 2023. Vol. 52:361–382

7. Nguyen HA, Lee NY. Polydopamine aggregation: a novel strategy for power-free readout of loop-mediated isothermal amplification integrated into a paper device for multiplex pathogens detection. Biosens Bioelectron. 2021. Vol. 189:113353

8. Vural Kaymaz S, Ergenc AF, Aytekin AO, Lucas SJ, Elitas M. A low-cost, portable, and practical LAMP device for point-of-diagnosis in the field. Biotechnol Bioeng. 2022. Vol. 119(3):994–1003

9. Trinh KTL, Trinh TND, Lee NY. Fully integrated and slidable paper-embedded plastic microdevice for point-of-care testing of multiple foodborne pathogens. Biosens Bioelectron. 2019. Vol. 135:120–128

10. Huang T-T, Liu S-C, Huang C-H, Lin C-J, Huang S-T. An integrated real-time electrochemical LAMP device for pathogenic bacteria detection in food. Electroanalysis. 2018. Vol. 30(10):2397–2404

11. Papaiakovou M, Pilotte N, Baumer B, Grant J, Asbjornsdottir K, Schaer F, et al.. A comparative analysis of preservation techniques for the optimal molecular detection of hookworm DNA in a human fecal specimen. PLoS Negl Trop Dis. 2018. Vol. 12(1):e0006130

12. Eppinger M, Almeria S, Allue-Guardia A, Bagi LK, Kalalah AA, Gurtler JB, et al.. Genome sequence analysis and characterization of Shiga toxin 2 production by Escherichia coli O157:H7 strains associated with a laboratory infection. Front Cell Infect Microbiol. 2022. Vol. 12:888568

13. Trinh KTL, Stabler RA, Lee NY. Fabrication of a foldable all-in-one point-of-care molecular diagnostic microdevice for the facile identification of multiple pathogens. Sens Actuators B Chem. 2020. Vol. 314:128057

14. Wang S, Cai G, Duan H, Qi W, Lin J. Automatic and multi-channel detection of bacteria on a slidable centrifugal disc based on FTA card nucleic acid extraction and recombinase aided amplification. Lab Chip. 2021. Vol. 22(1):80–89

15. Kim SA, Park SH, Lee SI, Ricke SC. Rapid and simple method by combining FTA card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples. Lett Appl Microbiol. 2017. Vol. 65(6):482–488

16. Trelief® Bacteria Genomic DNA Kit. https://www.masterbio.shop/product/detail/6752Accessed on April 2, 2023

17. Yin K, Ding X, Xu Z, Li Z, Wang X, Zhao H, et al.. Multiplexed colorimetric detection of SARS-CoV-2 and other pathogens in wastewater on a 3D printed integrated microfluidic chip. Sens Actuators B Chem. 2021. Vol. 344:130242

18. Lee S, Khoo VSL, Medriano CAD, Lee T, Park SY, Bae S, et al.. Rapid and in-situ detection of fecal indicator bacteria in water using simple DNA extraction and portable loop-mediated isothermal amplification (LAMP) PCR methods. Water Res. 2019. Vol. 160:371–379

19. Yin K, Pandian V, Kadimisetty K, Ruiz C, Cooper K, You J, et al.. Synergistically enhanced colorimetric molecular detection using smart cup: a case for instrument-free HPV-associated cancer screening. Theranostics. 2019. Vol. 9(9):2637–2645

20. Thompson MM, Hrabak EM. Capture and storage of plant genomic DNA on a readily available cellulose matrix. Biotechniques. 2018. Vol. 65(5):285–287

21. Han S, Soylu MC, Kirimli CE, Wu W, Sen B, Joshi SG, et al.. Rapid, label-free genetic detection of enteropathogens in stool without genetic isolation or amplification. Biosens Bioelectron. 2019. Vol. 130:73–80

22. Choi Y, Song Y, Kim YT, Lee SJ, Lee KG, Im SG. Multifunctional printable micropattern array for digital nucleic acid assay for microbial pathogen detection. ACS Appl Mater Interfaces. 2021. Vol. 13(2):3098–3108

23. Song Y, Kim YT, Choi Y, Kim H, Yeom MH, Kim Y, et al.. All-in-one DNA extraction tube for facilitated real-time detection of infectious pathogens. Adv Healthc Mater. 2021. Vol. 10(14):e2100430

24. Choi Y, Song Y, Kim YT, Park YM, Im SG, Lee KG, et al.. All-in-one pumpless portable genetic analysis microsystem for rapid naked-eye detection. Sens Actuators B Chem. 2021. Vol. 344:130307