0
views
0
recommends
+1 Recommend
1 collections
    0
    shares
      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      Molecular identification of Wolbachia and Sodalis glossinidius in the midgut of Glossina fuscipes quanzensis from the Democratic Republic of Congo Translated title: Identification moléculaire de Wolbachia et Sodalis glossinidius dans l’intestin moyen de Glossina fuscipes quanzensis de la République Démocratique du Congo

      Read this article at

      ScienceOpenPublisherPMC
      Bookmark
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          During the last 30 years, investigations on the microbiome of different tsetse species have generated substantial data on the bacterial flora of these cyclical vectors of African trypanosomes, with the overarching goal of improving the control of trypanosomiases. It is in this context that the presence of Wolbachia and Sodalis glossinidius was studied in wild populations of Glossina fuscipes quanzensis from the Democratic Republic of Congo. Tsetse flies were captured with pyramidal traps. Of the 700 Glossina f. quanzensis captured, 360 were dissected and their midguts collected and analyzed. Sodalis glossinidius and Wolbachia were identified by PCR. The Wolbachia-positive samples were genetically characterized with five molecular markers. PCR revealed 84.78% and 15.55% midguts infected by Wolbachia and S. glossinidius, respectively. The infection rates varied according to capture sites. Of the five molecular markers used to characterize Wolbachia, only the fructose bis-phosphate aldolase gene was amplified for about 60% of midguts previously found with Wolbachia infections. The sequencing results confirmed the presence of Wolbachia and revealed the presence of S. glossinidius in the midgut of Glossina f. quanzensis. A low level of midguts were naturally co-infected by both bacteria. The data generated in this study open a framework for investigations aimed at understanding the contribution of these symbiotic microorganisms to the vectorial competence of Glossina fuscipes quanzensis.

          Translated abstract

          Au cours des 30 dernières années, les recherches sur le microbiome de différentes espèces de glossines ont généré des données substantielles sur la flore bactérienne de ces vecteurs cycliques des trypanosomes africains, l’objectif principal étant d’améliorer le contrôle des trypanosomiases. C’est dans cette optique que la présence de Wolbachia et Sodalis glossinidius a été étudiée dans des populations sauvages de Glossina fuscipes quanzensis de la République démocratique du Congo. Les glossines ont été capturées avec des pièges pyramidaux. Parmi les 700 Glossina f. quanzensis capturés, 360 ont été disséqués et leur estomac récupéré et analysé. Sodalis glossinidius et Wolbachia ont été identifiés par PCR. Les échantillons positifs pour Wolbachia ont été génétiquement caractérisés avec cinq marqueurs moléculaires. La PCR a révélé que 84,78 % et 15,55 % de l’intestin moyen étaient respectivement infectés par Wolbachia et S. glossinidius. Les taux d’infection variaient selon les sites de capture. Sur les cinq marqueurs moléculaires utilisés pour caractériser Wolbachia, seul le gène de la fructose bis-phosphate aldolase a été amplifié pour environ 60 % des intestins moyens précédemment identifiés porteurs de Wolbachia. Les résultats du séquençage ont confirmé la présence de Wolbachia et ont révélé la présence de S. glossinidius dans l’intestin moyen de Glossina f. quanzensis. Un faible taux des intestins moyens était naturellement co-infecté par les deux bactéries. Les données de cette étude ouvrent un cadre pour des recherches visant à comprendre la contribution de ces microorganismes symbiotiques sur la compétence vectorielle de Glossina fuscipes quanzensis.

          Related collections

          Most cited references 39

          • Record: found
          • Abstract: found
          • Article: not found

          Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica.

          Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica are closely related Gram-negative beta-proteobacteria that colonize the respiratory tracts of mammals. B. pertussis is a strict human pathogen of recent evolutionary origin and is the primary etiologic agent of whooping cough. B. parapertussis can also cause whooping cough, and B. bronchiseptica causes chronic respiratory infections in a wide range of animals. We sequenced the genomes of B. bronchiseptica RB50 (5,338,400 bp; 5,007 predicted genes), B. parapertussis 12822 (4,773,551 bp; 4,404 genes) and B. pertussis Tohama I (4,086,186 bp; 3,816 genes). Our analysis indicates that B. parapertussis and B. pertussis are independent derivatives of B. bronchiseptica-like ancestors. During the evolution of these two host-restricted species there was large-scale gene loss and inactivation; host adaptation seems to be a consequence of loss, not gain, of function, and differences in virulence may be related to loss of regulatory or control functions.
            Bookmark
            • Record: found
            • Abstract: found
            • Article: not found

            Multilocus sequence typing system for the endosymbiont Wolbachia pipientis.

            The eubacterial genus Wolbachia comprises one of the most abundant groups of obligate intracellular bacteria, and it has a host range that spans the phyla Arthropoda and Nematoda. Here we developed a multilocus sequence typing (MLST) scheme as a universal genotyping tool for Wolbachia. Internal fragments of five ubiquitous genes (gatB, coxA, hcpA, fbpA, and ftsZ) were chosen, and primers that amplified across the major Wolbachia supergroups found in arthropods, as well as other divergent lineages, were designed. A supplemental typing system using the hypervariable regions of the Wolbachia surface protein (WSP) was also developed. Thirty-seven strains belonging to supergroups A, B, D, and F obtained from singly infected hosts were characterized by using MLST and WSP. The number of alleles per MLST locus ranged from 25 to 31, and the average levels of genetic diversity among alleles were 6.5% to 9.2%. A total of 35 unique allelic profiles were found. The results confirmed that there is a high level of recombination in chromosomal genes. MLST was shown to be effective for detecting diversity among strains within a single host species, as well as for identifying closely related strains found in different arthropod hosts. Identical or similar allelic profiles were obtained for strains harbored by different insect species and causing distinct reproductive phenotypes. Strains with similar WSP sequences can have very different MLST allelic profiles and vice versa, indicating the importance of the MLST approach for strain identification. The MLST system provides a universal and unambiguous tool for strain typing, population genetics, and molecular evolutionary studies. The central database for storing and organizing Wolbachia bacterial and host information can be accessed at http://pubmlst.org/wolbachia/.
              Bookmark
              • Record: found
              • Abstract: found
              • Article: found
              Is Open Access

              Wolbachia Stimulates Immune Gene Expression and Inhibits Plasmodium Development in Anopheles gambiae

              Introduction Wolbachia pipientis is an intracellular maternally inherited bacterial symbiont of invertebrates that is very common in insects, including a number of mosquito species [1], [2]. It can manipulate host reproduction in several ways, including cytoplasmic incompatibility (CI), whereby certain crosses are rendered effectively sterile. Females that are uninfected produce infertile eggs when they mate with males that carry Wolbachia, while there is a ‘rescue’ effect in Wolbachia-infected embryos such that infected females can reproduce successfully with any males. Therefore uninfected females suffer a frequency-dependent reproductive disadvantage. Wolbachia is able to rapidly invade populations using this powerful mechanism [3]–[5]. A strain of Wolbachia called wMelPop has been identified that over-replicates in somatic tissues and roughly halves the lifespan of laboratory Drosophila melanogaster [6]. A transinfection of wMelPop from Drosophila into the mosquito Aedes aegypti also leads to a similarly shortened lifespan in the lab, as well as inducing strong CI, which has made it a very promising candidate for the development of new strategies for controlling mosquito-borne diseases [7]. All mosquito-borne pathogens require an extrinsic incubation period before they can be transmitted that is relatively long (∼9 days for malaria) compared to mean mosquito lifespan in the field; therefore, a reduction in the number of old individuals in the population will reduce disease transmission [8]–[11]. We recently found that the presence of wMelPop also produces a major upregulation of a large number of immune genes in Ae. aegypti and inhibits the development of filarial nematode worm parasites [12]. We hypothesized that the two effects are functionally related – higher levels of immune effectors in wMelPop-infected mosquitoes render them better able to kill parasites [12]. Homologs of some of the Ae. aegypti genes that are upregulated in the presence of wMelPop have been previously shown to have the ability to regulate development of Plasmodium parasites in Anopheles, for example a transgene encoding cecropin-A/a synthetic cecropin-B of Hyalophora cecropia; the NF-κB-like transcription factor Rel2 controlling the Imd pathway; and TEP (Thioester containing) opsonization proteins [13]–[20]. It has recently been shown that the wMelPop-infected Ae. aegypti line has impaired ability to transmit an avian malaria, Plasmodium gallinaceum [21]. It is possible that these effects of wMelPop could be particular to the Ae. aegypti transinfection; however, if comparable upregulation of orthologous immune genes, and inhibition of Plasmodium development are also seen in the important Anopheles vectors of human malaria, it may provide a stimulus to the development of new Wolbachia-based malaria control strategies. To address this question we used Anopheles gambiae, the most important vector of malaria in Africa, which like Ae. aegypti is not naturally infected with Wolbachia. The creation of stably inherited lines of An. gambiae is likely to require a long period of microinjection and selection, as had to be performed for Ae. aegypti [7]. However, in advance of the successful creation of an An. gambiae stable transinfection, the effects of the presence of wMelPop on immunity and malaria transmission can be tested using an established wMelPop-infected An. gambiae cell line [22] and the ability to create somatic lifetime infections of Wolbachia in adult female mosquitoes by intrathoracic inoculation [23], [24]. The wMelPop strain forms disseminated somatic infections in its natural Drosophila host [6], in common with some but not all Wolbachia strains [25]. Given that a) Plasmodium parasites will travel solely through somatic tissues on their journey to the salivary glands, and b) that many of the known antimalarial immune effectors are humoral/systemic, we consider that the creation of somatic infections of Wolbachia via adult inoculation represents a useful model for stably inherited germline-associated infections. To examine this hypothesis further, we also created somatic wMelPop infections in Ae. aegypti, in order to compare the magnitude of the effects on mosquito immunity and filarial nematode parasite development with those observed in the stably wMelPop-transinfected line. Results Immune gene expression in An. gambiae Given that a stable wMelPop infection of An. gambiae does not yet exist, it was necessary to create transient somatic infections by intrathoracic innoculation with purified Wolbachia. RNA from these transinfected females was then tested for expression levels of six immune genes, and upregulation of all these genes was observed compared to buffer injected and E. coli - injected controls (Figure 1). Of these genes, LRIM1 and TEP1 (whose products have been shown to interact in the opsonisation response) have previously been shown to have an important inhibitory or antagonistic effect on Plasmodium development [18]–[20]. Importantly, injected mosquitoes were left for eight days before Plasmodium challenge or qRT-PCR, and therefore the pulse of immune gene upregulation caused by the injury itself or by the E. coli challenge would be expected to have already passed [15]. 10.1371/journal.ppat.1001143.g001 Figure 1 Immune gene expression in An. gambiae somatically infected with wMelPop. The expression of six immune genes were analyzed by qRT-PCR: leucine-rich repeat immune protein, LRIM1; thioester-containing protein, TEP1; cecropin, CEC1; defensin, DEF1; C-type lectin, CTL4; and clip-domain serine protease, CLIPB3. Adult An. gambiae females were injected with E. coli, wMelPop or the buffer alone, 2–3 days post-eclosion, and RNA was extracted from these adults eight days after injection. Expression was normalized to non-injected adult females of the same age from the same colony. Error bars show the SEM of three biological replicates, each containing eight adult females (total of 24 mosquitoes per condition). The wMelPop infected cell line MOS55 [22] showed upregulation of all six selected immune genes compared to an uninfected cell line created by tetracycline curing of infected MOS55 (Figure 2). These data add confidence to the hypothesis that it is the presence of wMelPop itself that is inducing immune gene upregulation, and by extension Plasmodium inhibition, and that these effects are not artefacts of the intrathoracic injection process. The degree of upregulation was different for some genes in the cell line than observed for the somatic in vivo transinfection. However these differences would be expected given that many immune genes are primarily expressed in particular cell types/organs in adult mosquitoes, such as the fat body cells or in the case of TEP1, the haemocytes [18], and the cellular composition of this larval-derived cell line is unknown. 10.1371/journal.ppat.1001143.g002 Figure 2 Immune gene expression in the An. gambiae wMelPop-infected MOS55 cell line. The expression of six immune genes as described for Figure 1 were analyzed by qRT-PCR, for the An. gambiae MOS55 cell culture infected with wMelPop, normalized to expression of these genes in a tetracycline treated, wMelPop free, genetically identical, MOS55 cell culture. Three samples of cells were taken from the cultures at different times; error bars show the SEM of these three samples. Effects on the development of Plasmodium berghei Three Plasmodium berghei challenge experiments were conducted on transiently Wolbachia-infected A. gambiae females compared to buffer injected, uninjected, and in one case E. coli-injected controls (Figure 3a–c). In all three experiments highly significant reductions in intensity of oocyst infection in the wMelPop transinfected females were observed compared to the other treatments, while there were no significant differences between any of the control treatments within each experiment. Mean P. berghei intensities were reduced in the wMelPop-infected mosquitoes by between 75% and 84% compared to the corresponding buffer injected control groups. A further experiment confirmed the lack of any significant differences in intensity between the E. coli-injected, buffer injected and uninjected controls (data not shown). 10.1371/journal.ppat.1001143.g003 Figure 3 An. gambiae somatically infected with wMelPop: challenges with Plasmodium berghei. Each panel represents an independent experiment showing mean numbers of oocysts per midgut (parasite intensities), comparing An. gambiae challenged with P. berghei eight (A–C) or five (D) days after intrathoracic innoculation with, in A–C, Wolbachia wMelPop compared to buffer (BI) and non-injected (NI) controls plus in C E. coli (EI); and in (D) Wolbachia+dsLacZ (WLI), Wolbachia+dsTEP1 (WTI) and NI. Parasite survival was determined by oocyst counting on day 10 post infection. In A–C significant reductions in intensity were observed in WI females compared to the NI, BI and EI controls: ***P 50% reduction in mean numbers of L3 compared to the Wolbachia-uninfected control at the same microfilarial challenge density [12]. Using quantitative PCR comparing three groups of two mosquitoes with the single copy genes ftsZ (Wolbachia) and Actin5C (Ae. aegypti) for normalization, we estimated that there were approximately 176±70 times more wMelPop cells in the stably infected line compared to the somatic infections. This may explain this reduced effect on gene upregulation. Therefore we conclude that intrathoracic inoculation can be a valuable way to test the effects of Wolbachia on host immunity and pathogen transmission. Although extrapolations to different mosquito species and parasites must be made with care, it does seem likely that the effects observed for somatic Wolbachia infections using the methodology reported here are likely to be smaller than for a stable inherited infection, and thus that the estimations made may be conservative. 10.1371/journal.ppat.1001143.g004 Figure 4 Immune gene expression and challenges with Brugia pahangi in Ae. aegypti somatically infected with wMelPop, and effects of immune knockdown on Wolbachia density. A) The expression of four immune genes were analyzed by qRT-PCR: a peptidoglycan recognition protein, PGRPS1; cecropin D, CECD; CLIP-domain serine protease, CLIPB37; and a C-type galactose-specific lectin. Adult females were injected with wMelPop or the buffer alone, approximately seven days post-eclosion. RNA was extracted from these adults eight days after injection. Expression was normalized to non-injected adult females of the same age from the same colony. Error bars show the SEM of three biological replicates, each containing eight adult females (total of 24 mosquitoes per condition). B) The mean numbers of L3 stage (infective) larvae per mosquito are shown following B. pahangi challenge in Ae. aegypti Refm strain previously injected with wMelPop or buffer; * P<0.05. Numbers above bars show the prevalence of filarial infection as a proportion of mosquitoes that contained at least one L3 Brugia larva over the total number of mosquitoes dissected in each category. C) We measured the levels Wolbachia ftsZ gene expression as a proxy for Wolbachia density and normalized the qRT-PCR data to the mosquito Actin5C gene. Two sets of three females per time point injected with either dsLacZ or dsRel2 were assayed. ftsZ gene expression was found to be higher in dsRel2-injected mosquitoes than in dsLacZ-injected mosquitoes at both six and ten days post injection. The mean level of Rel2 transcript in dsRel2-injected mosquitoes was confirmed to be approximately 40% of that in dsLacZ injected mosquitoes at both time points. These data suggest that the immune effectors controlled by the Imd pathway (Rel2-controlled) can influence Wolbachia densities. An experiment to test whether the immune upregulation observed in wMelPop-infected mosquitoes affects the density of the Wolbachia itself was conducted using the stable inherited infection of wMelPop in an Ae. aegypti Refm background [7], [12]. Wolbachia ftsZ gene expression (used as a proxy for Wolbachia density) was found to be higher in dsRel2-injected than in dsLacZ-injected mosquitoes at both day six and day ten post-injection (Figure 4c). These data suggest that the immune effectors controlled by the Imd (Rel2-controlled) pathway can influence Wolbachia densities. The very high rate of maternal transmission observed in wMelPop-infected Ae. aegypti [7], despite chronic immune upregulation, means that the biological significance of this density difference is unknown, although potentially it could act to limit wMelPop pathogenicity to some degree. More comprehensive experiments addressing this question will make use of transgenic immune knockdown lines infected with wMelPop, which are currently being produced, and are expected to enable the effects of stronger and more long lasting immune pathway knockdown to be investigated. Discussion The data reported strongly support the hypothesis that wMelPop can inhibit the development of Plasmodium in Anopheles malaria vector mosquitoes. The An. gambiae/P. berghei combination, although not one that occurs in nature, does represent a tractable and well studied model for which considerable information is already available about Plasmodium killing mechanisms; however we recognize the challenge experiments will ultimately need to be repeated with the far less tractable human parasite P. falciparum once a stably inherited Wolbachia transinfected line of An. gambiae has been created. The densities of P. berghei used in laboratory challenges such as these can be high compared to those of P. falciparum that would occur in nature, although the mean intensities recorded in these studies lie within the range recorded for P. falciparum in the field. The significant reductions in intensity we recorded in laboratory experiments are considered likely to translate to significant reductions in oocyst prevalence/transmission in a real-life setting. The knockdown experiment provided evidence for a major role of TEP1, and by extension LRIM1 whose products interact as part of the same opsonization pathway [20], in the inhibition of P. berghei development. This is the first time a direct link between the Wolbachia pathogen inhibition and immune upregulation phenotypes has been made. A more detailed and exhaustive investigation of the relative contributions of different components of the Anopheles immune system to Plasmodium killing can be made once stable inherited Wolbachia infections have been established. Taken together with the recent report of reduction in P. gallinaceum development in wMelPop-infected Ae. aegypti [21], the data increase the desirability of creating stably inherited wMelPop transinfections in important malaria vectors. The potential combination of lifespan shortening and direct inhibition of Plasmodium development in the mosquito would represent a very attractive control strategy, since both of these phenotypes are critical components of malaria vectorial capacity. A simple model exploring relative contributions of these two parameters to vectorial capacity is shown in Figure 5. Though lifespan reduction and Plasmodium inhibition can each substantially reduce the vectorial capacity of a mosquito population, together they act synergistically to reduce transmission. Depending on the scale of lifespan reduction that would be observed under field conditions, which is as yet unknown, the Plasmodium inhibition effect could dramatically increase the efficacy of the wMelPop infection in reducing malaria transmission. 10.1371/journal.ppat.1001143.g005 Figure 5 Model of possible effects of wMelPop on malaria vectorial capacity. Vectorial capacity is a measure that describes the transmission potential of a mosquito population and is independent of Plasmodium prevalence. It can be thought of as proportional to the number of infectious bites that occur per day after a single infectious human arrives in a previously malaria-free area. If we assume recruitment to the adult mosquito stage is constant then vectorial capacity can be written (A b (1−μ)τ)/μ where b is the ability of the mosquito to transmit Plasmodium, μ is adult daily survival, τ is the length of the intrinsic incubation period of the Plasmodium and all other parameters are combined in A [42]. The figure plots vectorial capacity as transmission (b) and daily survival (μ) are each reduced because of the presence of Wolbachia by a multiplicative factor (1−x) where x varies in the range 0 to 1 (parameters: b = 1; μ = 0.1; τ = 1; A = 1). A more advanced analysis tailored to a specific system might want to include age-specific adult mortality, the effect of Wolbachia on mosquito population dynamics and seasonality. Other Wolbachia strains might also show malaria inhibition effects, particularly if they reach high somatic densities and/or induce large-scale immune stimulation. Here we show that the use of transient somatic infections of Wolbachia by adult female inoculation followed by pathogen challenge is a valuable means to test likely effects on immunity and transmission. This is significant as it allows comparison and selection of strains for the most desirable properties prior to the lengthy, and technically very challenging, process of creating stably inherited Anopheles transinfections. If other Wolbachia strains can be identified which also inhibit Plasmodium transmission, they would represent an attractive alternative to wMelPop if they do not shorten lifespan to the same extent, since they are therefore likely to have much lower fitness costs. Only the wMelPop strain has to date been found to produce a strong life-shortening phenotype. Laboratory estimates suggest that transinfection of wMelPop in Aedes aegypti can reduce fitness by around 50% [7]. This would appear to make it difficult for this strain of Wolbachia to spread by means of CI through natural populations [26], particularly where populations are fragmented. However, fitness estimates made in relatively benign laboratory conditions, where a comparatively large fraction of the population become old, can overestimate the relative costs of infection. In the field most mosquitoes die early and few live long enough to experience higher Wolbachia-induced mortality (although those that do are significant to disease control, if they would otherwise have lived long enough to transmit the infection). As shown in Figure 5 reductions in longevity and Plasmodium inhibition together determine vectorial capacity and it will also be important to understand the joint effects of the two phenotypes on mosquito fitness in the field. Detailed knowledge of the demographics of the target species is also important [27]. Selective pressures acting on the host would likely modulate the life-shortening phenotype over time, but this may not occur rapidly enough to prevent a sustained period of disease control. Wolbachia is now known to inhibit the dissemination or development of a variety of insect pathogens and insect-borne pathogens – various Drosophila pathogenic viruses, dengue and chikungunya viruses of humans, and filarial nematode parasites in addition to Plasmodium [12], [21], [28]–[31]. Some of these pathogen-inhibition phenotypes have been reported in Drosophila species that naturally harbour Wolbachia, in other words they are not restricted to species such as Ae. aegypti or An. gambiae in which Wolbachia forms a novel transinfection. On a broader level these Wolbachia cases can be added to various other examples where bacterial symbionts have been shown to provide protective effects against one or more pathogens [32], [33], although the mechanisms involved are likely to be diverse. Parallels can also be drawn with the effects of entomopathogenic fungi, which can both reduce Anopheles lifespan and directly inhibit Plasmodium development [34]–[36]. Pathogen inhibition represents a new and increasingly significant component of our understanding of the effects of Wolbachia in insects, and provides excellent prospects for the development of novel malaria control strategies. Materials and Methods Ethics statement All procedures involving animals were approved by the ethical review committee of Imperial College and by the United Kingdom Government (Home Office), and were performed in accordance with United Kingdom Government (Home Office) and EC regulations. Somatic wMelPop infections Wolbachia wMelPop was purified from the infected An. gambiae cell line MOS55 [22], [37] as previously described [23], [24]. This protocol has previously been shown to allow Wolbachia replication in the recipient An. gambiae [24]. Cells obtained from one 75 CM2 flask were re-suspended in 100 µL of Schneider medium without antibiotics (optical density, OD = 0.09). 69 nL of this Wolbachia suspension (or 69 nL Schneider for the controls) were microinjected into the thorax of young An. gambiae females of the G3 strain or Ae. aegypti females of the Refm strain [38] using an Nanoject microinjector (Drummond). The mosquitoes were supplied with 10% sucrose ad libitum and left to recover for at least eight days prior to qRT-PCR or challenge experiments. A similar OD of 0.1 for E. coli was used to inject another set of controls. qRT-PCR and qPCR Gene expression levels were monitored using qRT-PCR. Total RNA was extracted with Trizol reagent from groups of ten An. gambiae or Ae. aegypti females maintained at 26°C and 70% relative humidity, and cDNAs were synthesised from 1 µg of total RNA using SuperScript II enzyme (Invitrogen). qRT-PCR was performed on a 1 to 20 dilution of the cDNAs using dsDNA dye SYBR Green I. Reactions were run on a DNA Engine thermocycler (MJ Research) with Chromo4 real-time PCR detection system (Bio-Rad) using the following cycling conditions: 95°C for 15 minutes, then 45 cycles of 95°C for 10s, 59°C for 10s, 72°C for 20s, with fluorescence acquisition at the end of each cycle, then a melting curve analysis after the final one. The cycle threshold (Ct) values were determined and background fluorescence was subtracted. Gene expression levels of target genes were calculated, relative to the internal reference gene Actin5C or RS17 for Ae. aegypti and RS7R for An. gambiae. Primers were designed using Vectorbase (www.vectorbase.org) mosquito gene sequences/orthology criteria, and the wMel genome sequence [39], since wMel and wMelPop are closely related [40]. Primer pairs used to detect target gene transcripts are listed in Table 1. 10.1371/journal.ppat.1001143.t001 Table 1 Oligonucleotide primers used in quantitative PCR experiments and dsRNA synthesis. Gene Name Accession no. Forward Primer Reverse Primer An. gambiae CEC1 AGAP000693 CCAGAGACCAACCAACCACCAA GCACTGCCAGCACGACAAAGA DEF1 AGAP011294 CATGCCGCGCTGGAGAACTA GATAGCGGCGAGCGATACAGTGA LRIM1 AGAP006348 CATCCGCGATTGGGATATGT CTTCTTGAGCCGTGCATTTTC TEP1 AGAP010815 CGCCCAGGAGCGTACGTTGG CCTGGCGAACAGACCCAAGCTG CTL4 AGAP005335 ATCGGAATGTCGATCGCTAC CTGTCCGGCGATCAAACTAT CLIPB3 AGAP003249 CAGATTGTCGTCCACACTGG GCTCAGGGGCAGACAGATAG RS7R AGAP010592 AGAACCAGCAGACCACCATC GCTGCAAACTTCGGCTATTC dsRNA-Tep1 [17] AGAP010815 TAATACGACTCACTATAGGGTTTGTGGGCCTTAAAGCGCTG TAATACGACTCACTATAGGGACCACGTAACCGCTCGGTAAG Ae. aegypti PGRPS1 AAEL009474 TGGAGCGACATTGGTTACAA GCGATGCCAATCGACTTACT CECD AAEL000598 GCTAGGTCAAACCGAAGCAG TCCTACAACAACCGGGAGAG CLIPB37 AAEL005093 TTGGGGGAAAACAGAAACAG GATCTGCTTCCCAGAGAACG Galactose-specific CTL AAEL005641 GTCTCCGGGTGCAATACACT CCCTATCGTTCCACTTCCAA Actin5C AAEL011197 ATCGTACGAACTTCCCGATG ACAGATCCTTTCGGATGTCG RpS17 AAEL004175 CAGGTCCGTGGTATCTCCAT CAGGACATCATCGAAGTCGA Rel2 [43] AAEL007624 GGACGAGGCAGCGGCGCAGTTTGAGC TCCAGAGGGCCGAGATAAGTTCC dsRNA-Rel2 [43] AAEL007624 TAATACGACTCACTATAGGGACCGGTGGAAGTGCTC TAATACGACTCACTATAGGGCCCCGATCTCCGTTAT Wolbachia wMel ftsZ WD_0723 TGATGCTGCAGCCAATAGAG TCAATGCCAGTTGCAAGAAC E. coli dsRNA-LacZ EG10527 TAATACGACTCACTATAGGGAGAATCCGACGGGTTGTTACT TAATACGACTCACTATAGGGCACCACGCTCATCGATAATTT Previously published oligonucleotides are indicated by the reference number following the gene name. The density of Wolbachia in somatic and stable infections of Ae. aegypti was estimated using both qPCR and qRT-PCR. DNA was extracted using the Livak method and qRT-PCR or qPCR equipment and protocols were the same as those described above. The single copy genes ftsZ (Wolbachia) and Actin5C and S7 (Ae. aegypti) were used to estimate relative numbers of Wolbachia normalized against the mosquito genome. Plasmodium berghei challenge experiments General parasite maintenance was carried out as previously described [41]. P. berghei ANKA 2.34 parasites were maintained in 4–10-week-old female Theiler's Original (TO) mice by serial mechanical passage (up to a maximum of eight passages). Hyper-reticulocytosis was induced 2–3 days before infection by treating mice with 200µL i.p. phenylhydrazinium chloride (6mg/ml in PBS; ProLabo UK). Mice were infected by intraperitoneal (i.p.) injection and infections were monitored on Giemsa-stained tail blood smears. In four independent experiments, individual 4–10 week old Theiler's Original (TO) mice were treated with 200µL i.p. phenylhydraziuium chloride (PH; 6mg/ml in PBS; ProLabo UK) to induce hyper-reticulocytosis. Three days later mice were injected by intraperitoneal (i.p.) injection with 106 parasites of P. berghei ANKA 2.34 as described previously [41]. Three days post mouse infection, batches of 100 starved Anopheles gambiae strain G3 females, eight days post injection with Wolbachia, buffer, E. coli or uninjected controls, were allowed to feed on the infected mice. 24h after feeding, mosquitoes were briefly anesthetized with CO2, and unfeds removed. Mosquitoes were then maintained on fructose [8% (w/v) fructose, 0.05% (w/v) p-aminobenzoic acid] at 19–22°C and 50–80% relative humidity. At day 10 post-feeding, mosquito midguts were dissected, and oocyst numbers (intensity) and prevalence recorded. The Kruskal-Wallis test was used to compare oocyst counts (intensity of infection) and Fisher's exact test for prevalence (percentage of mosquitoes containing at least one oocyst). Gene knockdown experiments T7-tailed primers (see Table 1) were used to amplify fragments of the TEP1 and REL2 gene from female cDNA template or the LacZ gene from E. coli total DNA. dsRNA was synthesized using the T7 Megascript kit (Ambion) and adjusted to a concentration of 3 or 4 µg/µl in RNAse free water for dsREL2 and dsTEP1 respectively. For REL2 KD 69nl of dsRNA were injected per female mosquito, For TEP1-wolbachia KD 69 nl of a mix of 2 parts dsRNA to 1 part of purified wMelPop in Schneider's medium (OD 0.3) were injected into the thorax of CO2 anesthetized female An. gambiae mosquitoes (total ∼200 per group). Five days after injection (in order to still fall within the gene knockdown period), mosquitoes were fed on a Plasmodium infected mouse. Brugia pahangi filarial nematode challenge Ae. aegypti mosquitoes of the filaria-susceptible Refm strain were fed on sheep blood containing 23 B. pahangi microfilaria per µL eight days post Wolbachia innoculation, plus buffer-injected controls of the same age; any females that did not feed properly were removed. Dissections were carried out 10 days after the infective blood meal under a dissecting stereomicroscope. Kruskal-Wallis tests were used to compare counts of B. pahangi L3 (infective stage larvae).
                Bookmark

                Author and article information

                Journal
                Parasite
                Parasite
                parasite
                Parasite
                EDP Sciences
                1252-607X
                1776-1042
                2019
                07 February 2019
                : 26
                : ( publisher-idID: parasite/2019/01 )
                Affiliations
                [1 ] Molecular Parasitology and Entomology Unit, Department of Biochemistry, Faculty of Science, University of Dschang PO Box 67 Dschang Cameroon
                [2 ] Institute of Health and Society, Université Catholique de Louvain Clos Chapelle-aux-Champs 30 1200 Woluwe-Saint-Lambert Brussels Belgium
                [3 ] Department of Biomedical Sciences, Institute of Tropical Medicine Nationalestraat 155 2000 Antwerp Belgium
                [4 ] Department of Animal Biology and Physiology, Faculty of Science, University of Yaoundé I PO Box 812 Yaoundé Cameroon
                [5 ] Mission Spéciale d’Eradication des Glossines Division Régionale Tsé-Tsé Adamaoua PO Box 263 Ngaoundéré Cameroon
                [6 ] Institut national de recherche biomédicale Kinshasa Avenue de la démocratie N°5345 Gombe Kinshasa Democratic Republic of Congo
                [7 ] UMR 177, IRD-CIRAD, CIRAD TA A-17/G, Campus International de Baillarguet Montpellier Cedex 5 France
                [8 ] Center for Research on Filariasis and other Tropical Diseases (CRFILMT) PO Box 5797 Yaoundé Cameroon
                [9 ] University of Yaoundé I, Faculty of Science PO Box 812 Yaoundé Cameroon
                [10 ] Department of Tropical Medicine, University of Kinshasa B.P. 127 Kinshasa XI Democratic Republic of Congo
                Author notes
                [* ]Corresponding author: gsimoca@ 123456yahoo.fr
                Article
                parasite180128 10.1051/parasite/2019005
                10.1051/parasite/2019005
                6366345
                30729921
                © G. Simo et al., published by EDP Sciences, 2019

                This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                Page count
                Figures: 3, Tables: 4, Equations: 0, References: 50, Pages: 10
                Categories
                Research Article

                Comments

                Comment on this article