Introduction Individuals with compromised immune systems are at high risk for acquired invasive fungal infections. Aspergillus fumigatus, the etiological agent of invasive pulmonary aspergillosis (IPA), is a ubiquitous mold that causes severe, invasive, life-threatening disease in patients who are severely immunocompromised. Disease acquisition includes such risk factors as neutropenia and impaired neutrophil function and myeloablative-immunosuppressive therapies associated with hematopoietic stem-cell transplantation [1]. Despite available anti-fungal therapy, the prognosis of IPA remains poor, and mortality ranges from 30% to 90% [2,3]. This is thought to be due in part to the relatively small arsenal of effective anti-fungal drugs, some of which cause severe nephrotoxicity—specifically, amphotericin B, which is associated with response rates of between 10% and 40% [4]. IPA has risen dramatically over the past several decades due to the consistent increase in immunosuppressed patients, and by the early 1990s 60% of invasive fungal infections diagnosed at autopsy were IPA [5]. It must also be stated that IPA is not only associated with stem-cell transplantation, but also presents in whole-organ transplantation, primarily lung and heart, with mortality rates of 68% to 78% [6]. A. fumigatus is also the etiological agent of allergic bronchopulmonary aspergillosis, an allergic airway disease characterized by persistent bronchial inflammation and bronchiectasis [7]. Upon inhalation of A. fumigatus conidia from the environment, alveolar macrophages rapidly ingest and attempt to clear the invading pathogen. Conidia that escape the fungicidal activities of alveolar macrophages begin to germinate, leading to the rapid recruitment of neutrophils, which subsequently promote anti-hyphal defenses [8,9]. A major focus in innate immunity and host-pathogen interactions in the past decade has been elucidation of the receptors involved in the recognition and response to pathogens, the most characterized of which are the toll-like receptors (TLRs). However, in the context of macrophage–A. fumigatus interactions, there is no clear role for the TLRs in recognition and responsiveness. TLR2 and TLR4 are the most studied. However, the data on TLR2 are conflicting in that several reports have shown roles for and against its importance in host defense against this pathogen. For example, macrophages from TLR2−/− mice produce less tumor necrosis factor-α (TNF-α) [10] and CXCL2/MIP-2 [11] in response to A. fumigatus, whereas antibody-mediated blockage of TLR2 had no effect on TNF-α production [12] and TLR2−/− mice challenged with A. fumigatus survived better than wild-type control mice and had higher lung levels of TNF-α [13]. A role for TLR4 in the inflammatory response to A. fumigatus conidia, but not hyphae, has also been demonstrated [14,15], suggesting that TLR4 is critical for recognition of different A. fumigatus morphologies. TLR4−/− mice challenged with A. fumigatus have increased susceptibility compared with control mice [13], although this is not associated with defects in TNF-α production, as it was unaffected by TLR4−/− deficiency [13]. Other studies show that TLR4 signaling is essential for the anti-fungal effector activity of neutrophils [16], but not Kupffer cells [17], against both conidia and hyphae of A. fumigatus. In addition, many of these studies investigating the role of TLRs and A. fumigatus recognition have not been performed with alveolar macrophages, and thus it is uncertain if the mechanisms described are representative of these cells, which have a unique phenotype. Non-TLRs are also important in innate recognition of A. fumigatus. The cell wall of A. fumigatus is known to contain galactomannan moieties that are thought to be covalently linked to the non-reducing ends of beta-1,3–glucan side chains [18]. Accordingly, several studies have described mannose- or mannan-specific receptors in the uptake of A. fumigatus conidia by phagocytic cells [19]. Studies have identified the C-type lectin DC-SIGN (dendritic-cell-specific, ICAM-3-grabbing nonintegrin) as being involved in the binding of A. fumigatus conidia to human macrophages and dendritic cells [20]. The A. fumigatus cell wall is also rich in beta-1,3–glucan moieties, and although receptors for these carbohydrates, including CR3, have been implicated, the role of these receptors in innate immune response to this organism is unclear [21]. We have previously shown that recognition of cell-wall beta glucan plays an important role in the induction of inflammatory mediators by macrophage populations in response to Pneumocystis carinii and Candida albicans [22,23]. Dectin-1 is a 43-kDa, type II transmembrane receptor containing a single cytoplasmic immunoreceptor tyrosine activation motif and is the predominant macrophage receptor for beta-1,3 glucans [23–25]. As dectin-1 is highly expressed on resident alveolar macrophages, we examined the role of this receptor in response to A. fumigatus, and show here that dectin-1 is centrally involved in generating inflammatory responses to specific morphological forms of this organism both in vitro and in vivo. Results/Discussion Dectin-1 Is Involved in the Macrophage Cytokine and Chemokine Response to A. fumigatus Extensive reports have shown that zymosan, a beta-glucan–rich, yeast-derived particle, and the beta-glucan–containing fungal organisms C. albicans and P. carinii [22,25] bind to the dectin-1 beta-glucan receptor leading to phagocytosis and proinflammatory cytokine production [25,26]. A. fumigatus similarly possesses a cell wall significantly made up of beta glucans [18]; thus, we questioned whether macrophage interactions with A. fumigatus involved dectin-1. The results in Figure 1A show that RAW 264.7 cells, a macrophage cell line that was established from a tumor induced by Abelson murine leukemia virus [27], can produce a number of cytokines and chemokines in response to live A. fumigatus after 24 h of co-culture, and that this response is greatly enhanced in RAW 264.7 macrophages transduced to over-express dectin-1. In both cell types, inhibition of dectin-1 function with the monoclonal antibody 2A11 [26] significantly blocked these responses. Control experiments stimulated RAW 264.7 cells with the TLR ligands LPS and Pam(3)Cys in the presence or absence of 2A11. Results showed that dectin-1–blockage did not impair the TNF-α and MIP-2 response to these stimulants (unpublished data). Thus, dectin-1 can recognize and respond to live A. fumigatus. Innate immune cells of the lung, particularly alveolar macrophages, are critical for recognizing and reacting to A. fumigatus [8,9]. Since we have previously shown that dectin-1 is expressed at high levels on alveolar macrophages [22,28], we assessed their response to live A. fumigatus. The results in Figure 1B and 1C show that co-culture of live A. fumigatus with alveolar macrophages for 24 h led to production of TNF-α, CCL3/MIP-1α, CXCL2/MIP-2, IL-1β, IL-1α, IL-6, G-CSF, and GM-CSF, all of which were significantly attenuated by blocking dectin-1 with the monoclonal antibody 2A11 [26]. We observed little spontaneous production of cytokines and chemokines by unstimulated alveolar macrophages (e.g., spontaneous production of TNF-α, CCL3/MIP-1α, and CXCL2/MIP-2 was 54.7 ± 20, 186 ± 45, and 122 ± 25 pg/ml, respectively). T helper type-1 cell-mediated immunity is essential for optimal pulmonary host defense against fungal infections [29]. Innate cells, such as alveolar macrophages, play a central role in aiding the development of T helper type-1 responses [29]. In our studies, we found that alveolar macrophages stimulated with A. fumigatus had dectin-1–dependent induction of IFN-γ (Figure 1D), suggesting that dectin-1–ligation by A. fumigatus may also promote the generation of T helper type-1 immunity. IL-12 was also induced by A. fumigatus, but not found to be dectin-1–dependent (233 ± 83 pg/ml and 71 ± 22 pg/ml for isotype and 2A11, respectively, p = 0.0902). We also observed dectin-1–dependent induction of IL-10, a critical cytokine for regulating the pulmonary inflammatory response [30]. Previous studies indicated that cytochalasin D–treated macrophages stimulated with the fungal particle zymosan had enhanced TNF-α production, indicating that internalization was not required for dectin-1–mediated cytokine and chemokine production in RAW macrophages [23]. Although zymosan is employed as a representative fungal particle, it is not clear whether its use predicts the subsequent events associated with dectin-1 ligation by a live, intact fungal organism such as A. fumigatus. Experimental studies have shown that unstimulated alveolar macrophages are quite efficient at internalizing A. fumigatus conidia, a process that requires actin polymerization [31,32]. We questioned whether blocking actin polymerization would affect the ability of alveolar macrophages to produce inflammatory mediators in response to A. fumigatus. We found that alveolar macrophages pretreated with cytochalasin D retained the inflammatory response to live A. fumigatus (Figure 1E), and that the production of TNF-α, MIP-1α, and MIP-2 was exacerbated. Fluorescent deconvolution microscopy performed to assess the internalization of A. fumigatus in vehicle versus cytochalasin D-treated alveolar macrophages indicated efficient uptake of fluorescein isothiocyanate–conjugated conidia in vehicle-treated, but not cytochalasin D–treated, alveolar macrophages [20,31,32] (Figure S1). We did not observe non-specific induction of cytokines/chemokines by unstimulated alveolar macrophages in the presence of cytochalasin D. Moreover, lactate dehydrogenase (LDH) analysis of co-culture supernatants indicated that cytochalasin D concentration employed in these studies was not cytotoxic to alveolar macrophages (unpublished data). The heightened response in cytochalasin D-treated cultures is likely to be a result of prolonged stimulation at the cell surface, as observed previously with zymosan [33]. These results therefore suggest that alveolar macrophage cytokine and chemokine production in response to live A. fumigatus is mediated by dectin-1 and does not require organism uptake. Role of TLR2 in Dectin-1–Dependent Alveolar Macrophage Responses to A. fumigatus Dectin-1–mediated inflammatory responses to the fungal particle zymosan have been shown to be dependent on TLR2 [23,34]. However, the role of TLR2 in the inflammatory response to A. fumigatus is less clear, with reports both supporting and arguing against its role in the inflammatory response [10–13]. To address the role of dectin-1 in TLR2-mediated responses to A. fumigatus, we co-cultured alveolar macrophages isolated from wild-type C57BL/6 and TLR2−/− mice with A. fumigatus for 24 h, followed by analysis of cytokine and chemokine levels in co-culture supernatants. Data presented in Table 1 indicate that only TNF-α production was significantly affected (p 98% enriched for alveolar macrophages. A. fumigatus-macrophage co-culture for cytokine and chemokine induction. Alveolar macrophages or RAW-dectin macrophages [23] (3 × 105) were pre-treated with the anti–dectin-1 antibody 2A11 (5 μg/ml) or isotype for 30 min [26] and thereafter co-cultured with A. fumigatus conidia at a ratio of 1:1 for various times in a 96-well plate at 37 °C, 5% CO2. Controls included alveolar or RAW macrophages cultured in medium alone. Thereafter, the contents of each well were collected and the supernatants analyzed for IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IL-12p40, IL-12p70, IL-17, IFN-γ, GM-CSF, G-CSF, TNF-α, MIP-1α, RANTES, and KC levels using the Bio-Plex Protein Array System (Bio-Rad, Hercules, California, United States) as per manufacturer's instructions. MIP-2 concentrations were determined using a commercially available ELISA kit (R&D Systems, Minneapolis, Minnesota, United States) as per manufacturer's instructions. To determine the response to SC, A. fumigatus RC were cultured for 6 h at 37 °C, 5% CO2 and allowed to swell [10,31,42]. Thereafter, macrophages were added for an additional 4 h. Controls for these studies included alveolar macrophages added to RC for 4 h. To determine the response to A. fumigatus hyphae, A. fumigatus conidia were cultured for 24 h at 37 °C, 5% CO2 prior to the addition of macrophages for 4 h, 8 h, or 24 h. Spontaneous cytokine and chemokine production in unstimulated cultures was subtracted from stimulated cultures in order to calculate the net concentration induced by A. fumigatus. To determine whether macrophage cell death occurred in co-cultures, supernatants were analyzed for LDH levels using an LDH kit (Sigma, St. Louis, Missouri, United States) as per manufacturer's instructions. Caspase 3 levels in cell lysates were also analyzed using the EnzChek Caspase 3 Assay Kit containing the rhodamine 110 bis-(N-CBZ-L-aspartyl-Lglutamyl-L-valyl-L-aspartic acid amide) (Z-DEVD–R110) substrate (Molecular Probes, Eugene, Oregon, United States) as per manufacturer's instructions. In specific experiments, macrophages were pretreated with cytochalasin D (10 μM), 250 μg/ml mannan (both from Sigma, St. Louis, Missouri, United States), or 100 μg/ml glucan phosphate [23,26] for 30 min at room temperature prior to addition to RC or SC. For analysis of responses to heat-killed A. fumigatus, A. fumigatus conidia were cultured for 3 h, 6 h, or 9 h at 37 °C, 5% CO2 followed by heat-killing at 100 °C for 10 min [10]. Thereafter, heat-killed A. fumigatus were co-cultured with alveolar macrophages at a ratio of 1:1 for 6 h at 37 °C, 5% CO2 in a 96-well plate. Some experiments employed A. fumigatus organisms killed by 70% ethanol treatment for 30 min at room temperature. All killed A. fumigatus were plated onto potato dextrose agar at 37 °C for 48 h to confirm negative growth. In specific experiments, RAW 264.7 macrophages were cultured with LPS (100 ng/ml) or Pam(3)Cys (10 μg/ml) (both from InvivoGen, San Diego, California, United States) in the presence or absence of 2A11 for 16 h, followed by analysis of cytokine and chemokine levels in supernatants. Analysis of A. fumigatus internalization. Alveolar macrophages were isolated as described above and adhered to poly-L-lysine-coated glass slides (Polysciences Inc., Warrington, Pennsylvania, United States) for 60 min at 37 °C. After being washed, separated slides were incubated with dimethyl sulfoxide (DMSO, vehicle) or cytochalasin D (10 μM) for 60 min at 37 °C, followed by incubation for 60 min with fluorescein isothiocyanate-labeled A. fumigatus conidia (0.1 mg/ml FITC for 60 min at room temperature) [20]. After being washed, slides were counterstained with 4,6-diamidino-2-phenylindole,dihydrochloride (DAPI, Molecular Probes, Eugene, Oregon, United States) nucleic-acid stain (0.4 μg/ml, 10 min at room temperature), followed by application of Prolong (Molecular Probes) mounting media. Slides were analyzed on a Zeiss Axioplan 2 upright fluorescent deconvolution microscope (Carl Zeiss, Oberkochen, Germany), and images were captured using 3I Slidebook Version 4.0 software (Optical Analysis, Nashua, New Hampshire, United States). s-Dectin-Fc constructs. Two soluble fusion proteins consisting of the extracellular domain of murine dectin-1 fused with either the heavy chain of murine IgG1 (s-dectin-mFc) or a mutated Fc portion of human IgG1 (s-dectin-hFc) were constructed. For s-dectin-mFc, cDNA encoding the extracellular domain of dectin-1, consisting of amino acids 69 to 244 [25], was amplified from a PCR 3.1 plasmid encoding the full-length murine dectin-1 receptor using the primers GGGTACCGACGACACAATTCAGGG and GGATCCACGCGGAACCAGCAGTTCCTTCTCACAG. The cDNA encoding CH2-CH3 murine IgG1 regions were amplified using the primers CTGGTTCCGCGTGGATCCGTGCCCAGGGATTGTGGT and GAATTCTCATTTACCAGGAGAGTG from the pACCKP2 plasmid containing the TNF receptor extracellular domain linked to murine IgG1 heavy chain [43]. For the s-dectin-hFc construct, the pSecTag2 (Invitrogen) plasmid containing a mutated Fc portion of human IgG1 [38] was used. The products were combined at a 1:1 ratio, and PCR was performed using the 5′ dectin-1 primer and the 3′ IgG1 primer. The chimeric PCR product was isolated and purified via gel extraction and was subcloned into the TOPO-TA Vector (Invitrogen). Using M13 Forward and Reverse primers, the s-dectin-Fc DNAs were amplified via PCR and digested with KpnI and EcoRI and inserted in-frame into the multiple cloning site of pSecTag2 C mammalian expression vector (Invitrogen), containing the Igκ-leader sequence, facilitating protein secretion. To verify fusion protein expression, the pSecTag2 s-dectin-mFc or s-dectin-hFc constructs were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen). Western blotting of supernatants from transfected cells revealed a 120-kD product on non-reducing SDS-PAGE that reacted with either anti-human IgG1 or anti-murine IgG1. For analysis of the effects of s-dectin-hFc on cytokine and chemokine production, alveolar macrophages were co-cultured with A. fumigatus conidia at a ratio of 1:1 for 24 h in the presence or absence of s-dectin-hFc (10 μg/ml) in a 96-well plate at 37 °C, 5% CO2. Controls included alveolar macrophages cultured in medium alone. Thereafter, the contents of each well were collected and the supernatants analyzed for cytokines and chemokines by Bio-Plex (Bio-Rad, Hercules, California, United States). Analysis of A. fumigatus, beta-glucan exposure. A. fumigatus RC were adhered for 2 h, 6 h, 10 h, or 24 h to sterile, round glass coverslips and incubated in the presence or absence of conditioned media containing s-dectin-mFc followed by Cy3-conjugated, goat anti-mouse IgG1. After being washed, the coverslips were mounted onto glass slides and Prolong mounting media (Molecular Probes) was applied. The coverslips were analyzed on a Zeiss Axioplan 2 upright fluorescent deconvolution microscope (Zeiss), and images were captured using 3I Slidebook Version 4.0 software. In vivo A. fumigatus challenge. Mice were lightly anesthetized with isoflurane and held in a vertical, upright position. A. fumigatus conidia, 5 × 106 in a volume of 50 μl, in the presence or absence of s-dectin-hFc (40 μg/ml) was administered to mice via the caudal oropharynx. At 24 h post-inoculation, mice were anesthetized with intraperitoneal pentobarbital, sacrificed by exsanguination, and a BAL was performed. The first ml of BAL fluid was collected, the supernatant clarified by centrifugation, and stored at −80 °C until use in Bio-Plex (Bio-Rad) assays. For total BAL-fluid cell determinations, the cell pellet from each individual sample was resuspended in 1 ml of tissue culture media and enumerated by a hemacytometer using trypan blue dye exclusion. To determine neutrophil counts in BAL fluid, 2.5 × 104 cells from each lavage pellet was cytospun onto slides and stained with Diff-Quik (Fisher Scientific, Pittsburgh, Pennsylvania, United States). Thereafter, percentages of lymphocytes, macrophages, and neutrophils were determined in blinded fashion. To determine A. fumigatus lung burden, lungs were excised from non-lavaged untreated and s-dectin-hFc–treated mice and homogenized using a Polytron PT1200E tissue homogenizer (Kinematica, Newark, New Jersey, United States). Serial 1:10 dilutions were plated onto potato dextrose agar, and CFU/lung were determined after 24 h at 37 °C. Statistics. Data were analyzed using StatView statistical software (Brainpower, Calabasas, California, United States). Comparisons between groups were made with analyses of variance and appropriate ad hoc testing. The two-tailed unpaired t test or the two-tailed nonparametric Mann-Whitney test was employed. Significance was accepted at p < 0.05. Supporting Information Figure S1 Internalization of A. fumigatus by Alveolar Macrophages (142 KB PDF) Click here for additional data file.
