Transcription factor Nr4a1 couples sympathetic and inflammatory cues in CNS-recruited macrophages to limit neuroinflammation.

There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

Abstract

The molecular mechanisms that link the sympathetic stress response and inflammation remain obscure. Here we found that the transcription factor Nr4a1 regulated the production of norepinephrine (NE) in macrophages and thereby limited experimental autoimmune encephalomyelitis (EAE), a mouse model of multiple sclerosis. Lack of Nr4a1 in myeloid cells led to enhanced NE production, accelerated infiltration of leukocytes into the central nervous system (CNS) and disease exacerbation in vivo. In contrast, myeloid-specific deletion of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, protected mice against EAE. Furthermore, we found that Nr4a1 repressed autocrine NE production in macrophages by recruiting the corepressor CoREST to the Th promoter. Our data reveal a new role for macrophages in neuroinflammation and identify Nr4a1 as a key regulator of catecholamine production by macrophages.

Related collections

Most cited references 40

Record: found
Abstract: found
Article: not found

Infiltrating monocytes trigger EAE progression, but do not contribute to the resident microglia pool.

Bahareh Ajami, Jami Bennett, Charles Krieger … (2011)

In multiple sclerosis and the experimental autoimmune encephalitis (EAE) mouse model, two pools of morphologically indistinguishable phagocytic cells, microglia and inflammatory macrophages, accrue from proliferating resident precursors and recruitment of blood-borne progenitors, respectively. Whether these cell types are functionally equivalent is hotly debated, but is challenging to address experimentally. Using a combination of parabiosis and myeloablation to replace circulating progenitors without affecting CNS-resident microglia, we found a strong correlation between monocyte infiltration and progression to the paralytic stage of EAE. Inhibition of chemokine receptor-dependent recruitment of monocytes to the CNS blocked EAE progression, suggesting that these infiltrating cells are essential for pathogenesis. Finally, we found that, although microglia can enter the cell cycle and return to quiescence following remission, recruited monocytes vanish, and therefore do not ultimately contribute to the resident microglial pool. In conclusion, we identified two distinct subsets of myelomonocytic cells with distinct roles in neuroinflammation and disease progression.

0 comments Cited 433 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: not found

T cell receptor signal strength in Treg and iNKT cell development demonstrated by a novel fluorescent reporter mouse

Amy E Moran, Keli Holzapfel, Yan Xing … (2011)

T cells encounter several checkpoints as they develop, and their fate often relies on the strength of signal perceived by the antigen receptor. For example, CD4+CD8+ double-positive (DP) thymocytes with low affinity for self-peptide MHC (pMHC) ligands undergo positive selection, whereas those with high affinity undergo negative selection (Starr et al., 2003). Multiple studies suggest that DP thymocytes are exquisitely sensitive and exhibit a broader range of recognition of pMHC than mature T cells (Davey et al., 1998; Lucas et al., 1999). Nonetheless, mature T cells continue to perceive low-affinity self-pMHC ligands in the periphery, and these interactions are essential for survival and effector function (Kirberg et al., 1997; Stefanová et al., 2002; Lo et al., 2009). Thus, the ability of the TCR to distinguish pMHC ligands of different affinity is a fundamental principal of immunological tolerance and homeostasis. Although the affinity model explains the lineage commitment of a majority of T cell progenitors, some T cell subsets seem to have survived strong TCR signals during development as displayed by their activated phenotype (Baldwin et al., 2004; Kronenberg and Rudensky, 2005; Kronenberg and Gapin, 2007). CD4+Foxp3+ regulatory T cells (Treg cells), invariant NKT cells (iNKT cells), and CD8αα+ intraepithelial lymphocytes (IELs) are hypothesized to be positively selected via strong TCR signals in the thymus (Leishman et al., 2002; Godfrey et al., 2004; Zhou et al., 2004). In the case of Treg cells, Jordan et al. (2001) first demonstrated that expression of a neo-self-antigen in the thymus of mice with TCRs specific for that antigen promoted the development of Treg cells. Yet use of a TCR with an intrinsically lower affinity for the same neo-self-antigen failed to select Treg cells, suggesting a role for strong TCR signals. Moreover, T cells transduced with TCRs cloned from Treg cells underwent homeostatic expansion in lymphopenic recipients to a greater extent than cells transduced with receptors cloned from conventional T cell (Tconv cell) CD4 T cells, which is consistent with the idea that Treg cells recognize self-pMHC more avidly (Hsieh et al., 2006). Studies of the TCR repertoire from Treg and Tconv CD4 T cells illustrated that they are equally diverse but different from each other (Hsieh and Rudensky, 2005). However, these TCR repertoires were not entirely unique; thus, others have suggested that Treg cells are not shaped by agonistic interaction with self but rather by some stochastic event (Pacholczyk et al., 2006, 2007). In addition, when Treg TCR transgenics were created, no overt thymic clonal deletion was observed (Bautista et al., 2009; Leung et al., 2009), nor was self-reactivity evident. Thus, it remains unclear precisely what type of TCR signals are involved in Treg cell development in the thymus. iNKT cells are CD1d-restricted αβ T cells that recognize lipid antigens. In the steady-state, they have a memory phenotype and have been proposed to develop after agonist or stimulatory interaction with a lipid self-ligand in the thymus, yet the precise ligand remains unidentified (Kronenberg and Gapin, 2007). Finally, CD8αα IELs have an activated phenotype and were increased in transgenic models in which the cognate stimulatory antigen was also present (Leishman et al., 2002). Thus, the term agonist selection has been applied to all three subsets, indicating encounter with a stimulatory (presumed high affinity) TCR ligand during development. Short of cloning TCRs and identifying the selecting ligand in the thymus, it is difficult to know if a given T cell perceives a strong or weak TCR signal during development. Therefore, we sought to make a reporter mouse in which the level of a fluorescent protein reflects the strength of antigen receptor signal. We generated a transgenic mouse in which we inserted GFP into the Nr4a1 (Nur77) locus of a bacterial artificial chromosome (BAC). Nur77 is an immediate early gene up-regulated by TCR stimulation in thymocytes and T cells (Osborne et al., 1994). It is an orphan nuclear receptor whose function in T cells is not completely understood, although data suggest it may play a role in thymocyte apoptosis (Cainan et al., 1995; Cho et al., 2003). In a microarray screen, we showed that thymocytes undergoing both positive and negative selection induced Nr4a1 but to different expression levels (Baldwin and Hogquist, 2007). Thymocytes undergoing positive selection showed a twofold increase in Nr4a1 expression, whereas those undergoing negative selection showed a 10-fold increase. Together, these observations suggested that a Nur77 reporter mouse might be a useful system for understanding the role of TCR signal strength during T cell development. In this study, we report that GFP is up-regulated by antigen receptor stimulation in Nur77GFP mice, but unlike CD69, another common marker of T cell activation, it is not induced by inflammatory stimuli. Furthermore, the level of GFP expressed during acute activation reflects the strength of TCR stimulation, and the low basal level of GFP expressed in mature naive T cells is dependent on continued interaction with MHC. We applied this novel tool to study the TCR signal strength perceived by different T cell subsets during development. RESULTS A Nur77GFP transgenic mouse reports antigen receptor activation in lymphocytes To create a fluorescent reporter that would be activated by antigen receptor signaling in lymphocytes, we inserted a GFP-Cre fusion protein at the start codon of the Nr4a1 (Nur77) gene in a BAC (Fig. 1 A). The Cre recombinase gene was included for fate mapping experiments that are not reported in this study. One B6 × SJL F1 and two C57BL/6J founders were generated. Each founder expressed a slightly different overall level of GFP, but the pattern of expression was identical, and endogenous Nur77 expression was consistent with GFP expression (Fig. S1 A). All three showed normal lymphoid and myeloid development (unpublished data). A subset of myeloid lineage cells in the spleen expressed high levels of GFP in the steady-state (Fig. 1 B), whereas mature T and B lymphocytes expressed low levels of GFP (Fig. 1 C). Figure 1. A Nur77GFP BAC transgenic mouse expresses GFP upon TCR activation. (A) A GFP-Cre fusion protein was inserted at the start site of the Nr4a1 (Nur77) gene of a BAC construct and used to generate B6 or B6.SJLF1 transgenic lines. (B) GFP was highly expressed in a subset of myeloid cells of the spleen but not lymph node. (C) T and B lymphocytes expressed a low level of GFP. Three founder lines showed similar cell-specific patterns of GFP expression, but higher levels were observed in the B6-820 line (n = 5 mice). (D) GFP was up-regulated in T cells 12 h after anti-CD3 injection in vivo or in B cells after 3 h of anti-IgM treatment in vitro (n = 4 mice and three experiments). To determine whether TCR stimulation induced GFP expression, we injected Nur77GFP mice with 50 µg anti-CD3 i.v. and 12 h later harvested lymphocytes. We observed robust induction of GFP (Fig. 1 D, left) and CD69 on T cells (not depicted) after α-CD3 stimulation. We also stimulated bulk splenocytes with 10 µg α-IgM in vitro for 3 h. Again, robust GFP expression was observed in B cells (Fig. 1 D, right) but not T cells. Thus, we conclude that GFP expression can be induced after lymphocyte antigen receptor activation both in vitro and in vivo. Initial microarray experiments showed differential expression of Nr4a1 in thymocytes undergoing positive versus negative selection. In light of this, we asked whether the level of GFP induced in T cells would correlate with the strength of TCR signal perceived. We used Kb/OVA-specific OT-I TCR transgenic mice, for which many variant peptide ligands have been characterized (Hogquist et al., 1994; Daniels et al., 2006). DP thymocytes from OT-I/Nur77GFP mice lacking the transporter associated with antigen process 2 gene (Tapo) were stimulated with APCs pulsed with OVA peptide (OVAp) variants in vitro. In Fig. 2 A, these are listed according to stimulatory strength, with the cognate OVAp on the left and the weakest variant (E1) on the right. The level of GFP induced by each directly correlated with its stimulatory activity (Fig. 2 A). Interestingly, even the low-affinity variant E1 and the self-peptide β-CAT induced GFP above the background level (control peptide p815; Fig. 2 A, inset). Neither of these weak peptides stimulates OT-I T cells to proliferate, but they support positive selection of OT-I in organ cultures (Hogquist et al., 1994; Santori et al., 2002) and in vivo (Stefanski et al., 2001). Figure 2. The level of GFP expression reflects TCR signal strength and is transient. (A) OT-I/Tapo/Nur77GFP thymocytes were co-cultured for 3 h with B6 splenocytes pulsed with the peptide SIINFEKL (OVAp) or the indicated altered peptide ligands, listed in order of decreasing potency. The MFI of GFP was normalized to the level observed with OVAp stimulation (n = 5). cntl, control. (B) Splenocytes from OT-I/Nur77GFP mice were cultured with the indicated peptides for various lengths of time. The data represent the mean normalized GFP levels from six different experiments of at least six mice. Error bars indicate standard deviation. GFP up-regulation was transient after TCR stimulation with maximum expression observed between 12 and 24 h (Fig. 2 B). The up-regulation of endogenous Nur77 protein was also determined in parallel, and endogenous levels also correlated with strength of stimulus (Fig. S1 B), although peak induction of endogenous Nur77 occurred earlier than GFP, presumably reflecting the time required for maturation of a fully fluorescent GFP and the greater stability of GFP (Fig. S1 C). Analogous experiments were performed in vivo using OT-I/Nur77GFP cells transferred into mice and infected with strains of Listeria monocytogenes expressing variants of the OVAp. As seen with peptides in vitro, the level of GFP in OT-I T cells in vivo reflected the stimulatory strength of the variant peptide ligand, even in the context of an infection (Fig. S2). Thus, the Nur77GFP mouse has the potential to be a sensitive reporter of TCR signal strength both in vitro and in vivo. GFP expression is induced by positive selection and maintained by tonic MHC signals Because Nr4a1 message was up-regulated during positive selection (Baldwin and Hogquist, 2007) and GFP could be induced by low-affinity TCR ligands (Fig. 2 A), we sought to determine whether GFP was up-regulated by positive selection in vivo. In the thymus of Nur77GFP mice, only a fraction of cells expressed GFP (Fig. 3 A). Further analysis revealed that the GFP+ population was enriched for DP dull, CD4, and CD8 single-positive (SP) cells (Fig. 3 A, right). Among DP thymocytes, the GFP+ cells were high for CD69 and the TCR-β chain (Fig. 3 B, dot plot), suggesting that induction of GFP occurred at the time of positive selection (Fig. 3 B, histogram). Furthermore, we observed very low expression of GFP in DP thymocytes from OT-I Tapo (nonselecting) mice compared with OT-I (selecting) control mice (Fig. 3 C), demonstrating that positive selection induced GFP in vivo. Consistent with the induction of GFP expression during positive selection, the majority of GFP bright cells were located in the medulla with only a few GFP-positive thymocytes found in the cortex (Fig. 3 D). Figure 3. GFP expression is induced during positive selection. (A) Flow cytometric analysis of GFP in total thymocytes (left). Dot plots (right) show CD4 and CD8 expression on total or GFP-positive thymocytes from Nur77GFP mice. (B) The GFP+ DP population was enriched for CD69+TCR-β+ cells (dot plot). CD69+TCR-βhi (postselection) DP thymocytes expressed higher levels of GFP compared with CD69−TCR-βlo (preselection) DP thymocytes (histogram overlay). (C) GFP expression of DP thymocytes from WT or Tap-deficient mice. NTg, nontransgenic. (D) Immunofluorescence analysis of GFP in the Nur77GFP thymus, with the cortical region defined by staining for the β5t proteasome subunit. Data are representative of >10 mice from at least three independent experiments. Bars, 100 µm. Like mature SP thymocytes, naive T cells in the periphery expressed GFP, although at slightly lower levels (Fig. 4 A, right), suggesting a decay of GFP with maturation. In fact, there was a modest stepwise decrease in GFP expression during development with semimature SP thymocytes expressing the highest level of GFP, followed by mature SP, then recent thymic emigrants (RTEs; HSAhiQa2lo), and finally naive non-RTE T cells (Fig. S3). Nonetheless, naive non-RTE T cells expressed a level of GFP in the steady-state that was significantly above background and did not vary with age. Interestingly, this basal level of GFP was higher in CD4 than CD8 T cells, which is consistent with some models that have proposed that the CD4 coreceptor delivers a stronger signal than the CD8 coreceptor (Veillette et al., 1988; Legname et al., 2000). Memory phenotype CD4 and CD8 T cells did not express significantly different levels of GFP when compared with their naive counterparts (unpublished data). Finally, in the absence of the co-stimulatory molecule CD28, T cells expressed identical levels of GFP compared with CD28-sufficient T cells (Fig. S4). Figure 4. GFP expression is maintained in the steady-state by tonic MHC signals. (A) Analysis of GFP levels in mature CD4 and CD8 SP thymocytes (left; defined as HSAloQa2hi) or naive phenotype CD4 and CD8 lymph node T cells (right; defined as CD44loCD69−CD25−). Data are representative of >10 mice. (B) 1–2 × 106 polyclonal Nur77GFP CD4 T cells were transferred into B6 or I-Ab–deficient (MHC IIo) recipients and analyzed 6 or 9 d later. Bar graph shows the mean GFP level on cells adoptively transferred into I-Ab–deficient recipients normalized to the level on CD4 T cells in B6 recipients. Data are representative of 11 mice from four independent experiments. Error bars indicate standard deviation. NTg, nontransgenic; Tg, transgenic. To determine whether the GFP levels in naive T cells reflect tonic TCR stimulation by self-pMHC, we adoptively transferred Nur77GFP CD4 T cells into congenic WT or MHC II–deficient hosts and analyzed them after 6 or 9 d. The GFP level in naive phenotype, non-RTE CD4 T cells was maintained after adoptive transfer into WT recipients (Fig. 4 B, red line). In contrast, GFP was lost from CD4 T cells in MHC II–deficient recipients. These data suggest that TCR signals maintain GFP expression in peripheral T cells. Thymocytes undergoing negative selection express high levels of GFP If GFP levels reflect the strength of the TCR signal perceived, one would predict higher GFP expression in thymocytes undergoing negative selection compared with positive selection. To test this, we used the OT-I/rat insulin promoter (RIP)–membrane OVA (mOVA) system, in which negative selection occurs via clonal deletion in CD8 SP thymocytes (Kurts et al., 1997). However, cells undergoing clonal deletion are rapidly cleared by thymic macrophages (Surh and Sprent, 1994). Thus, we created OT-I/Bimo/Nur77GFP transgenic mice, in which deficiency of the proapoptotic molecule Bim prevented apoptosis. Accordingly, bone marrow chimeras were created using OT-I/Nur77GFP or OT-I/Bimo/Nur77GFP mice as donors and B6 or RIP-mOVA mice as recipients (Fig. 5). As expected, we observed efficient positive selection of OT-I in B6 recipients and efficient deletion in RIP-mOVA recipients (Fig. 5 A, left). Moreover, OT-I/Bimo cells underwent efficient positive selection in B6 recipients, but Bim deficiency completely rescued OT-I cells from deletion in RIP-mOVA recipients (Fig. 5 A, right; and Fig. S5). Interestingly, GFP expression was substantially higher in OT-I/Bimo thymocytes rescued from deletion in RIP-mOVA recipients compared with cells undergoing positive selection in B6 recipients (Fig. 5 B). Therefore, we conclude that GFP levels were induced to higher levels by negative selection signals as compared with positive selection stimuli. Figure 5. Thymocytes undergoing negative selection express higher levels of GFP compared with those undergoing positive selection. OT-I/Nur77GFP mice or OT-I/Bimo/Nur77GFP mice were generated and used as bone marrow donors. 5–10 × 106 bone marrow cells were injected into lethally irradiated B6 or RIP-mOVA recipients. (A) Expression of CD4 and CD8 on thymocytes from the indicated chimeric mice. (B) GFP expression on Vα2+ CD8SP from the indicated chimeric mice. Representative data are from five experiments with more than five mice. NTg, nontransgenic. Induction of GFP is TCR specific Many immunological studies use the expression of CD69 as a read-out for TCR activation. One caveat to this is that CD69 expression can be induced by inflammatory stimuli such as type I interferons (Sun et al., 1998; Shiow et al., 2006), thereby limiting its use as a marker of TCR stimulation in infection or inflammatory settings. We sought to determine whether inflammatory stimuli would also induce GFP expression in Nur77GFP mice. Neither polyinosinic:polycytidylic acid (pI:pC; Fig. 6 A) nor LPS (Fig. 6 B) induced GFP expression, although both induced CD69 up-regulation. To confirm this observation in the context of an infection, we transferred OT-I/Nur77GFP T cells into B6 recipient mice and infected them with L. monocytogenes that did or did not express OVA. Only when the pathogen expressed the OVA antigen was GFP up-regulation observed in OT-I T cells (Fig. 6 C). Together, these results suggest that GFP expression is driven by antigen receptor signaling in T cells in Nur77GFP mice and not by other homeostatic or inflammatory signals. Figure 6. Induction of GFP is TCR specific. (A and B) Nur77GFP mice were injected i.v. with pI:pC (A) or LPS (B). After 6 h, cells were analyzed for GFP (left) and CD69 (right) expression. (C) 5 × 106 OT-I/Nur77GFP lymph node cells were adoptively transferred into B6 recipients and infected with L. monocytogenes expressing the OVAp (LM-OVA) or not (LM). GFP expression on Vα2+CD8+ transferred cells was evaluated after 12 h. Histograms show representative data from three independent experiments with at least three mice. Treg cells express higher levels of GFP than Tconv cells Because GFP levels reflected TCR signal strength in Nur77GFP mice, we sought to use these mice to test whether Treg cells perceive stronger TCR signals compared with Tconv cells during development. Thymic Foxp3+ Treg cells expressed approximately twofold higher mean fluorescence intensity (MFI) for GFP than conventional CD4SP (Fig. 7). A higher level of GFP in Treg cells might arise if they were developmentally younger than Tconv cells because we observed a slight decrease in GFP as cells matured in the thymus (Fig. S3). This is unlikely because a previous study showed that thymic Treg cells are, on average, developmentally more mature than conventional CD4SP (McCaughtry et al., 2007). Furthermore, thymic Treg cell progenitors (defined as CD4SP, CD25+, CD122hi, Foxp3−; Burchill et al., 2008) had an even higher GFP expression level (Fig. 7). Finally, a twofold higher GFP level was also observed in peripheral Treg cells compared with Tconv CD4+ T cells (Fig. 7 and Fig. S6). These data together suggest that Treg cells perceive stronger TCR signals than Tconv cells during development and that this perception continues in the periphery. Interestingly, the GFP histograms for Treg and Tconv cells are not completely distinct, but overlap. This is consistent with TCR repertoire studies (Hsieh et al., 2006; Pacholczyk et al., 2006), which showed that some clones are unique to Treg cells, some are unique to Tconv cells, and some are shared. Figure 7. Treg cells express higher levels of GFP compared with Tconv cells. Lymphoid organs from Nur77GFP mice were analyzed by flow cytometry. Treg cells were defined as CD4SP CD25+Foxp3+. Treg cell progenitors were CD4SP CD25+CD122hiFoxp3−. Data are representative of more than eight mice from eight experiments. NTg, nontransgenic. STAT5 signaling does not increase GFP levels in Treg or Tconv cells Although it is proposed that avid interactions with self-ligands are required for Treg cell development, γc cytokines (IL-2 and to a lesser extent IL-15 and IL-7) are also known to be crucial (Burchill et al., 2007; Vang et al., 2008). To address the potential contribution of cytokine signaling to GFP expression, we isolated thymocytes and lymphocytes from Nur77GFP mice and cultured them for 3–12 h with 25 ng/ml IL-2 and observed no increase in GFP expression (unpublished data). A previous study showed that constitutive expression of STAT5 (Stat5b-CA) increased the frequency and number of Foxp3+ Treg cells (Burchill et al., 2003). Therefore, we generated Nur77GFP/Stat5b-CA mice. Thymocytes and lymphocytes were harvested and analyzed for Foxp3 expression and total GFP. As previously described (Burchill et al., 2003), we observed an increase in Treg cells in Nur77GFP/Stat5b-CA mice in both the thymus and the periphery when compared with WT littermate controls (Fig. 8 A). However, the total MFI of GFP in Treg cells from Nur77GFP/Stat5b-CA thymocytes did not increase but rather decreased in both the thymus (42 ± 2% decrease) and the periphery (32 ± 8% decrease; Fig. 8 B), whereas GFP expression in conventional CD4 thymocytes and lymphocytes did not change (Fig. 8 C). These data suggest that γc cytokine signaling via Stat5 does not account for the increased expression of GFP observed in the CD4+Foxp3+ population. Rather, the decrease in the total GFP MFI in the Treg cell population of Stat5b-CA mice likely reflects the recruitment of low-affinity TCR clones normally found in the naive repertoire into the Treg cell population as previously suggested (Burchill et al., 2008). Figure 8. Stat5 signaling does not increase GFP in Treg or Tconv cells. Stat5b-CA/Nur77GFP and Nur77GFP mice were generated. (A) Increased frequency of CD4+Foxp3+ Treg cells in Stat5b-CA/Nur77GFP mice in both the thymus and periphery. (B) Histogram overlays of CD4+Foxp3+ cells of Stat5b-CA/Nur77GFP and Nur77GFP control thymocytes (left) and lymphocytes (right). (C) Histogram overlays of CD4+Foxp3− CD4 T cells from Stat5b-CA/Nur77GFP and Nur77GFP mice. Data are representative of three experiments with four mice per group. NTg, nontransgenic. Treg cells compete for strong TCR ligands in the thymus Previous studies with Treg TCR transgenic mice showed that development of the Foxp3+ Treg cell lineage is impaired at high precursory frequency, suggesting that Treg cell progenitors compete for a limited factor during development (Bautista et al., 2009; Leung et al., 2009). This factor might be a cytokine, given the profound requirement for γc cytokine signaling during Treg cell development (Burchill et al., 2007). Alternatively, Treg cell progenitors might compete for recognition of rare high-affinity self-ligands during development. In the Nur77GFP mouse, the level of GFP reflects TCR signal strength; thus, we postulated that if Treg cell development were limited by competition for high-affinity ligands, GFP would be increased at low precursor frequency of a TCR specific for high-affinity ligands. Alternatively, if Treg cell development were limited by non-TCR factors, GFP would not increase with less competition for the selecting ligand. To test this, using a mixed bone marrow chimera strategy, we generated animals with varying frequencies of Nur77GFP/G113 TCR transgenic precursors. G113 was cloned from a naturally occurring Treg cell, although its TCR specificity is unknown (Hsieh et al., 2006). Similar to what was previously reported (Bautista et al., 2009), we observed that monoclonal G113 mice have an almost undetectable frequency of CD25+ Treg cells in the thymus (Fig. 9 A) or periphery (not depicted). Interestingly, the level of GFP was not higher on intact G113 CD4SP compared with the polyclonal CD4SP population (Fig. 9 A, top row). This suggests that Treg cell–encoded TCRs do not have an intrinsically higher affinity for ubiquitous self-antigens and that both Treg and conventional CD4 precursors are positively selected through similar (low) affinity interactions in the cortex. In contrast to monoclonal G113 mice, when chimerism was <1%, the frequency of CD4+CD25+ cells dramatically increased, as previously reported (Bautista et al., 2009). Surprisingly, the level of GFP increased on all G113 precursors (Fig. 9 A) when they were at low precursor frequency, with an inverse relationship between percent chimerism and the GFP MFI (Fig. 9 B). This was true for both CD25− and CD25+ G113 CD4SP thymocytes. GFP did not increase on non-Treg cell (OT-II) precursors in analogous control chimeras (Fig. 9 B). These data demonstrate that thymic Treg cell precursors compete for interactions that lead to strong TCR stimulations and imply that the high-affinity self-antigens that support Treg cell development are rare. Figure 9. Treg cells compete for strong TCR ligands during development. G113/Rag1o/Nur77GFP (CD45.2+) and WT (CD45.1+) bone marrow were mixed at various ratios and used to reconstitute lethally irradiated recipients (CD45.1+). Chimerism was determined by analyzing the G113+ T cell fraction from lymphoid tissue. 8 wk after transplant, lymphoid organs were harvested and analyzed by flow cytometry. (A) Dot plots on the far left show percent chimerism from select animals ranging from 97 to 0.032% G113 donor–derived T cells. Histograms on the right show GFP after gating on CD45.2+Vα2+Vβ6+CD4SP that were either CD25 negative or positive. (B) Similar mixed bone marrow chimeras were set up with OT-II/Nur77GFP bone marrow. Graph shows the GFP MFI on Vβ6+ CD4SP thymocytes (for G113) or Vβ5+ CD4SP (for OT-II). Data are representative of three experiments with more than five mice. n.d., not determined. NTg, nontransgenic. NKT cells express high levels of GFP during thymic selection iNKT cells have been described as autoreactive by design with a preponderance of indirect data suggesting that precursors interact with a stimulatory self-lipid ligand, which remains incompletely identified (Bendelac et al., 2001; Gapin, 2010). Surprisingly then, both thymic and splenic iNKT cells expressed very low levels of GFP in Nur77GFP mice (Fig. 10 A). To confirm that iNKT cells could in fact up-regulate GFP after TCR stimulation, we injected mice i.p. with 5 µg α-galactosylceramide (α-GalCer). There was robust induction of GFP in splenic CD1d tetramer–positive cells (Fig. 10 B). The lack of GFP in thymic iNKT cells was seemingly contradictory to data implicating agonistic TCR stimulation in thymic selection of iNKT cells. However, it is well known that iNKT cells undergo cell division after selection (Benlagha et al., 2002) and that mature iNKT cells can be retained in the thymus for extremely long periods of time (Berzins et al., 2006). Thus, to inquire more specifically about the intensity of TCR stimulation during iNKT cell selection, we sought to evaluate the earliest iNKT cell precursors, previously named stage 0 precursors, which can be identified as binding CD1d/α-GalCer tetramer, and are HSAhi, CD44lo, NK1.1− (Benlagha et al., 2005). Because such cells are rare in the thymus, we performed CD1d/α-GalCer tetramer–based magnetic enrichment. As expected, the majority of thymic iNKT cells were stage 3 mature cells (CD44hiNK1.1+), with a smaller subset of stage 2 and 1 cells (NK1.1−; Fig. 10 C). CD44− iNKT cells were further defined as stage 1 (HSAlo) or stage 0 (HSAhi). Interestingly, stage 0 iNKT cell progenitors expressed a higher level of GFP than age-matched conventional CD4SP, suggesting that they are indeed selected on stronger TCR ligands than Tconv CD4 T cells. However, unlike Tconv and Treg CD4 T cells, most iNKT cells lost GFP expression after maturation in the thymus and persisted like this in the periphery (Fig. 10 A). Figure 10. NKT cells express higher levels of GFP immediately after selection but do not maintain it in the periphery. (A) Histograms show the level of GFP on conventional CD4SP or CD1d/α-GalCer tetramer–binding iNKT cells in the thymus or spleen of Nur77GFP mice. Data are representative of more than five mice in at least three independent experiments. (B) GFP levels on splenic iNKT cells 6 h after injection with α-GalCer or solvent control. (C) CD1d/α-GalCer tetramer–binding iNKT cells were enriched from adult thymus using magnetic beads. Dot plots show the gating strategy used to identify subsets of thymic iNKT cells. (D) GFP levels on various staged iNKT cell populations compared with conventional CD4SP thymocytes. Data are representative of four experiments and more than nine mice. NTg, nontransgenic. DISCUSSION In this study, we introduced a unique BAC transgenic mouse useful for studying T cell activation in vivo. We showed that antigen receptor signaling was a major inducer of GFP in lymphocytes in Nur77GFP mice. GFP was not induced by TLR (toll-like receptor) ligands or other inflammatory stimuli, did not require co-stimulation, and was dependent on MHC for induction and maintenance in T cells. This finding is surprising in light of evidence that mechanical force, hormones, growth factors, and cytokines could induce Nur77 expression at the transcriptional level in nonlymphoid tissues (Pei et al., 2005; Pols et al., 2007). The only other stimulus reported to induce Nur77 in T cells is the thymotoxic plastics stabilizer DBTC (di-n-butylin dichloride; Gennari et al., 2002), whose biochemical effect is not understood. We observed that lymphocytes in the steady-state expressed a low level of GFP that was nonetheless consistently above the nontransgenic background. Polyclonal T and B lymphocytes expressed similar levels of GFP, and both responded to antigen receptor activation with rapid induction of GFP. Moreover, the thymic and peripheral expression pattern of GFP was consistent with antigen receptor regulation of signaling and TCR “tuning” and suggests this reporter mouse may be useful for imaging selection events in the thymus. Consistent with the idea that Nur77 expression is tightly regulated by the TCR, we found that adoptive transfer of CD4 T cells into an MHC II–deficient environment resulted in a loss of GFP expression that was otherwise maintained in the presence of MHC. This suggests that the tonic TCR signals perceived by T cells sustain the elevated GFP expression in the steady-state. Whether GFP expression in B cells requires tonic BCR signals is unknown. Naive CD4 T cells expressed higher basal levels of GFP compared with naive CD8 T cells. These data may suggest that CD4 T cells as a population express TCRs that perceive stronger self-pMHC signals through the TCR/coreceptor than CD8 T cells, but more experiments are required to address this hypothesis. Using the Nur77GFP mouse as a reporter of TCR signal strength, we tested the idea that CD4+Foxp3+ Treg cells perceive a stronger signal during thymic development than Tconv CD4 T cells. We showed that polyclonal Treg cells expressed a higher level of GFP, implying they perceived stronger TCR stimulation upon selection and continued to do so in the periphery. These data are consistent with previous work with TCR transgenic mice in which coexpression of a neo-self-antigen and specific TCRs skewed the T cell repertoire to a higher frequency of CD4+Foxp3+ T cells (Jordan et al., 2001; Kawahata et al., 2002). It is also consistent with the fact that mutations in LAT (linker of activated T cells) led to Tconv cell development but not CD4+Foxp3+ cell development (Koonpaew et al., 2006). Interestingly, we noted that there was distinct overlap in the GFP levels between Treg and non-Treg cells. This pattern is conceptually reminiscent of the repertoire analysis of Treg and non-Treg cells, which showed distinct receptor specificities that were found predominantly in one population or the other and some receptor specificities that were shared (Hsieh et al., 2006; Pacholczyk et al., 2006). Stat5 signaling is known to be required for CD4+Foxp3+ Treg cell development (Burchill et al., 2007). In light of this, it was possible that increased cytokine sensitivity and signaling in Treg cells accounts for the increased GFP expression. However, the failure of IL-2 to increase GFP expression in vitro or Stat5b-CA to increase GFP in vivo suggested otherwise. In fact, Treg cells from Stat5b-CA mice showed an overall decrease in GFP MFI. This is consistent with the TCR repertoire analysis performed by Burchill et al. (2008) in the Stat5b-CA mice, in which they observed that overexpression of Stat5 diverted TCR clones from the naive population into the Treg cell repertoire. Because naive T cells expressed lower GFP when compared with Treg cells, this resulted in a decrease in the total GFP MFI of the Treg cell population in Stat5b-CA mice. Using a Treg TCR transgenic model (G113) at low precursor frequency, we were able to provide evidence that Treg cells compete for strong TCR ligands during development. We observed that when there was high competition, as seen in the 100% G113 chimeras, there was no increase in the overall level of GFP on Tconv cells, suggesting that the G113 TCR does not have an intrinsically higher affinity for ubiquitous (presumably positive selecting) self-antigens. However, the level of GFP in G113 cells was higher when the progenitor was present at low precursor frequencies. This finding implies that G113 precursors compete for rare higher affinity ligands, either because the proteins they are derived from are low abundance or because the APCs that process and present such ligands are not numerous. The Nur77GFP mouse may provide a useful tool to distinguish between these possibilities in the future. Interestingly, even at very low precursor frequencies, where all G113+ thymocytes were GFPhi, not all were converted to the Treg cell lineage. This may suggest that there are other factors that also limit Treg cell development. Alternatively, it may reflect the delay between time of TCR stimulation and CD25 up-regulation and Foxp3 induction or clonal deletion of some of this population. A delay is consistent with work suggesting that Foxp3 is not required for the initial lineage decision in the thymus, but is downstream of a TCR signal and thus a delay in lineage differentiation (Gavin et al., 2007; Lin et al., 2007). Finally, we show that iNKT cells also perceive a stronger TCR stimulus than Tconv cells upon selection in the thymus. However, unlike Treg cells, iNKT cells do not continue to perceive this stimulus as they mature and emigrate to the periphery. Interestingly, the level of GFP on iNKT cells in the spleen and liver was so low that it suggests they receive very weak if any TCR stimulation in the steady-state. Given this, it is unclear why iNKT cells express intermediate levels of the T cell activation marker CD69, although it is well established that other stimuli can induce CD69 (Shiow et al., 2006). However, our findings are consistent with a published report that iNKT cells can persist long term in the absence of CD1d (McNab et al., 2005). Many cell types in the body express CD1d (Bendelac et al., 1997). The glycosphingolipid iGb3 was identified as a potential self-lipid ligand for NKT cells, although it is not clear that it is the sole endogenous antigen that stimulates iNKT cells (Zhou et al., 2004; Gapin, 2010). There is emerging evidence that stimulatory lipids are continually catabolized in lysosomes, and it was recently shown that when the catabolic enzyme α-galactosidase is absent, CD1d+ cells are able to activate iNKT cells (Bendelac et al., 1995; Zhou et al., 2004; Darmoise et al., 2010). Importantly, TLR signaling seems to inhibit α-galactosidase activity, thereby allowing for iNKT cell activation in the context of infection (Darmoise et al., 2010). The Nur77GFP mice may therefore be useful in determining what types of infections and stimuli activate APCs to display self-lipids that then stimulate iNKT cells. Historically, CD69 has been used to study T cell activation. However, CD69 expression is up-regulated by inflammatory stimuli (Shiow et al., 2006), whereas GFP in Nur77GFP mice was not. Therefore, this difference may make the Nur77GFP tool useful for determining whether certain populations of T cells, such as CD8αα IELs that express high levels of CD69, are being activated through their antigen receptor or whether the environmental stimuli cause the activated phenotype. In light of the tight regulation of GFP expression by TCR ligation and the differential expression of GFP based on TCR signal strength, we propose that the Nur77GFP mouse may be a novel model for studying TCR signal strength in vivo. In addition, because inflammatory stimuli that induce CD69 expression fail to up-regulate GFP expression, we expect that these mice will be a useful tool for tracking activated T cells in several different experimental contexts such as acute and chronic infection, cancer, and transplantation. MATERIALS AND METHODS Mice. A Nur77GFP targeting construct was created by insertion of a GFP-Cre fusion protein cDNA into the start site of the Nr4a1 gene on a 167-kb BAC vector. An ∼135-kb fragment from this vector was purified via BsiWI restriction sites and microinjected into C57BL/6J (B6) embryos at the Mouse Genetics Laboratory at the University of Minnesota. Alternatively, a 167-kb linearized DNA fragment was injected into B6 × SJL F1 embryos at the Transgenic and Chimeric Mouse Core Facility at the University of Pennsylvania. B6 and B6.SJL (CD45.1 congenic B6) mice were obtained from the National Cancer Institute. MHC I-Ab–deficient mice were obtained from Taconic. CD28-deficient mice were obtained from The Jackson Laboratory. G113 TCR transgenic mice were provided by C.-S. Hsieh (Washington University in St. Louis, St. Louis, MO), and Stat5b-CA mice were provided by M. Farrar (University of Minnesota, Minneapolis, MN). All animal experimentation was approved by and performed according to guidelines from the Institutional Animal Care and Use Committee at the University of Minnesota. Flow cytometry. Cell surface staining was performed with antibodies from eBioscience, BD, or BioLegend. For intracellular Foxp3, cells were stained with the Foxp3 Staining Buffer set (eBioscience). For endogenous Nur77 detection, cells were fixed with fresh 4% PFA, vortexed well, and permeabilized with 0.1% Triton X-100. Antibody was used at 1:50 for staining. Biotinylated CD1d/α-GalCer monomers were obtained from the tetramer facility at the National Institutes of Health. Isolation of CD1d/α-GalCer binding cells via tetramer enrichment was performed as previously described (Matsuda et al., 2000). Samples were analyzed on an LSR II (BD). Data were processed with FlowJo software (Tree Star). Bone marrow chimeras. Bone marrow was depleted of T cells with anti-Thy1.2 antibody and complement. Bone marrow was injected into lethally irradiated (1,000 rad) recipient mice. Chimeras were euthanized and analyzed at 8–12 wk after transplant. Immunofluorescence. Tissue was harvested and immediately placed in 4% PFA in PBS overnight. Tissue was washed three times with PBS before being placed in 15% sucrose in PBS overnight. Tissue was then embedded in OCT compound and frozen with 2-methylbutane with dry ice and stored at −80°C for long-term use. After cutting tissue sections, slides were dried for 30 min and then submerged in 0.1% Triton X-100 in PBS at room temperature for 5 min. Blocking was performed with 3% BSA in PBS before general antibody staining or endogenous GFP detection. Tetramer-based enrichment of thymic iNKT cells. Enrichment of CD1d+ cells was performed using an adult thymus as previously described (Matsuda et al., 2000). After tetramer enrichment, cell surface stains were performed, and a dump strategy (including B220, CD11c, Gr1, and CD25) was used to eliminate nonspecific events. The smallest gate (stage 0) included a mean of 115 events. In vivo and in vitro stimulation. For stimulation with α-CD3, 50 µg α-CD3 was injected i.v., mice were euthanized, and tissues were harvested and analyzed 12 h later. Stimulation of NKT cells was performed by i.v. injection of 5 µg α-GalCer 4–6 h before harvesting the spleen and liver. 50 µg LPS and 100 µg pI:pC were administered i.v., and tissues were harvested 6 h or 12 h later, respectively. For stimulation with α-IgM, 106 bulk splenocytes were cultured with 10 µg soluble α-IgM for 3 h at 37°C and then stained for FACS analysis. Plate-bound stimulation was performed by precoating 48-well plates with 10 µg α-CD3 or 10 µg α-CD2/CD3 and 50 µg α-CD28 O/N at 4°C and then culturing thymocytes and lymphocytes at 106 cells/well for 3 h at 37°C. OT-I Tapo stimulation was performed by peptide pulsing APCs with saturating concentrations of peptides and then adding thymocytes at a 1:4 ratio. Cells were incubated for 3 h at 37°C before FACS analysis. L. monocytogenes infection. 5 × 106 OT-I (CD45.2+) lymphocytes were adoptively transferred in B6.SJL (CD45.1+) hosts. 24 h after transfer, mice were infected i.v. with 5 × 103 CFU of L. monocytogenes or variants expressing either the OVAp or one of the OVA altered peptide ligands (Zehn et al., 2009) provided by M. Bevan (University of Washington, Seattle, WA). Mice were euthanized, and spleens were harvested 24 h after infection. Tissue was incubated with 5% collagenase D in serum-free HBSS for 30 min with mild agitation before performing cell surface staining. Statistical analysis. Prism software (GraphPad Software) was used for statistical analysis. Paired and unpaired, two-tailed Student’s t tests were used for data analysis and generation of p-values. Online supplemental material. Fig. S1 shows that GFP and endogenous Nur77 reflect strength of antigen receptor signal but that GFP decays more slowly. Fig. S2 shows that GFP expression correlates with TCR signal strength during infection in vivo. Fig. S3 shows that GFP expression changes with developmental age. Fig. S4 shows that GFP expression is independent of CD28. Fig. S5 shows that peripheral OT-I T cells that escaped deletion in RIP-mOVA recipients expressed a high level of GFP. Fig. S6 shows the normalized MFI of GFP in various lymphocyte subsets. Online supplemental material is available at http://www.jem.org/cgi/content/full/jem.20110308/DC1.

0 comments Cited 415 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: found

Is Open Access

Nr4a1-Dependent Ly6Clow Monocytes Monitor Endothelial Cells and Orchestrate Their Disposal

Leo M. Carlin, Efstathios G. Stamatiades, Cedric Auffray … (2013)

Introduction Monocytes are a heterogeneous population of blood phagocytic leucocytes that differentiate in the bone marrow. Inflammatory signals, such as chemokines, promote leucocyte diapedesis into damaged and infected tissues in order to recruit neutrophils within a few hours and “inflammatory” lymphocyte antigen 6c (Ly6C)+ monocytes 1 day later, herein initiating a cellular immune response (Auffray et al., 2009b; Serbina et al., 2008). Ly6C+ monocytes exit the bone marrow and extravasate into peripheral inflamed tissues, partly in response to chemokines that signal via C-C chemokine receptor type 2 (CCR2) (Serbina and Pamer, 2006; Tsou et al., 2007). They differentiate into inflammatory macrophages and dendritic cells (DCs) that produce tumor necrosis factor (TNF), inducible nitric oxide synthase, and reactive oxygen species in response to bacterial and parasitic infection (Narni-Mancinelli et al., 2011; Robben et al., 2005; Serbina and Pamer, 2006; Serbina et al., 2003b) and can stimulate naive T cells (Geissmann et al., 2003; Serbina et al., 2003a). Ly6C+ monocytes are also directly recruited to draining lymph nodes via the high endothelial venules (Palframan et al., 2001). They can produce type 1 interferons in response to viruses via a toll-like receptor 2-dependent pathway (Barbalat et al., 2009). It is also believed that Ly6C+ monocytes play a role in chronic inflammation, such as the formation of the atherosclerotic plaque, because Ccr2-deficient mice on low density lipoprotein receptor- or apolipoprotein E-deficient backgrounds and a high-fat diet have decreased atherosclerosis (Boring et al., 1998; Dawson et al., 1999). A second population of blood major histocompatability complex (MHC) class IInegative myeloid cells, which lack the Ly6C antigen (and, thus, are termed Ly6Clow or Gr1low monocytes), represents a distinct monocyte subset. They develop normally in Rag 2 −/− Il2rg −/− mice, which lack lymphoid cells (Auffray et al., 2007). They are characterized by high expression of the C-X3-C chemokine receptor 1 (CX3CR1) and require the transcription factor Nr4a1 for their development from proliferating bone marrow precursors (Geissmann et al., 2003; Hanna et al., 2011). They crawl along the endothelium of blood vessels in a steady state, express a full set of Fcγ receptors, and mediate IgG-dependent effector functions in mice (Auffray et al., 2007; Biburger et al., 2011; Sumagin et al., 2010). These Ly6Clow “patrolling” monocytes do not appear to share the functional properties of Ly6C+ monocytes. They do not differentiate into inflammatory macrophages or DCs following Listeria infection, and their extravasation is a rare event in comparison to Ly6C+ monocytes (Auffray et al., 2007). Ly6Clow monocytes were suggested to contribute to tissue repair in the myocardium (Nahrendorf et al., 2007), and, in contrast to Ccr2-deficient mice, Nr4a1-deficient mice showed increased atherosclerosis (Hamers et al., 2012; Hanna et al., 2012). Thus, initial data suggested that Ly6Clow monocytes may represent an “anti-inflammatory” subset. However, this hypothesis failed to explain a large number of observations. For example, limiting the recruitment of Ly6Clow monocytes after traumatic spinal cord injury was proposed to contribute decreasing inflammation in this model (Donnelly et al., 2011). Several studies on mouse models of lupus nephritis also suggested a proinflammatory role of Ly6Clow monocytes, in part via their activation by immune complexes containing nucleic acids (Amano et al., 2005; Santiago-Raber et al., 2009). Here, we characterize, in several of its key molecular mechanisms, the role of Ly6Clow Nr4a1-dependent monocytes in vivo as “accessory cells” of the endothelium. Ly6Clow monocytes scan capillaries and scavenge micrometric particles from their lumenal side in a steady state. A local nucleic-acid-mediated TLR7 “danger” signal increases their dwell time on the endothelium, a site at which they orchestrate the focal necrosis of endothelial cells that have recruited them, by recruiting neutrophils. TLR7-dependent necrosis is rapid, performed without extravasation, and leaves the basal lamina, tubular epithelium, and glomerular structures intact, at least initially. Phagocytosis of cellular debris suggests that Ly6Clow monocytes promote the safe disposal of endothelial cells at the site of recruitment. Therefore, Ly6Clow monocytes behave as “housekeepers” of the vasculature, although it is easy to conceive that their action might cause damage itself if the danger signal persists. Results CX3CR1high CD11b+ Ly6Clow Monocytes Are Enriched in the Microvasculature of the Skin and Kidney in a Steady State Monocytes that adhere to the lumenal side of the endothelium of dermal and heart capillaries, cremaster, mesenteric vessels, and glomeruli in the steady state have been identified by intravital microscopy as CX3CR1high CD11b (αM integrin)+ F4/80+ leucocytes (Auffray et al., 2007; Hanna et al., 2011; Li et al., 2012; Sumagin et al., 2010; Devi et al., 2013). Crawling CD11b+ CX3CR1high monocytes are also present in the vascular network that ramifies around renal tubules in the kidney cortex (Figures 1A and 1B; Movie S1 available online). Analysis of monocyte tethering and adhesion in vivo indicated that crawling Ly6Clow monocytes are in constant exchange between the bloodstream and the endothelium, having an average dwell time of 9 min in the kidney microvasculature (Figure 1C; Movies S2 and S3; also see Figure 3). Intravital imaging combined with intravenous (i.v.) immunolabeling of monocytes confirmed that all monocytes that crawled on the endothelium in a steady state expressed CD11b and CX3CR1 and lacked detectable Ly6C staining (Figure 1D; Movies S2, S4, and S5). To investigate the extent of the association of monocytes with the endothelium of the microvasculature in a steady state, we compared the number of monocytes per μl volume in the peripheral blood, the vasculature of the mesentery, and the capillaries of the dermis (ear) and kidney cortex. The number of crawling of Ly6Clow CD11b+ CX3CR1high monocytes/μl was at least one order of magnitude higher in the dermal and kidney cortex capillaries (103 to 104 monocytes/μl) than the number of Ly6Clow CD11b+ CX3CR1high monocytes in the peripheral blood (102 monocytes/μl) (Figure 1A). Antibody blockade of αL integrin (CD11a) detached monocytes from the vessel wall in vivo (Auffray et al., 2007), which resulted in a 50% increase in the proportion of circulating Ly6Clow over control monocytes (Figure S1), suggesting that the number of cells adherent at any time represent one-third of the total Ly6Clow pool that circulate in the peripheral blood. Crawling CX3CR1high CD11b+ Ly6Clow Monocytes Survey the Lumenal Side of “Resting” Endothelial Cells and Scavenge Microparticles Attached to It The characteristic slow motion (10–16 μm/min) and complex tracks, which include U-turns and spirals, of Ly6Clow monocytes crawling along the endothelium suggested that they survey the endothelium (Auffray et al., 2007). Intravital microscopy, image deconvolution, and transmission electron microscopy (TEM) indicated that the crawling monocytes extended numerous and mobile filopodia-like structures in contact with the endothelium in the dermal and kidney cortex blood vessels of Cx3cr1 gfp/+ ;Rag2 −/− ;Il2rg −/− mice (Figures 1E, 1H, and 1I; Movies S1 and S6). These filopodia or “dendrites” were also observed on human CD14dim monocytes spreading in vitro and stained positively for LFA1 and filamentous actin (Figure S1). Crawling monocytes scavenged 0.2 μm and 2 μm beads that attach to the capillary endothelium in the kidney cortex following i.v. injection, as well as high-molecular-weight dextran (2 MDa; Figures 1F and 1G; Movie S7). Uptake was not followed by their immediate detachment or extravasation. Rather, they can be seen crawling, or patrolling, on the endothelium while carrying their cargo for an extended period of time (e.g., >25 min in Movie S7). Consistently, mononuclear cells with the round or bean-shaped nuclei and granule-poor cytoplasm typical of Ly6Clow monocytes (Geissmann et al., 2003) were observed in steady-state kidney capillaries by TEM. These cells were monocytic, not lymphoid, given that they were present in Rag2 −/− ;Il2rg −/− mice. Pseudopodia that attached to the endothelium, and large endosomes that contained endogenous debris/microparticles were evident (Figures 1H and 1I). Thus, Ly6Clow monocytes scan the lumenal side of “resting” endothelial cells and uptake submicrometric and micrometric particles. LFA1 and ICAM1 and/or ICAM2 Are Absolutely Required for the Crawling of Nr4a1-Dependent MHCIIneg Monocytes, but Chemokine Receptors Are Dispensable Consistent with antibody blockade of LFA1 (Auffray et al., 2007), monocyte attachment to the endothelium was reduced to 1% of wild-type (WT) in Itgal −/− mice, whereas monocyte subsets were normally present in the peripheral blood (Figures 2A and 2B). Track analysis of intravital imaging experiments (Figure 2B; Movie S4) comparing Itgal −/− mice and their WT littermates demonstrated that αL integrin was absolutely required for monocyte crawling. The few remaining Itgal −/− monocytes that attached to the endothelium passively followed the blood flow (Figure 2B). LFA1 (αLβ2 integrin) accepts several ligands, including ICAM1, ICAM2, ICAM3, and JAM-A (de Fougerolles et al., 1993; Marlin and Springer, 1987; Ostermann et al., 2002; Staunton et al., 1989). Crawling monocytes were still present in Icam1 −/− mice, though they were reduced by 50%, and were normally present in Icam2 −/− mice (Figure 2C). However, monocyte attachment to the endothelium was reduced to 2% of control in Icam1/2 −/− double mutant mice, and the remaining adherent monocytes passively followed the blood flow, a phenocopy of the Itgal −/− mutant (Figure 2C). Thus, LFA1 and its ligand ICAM1—or ICAM2 in ICAM1-deficient mice—mediate adhesion and crawling of Ly6Clow monocytes to the endothelium. Chemokine receptor Ccr2 deficiency decreased by half the number of circulating Ly6C+ monocytes (Serbina and Pamer, 2006), which are proposed to represent a precursor for Ly6Clow monocytes (Varol et al., 2007). In the absence of Ccr2, Ly6C+ monocytes were decreased by ∼50%, as described, but the numbers of Ly6Clow monocytes in the bloodstream and crawling on the endothelium were unaffected in comparison to control monocytes (Figures 2D and 2E). Cx3cr1 deficiency was reported to moderately decrease the numbers of circulating and crawling Ly6Clow monocytes (Auffray et al., 2007; Auffray et al., 2009a; Landsman et al., 2009). Cx3cr1-deficient crawling monocytes displayed a normal patrolling motility and filopodia formation in vivo (Figure 2F), despite their number being reduced. Therefore, monocyte crawling on the endothelium does not require Cx3cr1 or Ccr2. To test whether another chemokine, or a combination of chemokines, may be responsible for LFA1 activation and binding to ICAM1 and/or ICAM2, we performed intravital imaging experiments in mice after i.v. injection of pertussis toxin (PT), a potent inhibitor of Gα i signaling. PT treatment (up to 100 μg/mouse) did not affect the adhesion and crawling of monocytes on the endothelium (Figure 2G). Thus, it is unlikely that PT-sensitive chemokine receptor signaling controls the adhesion of Ly6Clow monocytes to the endothelium in a steady state. A positive control for the effect of PT is shown in Figure 4. The transcription factor Nr4a1 is important for the development of Ly6Clow monocytes from their bone marrow precursors in mice; circulating and crawling Ly6Clow monocytes being reduced by 90% in Nr4a1-deficient mice (Hanna et al., 2011). Additional analysis indicated that CX3CR1high Ly6Clow CD11b+ I-A− (MHCII−) monocytes were, in fact, virtually absent from the blood and from the endothelium of Nr4a1 −/− mice (Figures 2H and 2I). The remaining 5%–10% of Ly6Clow CD11b+ cells in the blood have a distinct phenotype in addition to being Nr4a1 independent; they express I-A and intermediate levels of CX3CR1 and may represent a previously unrecognized subset of blood myeloid cells independent of both Ccr2 and Nr4a1 (Figure 2J, also see Figure S1), which will not be discussed further in this report. Patrolling Monocytes Are Retained within Kidney Capillaries in TLR7-Mediated Inflammation Thus, Nr4a1-dependent monocytes scavenge the lumenal side of the endothelium in a steady state via a process that requires LFA1 with ICAM1 or ICAM2 interaction but not chemokine-receptor signaling. To evaluate the response of the patrolling monocytes to TLR-mediated signal in vivo, we painted the kidney capsule of Cx3cr1 gfp/+ mice with R848 (Resiquimod, a selective ligand for TLR7 in mouse), Lipopolysaccharide (LPS), or PBS as a control (Figure S2). After R848 painting, the tracks of crawling monocytes inside capillaries increased in length, and their velocity decreased slightly (Figures 3A and 3B; Movie S8). The duration of their attachment to the endothelium, or dwell time, increased 2- to 3-fold (Figure 3C). This resulted in a rapid, sustained, time- and TLR7-dependent increase in their number within the peritubular capillaries, which was very significantly different from the slight increase observed 3 hr after PBS painting (the latter possibly being due to phototoxicity) (Figure 3D). Retention of crawling monocytes inside capillaries was dependent on local TLR7 signaling, because there was no monocyte retention in Cx3cr1 gfp/+ ;Tlr7 −/− mice in comparison to Cx3cr1 gfp/+ ;Tlr7 +/+ controls (Figures 3A–3D), although steady-state crawling itself was TLR7-independent (Figures 3A–3D; Movie S8), and because there was no significant monocyte retention in kidney capillaries after i.v. injection of R848 (Figure 3D). In addition, LPS painting did not increase the number of crawling monocytes, in comparison to PBS control (R848-positive control is also shown for clarity; Figure 3D). I.v. injection of labeled antibodies against CD11b 4.5 hr after R848 painting indicated that crawling GFP+ CD11b+ cells were located inside capillaries (Figure 3E; Movie S9). Moreover, the increase in GFP+ cells during the 4.5 hr of the experiment could be wholly accounted for by CD11b-labeled cells, indicating that the crawling monocytes had remained within the vascular lumen (Figure 3F). A Chemokine Receptor Switch Is Responsible for Intravascular Monocyte Retention These data indicated that crawling monocytes are retained within the capillaries of the kidney cortex in response to a local nucleic acid signal. To eliminate the possibility that lymphoid cells are involved, the experiment was repeated in Cx3cr1 gfp/+ ;Rag2 −/− ;Il2rg −/− mice, and the results were identical (Figures 4A and 4B). TLR7 is expressed ubiquitously, including in endothelial cells (Gunzer et al., 2005). After painting with R848, quantitative PCR (qPCR) analysis indicated that the expression of fractalkine (CX3CL1) in the kidney cortex is rapidly upregulated in a TLR7-dependent manner and independently of leucocyte adhesion (Figure 4C). I.v. injection of PT inhibited, in a dose-dependent manner, the increase in track length and displacement in response to R848 painting and the resulting accumulation of monocytes inside kidney capillaries (Figures 4A, 4B, and 4D). Thus, fractalkine was upregulated in the kidney, and Gα i chemokine-receptor signaling was required to retain monocytes in the capillaries by preventing their detachment from the endothelium. One obvious candidate to mediate this effect was the fractalkine receptor CX3CR1. Indeed, Cx 3 cr1 deficiency prevented monocyte retention inside kidney capillaries in response to R848 (Figures 4A–4D). In a steady state, crawling monocytes are present, though they are less abundant in the vasculature of Cx 3 cr1 −/− mice (Auffray et al., 2007) (Figures 4D). In addition, Mac1 (αMβ2 integrin) blockade with neutralizing antibodies, which does not affect “steady-state” crawling behavior (Auffray et al., 2007) (Figure 4D), also prevented the accumulation of monocytes inside kidney capillaries (Figure 4D). Therefore, although Gα i signaling is dispensable for monocyte adhesion in a steady state, it is required in response to R848 in order to prevent the detachment of crawling monocytes and promote their intravascular retention, at least in part via fractalkine and CX3CR1 and αM integrin. Intravascular Retention of Monocytes Is CCR2 Independent and Causes Neutrophil Recruitment Although we did not reproducibly detect crawling granulocytes in the kidney capillaries of WT mice in a steady state by intravital microscopy or TEM, the above experiments documented the recruitment of GFP− Gr1+ Ly6G+ cells, most likely to be neutrophilic granulocytes, crawling inside capillaries and forming clusters in the vicinity of the patrolling monocytes (Figures 4E and 4F; Movie S10). TEM analysis of the kidney cortex of mice 5 hr after painting with R848 confirmed the recruitment of both monocytic cells and granulocytes in the vasculature (Figure 4G). Monocytes and neutrophils were attached to the endothelium of peritubular and glomerular capillaries (Figures 5 and S3). However, we did not observe any example of monocyte or neutrophil diapedesis or the presence of neutrophils outside the capillaries. These results are consistent with data obtained by intravital microscopy. They also indicated that leucocytes were retained not only in peritubular but also in glomerular capillaries (Figure S3). Mice were not submitted to intravital microscopy in these TEM experiments; thus, leucocyte recruitment was independent from laser damage. Similar observations were made in Ccr2-deficient mice (Figure 4G), indicating that CCR2 is largely dispensable for the retention of crawling monocytes and the recruitment of neutrophils. However, both monocyte and neutrophil recruitment were severely decreased in Itgal-, Cx3cr1-, and Nr4a1-deficient mice (Figure 4G). Given that neutrophils do not express CX3CR1 and are present in normal numbers in Nr4a1-deficient mice, these data provided genetic evidence suggesting that monocytes recruit neutrophils after their retention in the microvasculature of the kidney. Intravascular Monocytes Orchestrate the Rapid Necrosis and Disposal of Endothelial Cells TEM indicated that the endothelium of the tubular capillaries was undergoing severe focal damage at sites where monocytes, and neutrophils were retained after TLR7 stimulation. Endothelium thickness was increased (Figures 5 and 6A), and endothelial cells were markedly swollen with rarefaction of the cytoplasm, blebbing from the plasma membrane of cytoplasmic fragments, loss of plasma membrane integrity, and release of cellular debris and damaged organelles, such as mitochondria, whereas the morphology of nuclei remained largely unchanged (Figures 5 and 6B). In addition, extracellular fluids accumulated in the subendothelial space, separating the endothelial cells from the basal lamina (Figure 6B). In some cases, endothelial cells were detached from the basal lamina and a monocyte was seen in contact with the basal lamina (Figures 6B and S3). Endothelial cell damage was limited to cells adjacent to a monocyte or a neutrophil, and the basal lamina was always preserved (Figure 5A). Monocytes adjacent to the damaged endothelial cells could be observed phagocytosing cellular debris and organelles such as altered mitochondria (Figures 5A and S3). These features corresponded to a “textbook” description of necrosis and also suggested a safe disposal of the endothelial cells debris and organelles by monocytes. Similar features were observed in Ccr2-deficient mice (Figures 5B, 6A, and 6B). In contrast, endothelial damage was absent in Itgal-, Cx3cr1-, and Nr4a1-deficient mice after kidney painting with either PBS or R848 (Figures 5C, 6A, and 6B). Therefore, focal necrosis of endothelial cells and phagocytosis of cellular debris required the presence of leucocytes on the endothelium and was Cx3cr1- and Nr4a1-dependent but largely Ccr2-independent. Altogether, these data indicated that patrolling Nr4a1-dependent monocytes orchestrate and are required for endothelial cell death and scavenge the resulting cellular debris in situ. The Kidney Endothelium Retains Monocytes, which, In Turn, Recruit Neutrophils that Kill Endothelial Cells We investigated the signals responsible for monocyte and neutrophil recruitment by TEM and intravital analysis of TLR7-deficient bone marrow chimeric mice (Figure 6C). Expression of TLR7 on the host, but not on monocytes, was required for their recruitment in the kidney vasculature (Figures 6D and 6E). This indicated that the kidney endothelium recruits monocytes in response to a nucleic acid signal sensed via TLR7, consistent with fractalkine induction by R848 and fractalkine- and CX3CR1-dependent recruitment of monocytes (see Figure 4). However, the efficient recruitment of neutrophils required TLR7 expression on both the host and bone-marrow-derived cells (Figures 6D and 6E). Expression of TLR7 by the kidney and the retention of TLR7-deficient monocytes by the endothelium were not sufficient to recruit neutrophils. These data characterize a sequence of events and the successive requirement of TLR7 on the kidney for the accumulation of monocytes on the endothelium and on hematopoietic cells for the recruitment of neutrophils. Endothelial cell necrosis was reduced to background levels in Tlr7 host+/+BM−/− despite the presence of monocytes (Figure 7A), suggesting either that monocytes require TLR7 to kill endothelial cells or that neutrophils are responsible for endothelial necrosis. Therefore, we selectively depleted neutrophils (by 90%) but not monocytes by intraperitoneal injection of an antibody against Ly6G 1A8 8 hr before R848 painting (Figure 7B). Neutrophil depletion from the periphery resulted in the severe reduction of neutrophils in the kidney, whereas monocytes were still retained (Figure 7C), and mostly abolished endothelial necrosis (Figures 7D and 7E). Therefore, the endothelium recruits monocytes, monocytes recruit neutrophils, and the neutrophils are, in turn, required for endothelial killing. Consistent with a role of monocytes in recruiting neutrophils in a TLR7-dependent manner, fluorescence-activated cell sorting (FACS)-sorted Ly6Clow monocytes displayed a strong MEK-dependent proinflammatory chemokine and cytokine response to R848 in vitro, characterized by the production of the chemokine KC (C-X-C chemokine ligand 1; CXCL1), known to contribute to neutrophil recruitment, as well as several other proinflammatory mediators such as interleukin 1β (IL-1β), TNF, C-C cheomokine ligand 3 (CCL3; macrophage inflammatory protein 1α), and interleukin 6 (IL-6) (Figure 7F). Notably, this response appears to be relatively specific, or at least preferential, for TLR7, given that Ly6Clow monocytes responded very poorly to LPS stimulation both in vitro and in vivo (Figure S2), which is in contrast to Ly6C+ monocytes (Figure 7F) and consistent with data in humans (Cros et al., 2010). Discussion A Multistep Process Controls Intravascular Scavenging of the Endothelium and Removal of Endothelial Cells Our data indicate that intravascular patrolling, mediated by LFA1-ICAM1 interactions and independent of chemokine signaling, represents the first step of monocyte surveillance of the endothelium from its lumenal side. TLR7-dependent sensing of a “danger” signal by the kidney cortex then triggers the expression of fractalkine and intravascular retention of Ly6Clow monocytes by the endothelium. This process is Gαi-dependent and requires the fractalkine receptor CX3CR1 expressed by Ly6Clow monocytes and the αMβ2 integrin Mac1 (Figure 7G). The subsequent recruitment of neutrophils requires the prior retention of Ly6Clow monocytes and the expression of TLR7 by hematopoietic cells. Altogether, our data suggest that the activation of intravascular monocytes via TLR7 in prolonged contact with the endothelium is the mechanism that recruits neutrophils via the production of KC or other proinflammatory mediators. In the last steps, neutrophils, in turn, mediate the focal necrosis of the endothelial cells, and monocytes scavenge cellular debris, all from within the capillary lumen. Phagocytosis of cellular debris suggests the safe disposal of endothelial cells at the site of necrosis. Therefore, Lyc6Clow monocytes behave as “housekeepers” of the vasculature. Earlier observations that Ly6Clow monocytes crawl on endothelia (Auffray et al., 2007; Hanna et al., 2011; Li et al., 2012; Sumagin et al., 2010) and do not contribute to the pool of inflammatory monocytes that extravasate to give inflammatory macrophages and DCs in response to listeria infection in vivo (Auffray et al., 2007; Geissmann et al., 2003; Serbina et al., 2003b) are consistent with their intravascular function. Their MEK-dependent preferential response to TLR7 agonists is reminiscent of our earlier observation that CD14dim human monocytes selectively respond to viruses and nucleic acids via a TLR7-8 MEK pathway (Cros et al., 2010) and further suggests that Ly6Clow and CD14dim monocytes share a common function in mice and humans, respectively. Neutrophils damage endothelial cells when activated (Villanueva et al., 2011; Westlin and Gimbrone, 1993). There has been recent recognition that apoptosis was not the only mechanism underlying programmed or regulated cell death and that necrotic cell death can occur in vivo (Edinger and Thompson, 2004; Galluzzi and Kroemer, 2008; Green, 2011; Kroemer et al., 2009). Indeed, our data demonstrate that neutrophils can mediate endothelial cell death by necrosis in vivo. Activated neutrophils produce a variety of soluble and membrane-bound mediators that can contribute to necrosis, and additional investigation should explore the exact mechanisms responsible for neutrophil-mediated necrosis of endothelial cells. Possible Relevance to Vascular Inflammation and Tissue Damage The several steps that allow Ly6Clow monocytes to orchestrate endothelial cell death indicate a tight control of endothelial cell necrosis, which may be useful in avoiding excessive damage. However, as outlined above, it is easy to conceive that this process might become detrimental, particularly if the danger signal persists in situations such as atherosclerosis or systemic lupus erythematosus (SLE). For example, TLR7 is involved in several steps of the pathogenesis of SLE (Barrat et al., 2007; Deane et al., 2007; Vollmer et al., 2005), and subendothelial deposits of nucleic acids in immune complexes are a feature of a proportion of SLE patients (Hill et al., 2001; Hill et al., 2000). Activation of Ly6Clow monocytes and their human equivalent was reported in murine models of SLE and human patients (Amano et al., 2005; Nakatani et al., 2010; Santiago-Raber et al., 2009; Cros et al., 2010; Yoshimoto et al., 2007), and CX3CR1 blockade was proposed to reduce monocyte recruitment to the kidney and inflammation (Inoue et al., 2005; Nakatani et al., 2010). Collectively, this literature raises the possibility that, although Ly6Clow monocytes would be expected to protect the endothelium, they could also paradoxically contribute to vascular and tissue damage in genetically susceptible individuals. Revising the Leucocyte Diapedesis Model Extravasation of leucocytes into inflamed tissues by the means of chemotaxis is a hallmark of inflammation, and it is unclear why monocytes and neutrophils did not extravasate in response to the local TLR7-mediated signal. It is possible that additional signals are needed. However, the accumulation of crawling leucocytes inside blood vessels may not always lead to extravasation (Geissmann et al., 2005; Devi et al., 2013). Metchnikoff (1893)’s description of diapedesis 120 years ago in his ninth lecture on the comparative pathology of inflammation insisted that the accumulation and ameboid locomotion of leucocytes inside blood vessels was not always followed by extravasation. Intravascular leucocytes retained both ameboid motility and chemotaxis, and Metchnikoff (1893) proposed that they sensed and obeyed signals from the inflamed tissues to stay inside blood vessels, a process called “negative chemotactism.” Whether nucleic acids represent such a negative chemotactic factor in vivo is an interesting hypothesis that would have practical implications. The “choice” between extravasation and intravascular “retention” may also correspond to distinct properties of different leucocyte cell types. It is clear from the present study that the Ly6Clow subset of monocytes specializes in surveying the endothelium. Therefore, we suggest that interactions between leucocyte and endothelium may be best described by a revised model that takes into account subset-specific functions, time, and the response to individual stress signals, as opposed to the leucocyte extravasation model alone. Experimental Procedures Mice Mouse strains are described in Extended Experimental Procedures. Antibodies and Reagents Antibody clones and reagent manufacturers are described in Extended Experimental Procedures. Intravital Microscopy and Image Analysis of the Ear, Mesentery, and Kidney Intravital confocal microscopy of monocytes in the ear and mesentery was performed as previously described (Auffray et al., 2007) with LSM510 Zeiss and SP5 Leica inverted microscopes. For intravital imaging of the kidney, we induced anaesthesia with a combination of ketamine, xylazine, and acepromazine, and the kidney was surgically exposed without removing the renal capsule or interrupting the blood flow and placed against a coverslip. Anesthesia was maintained by the inhalation of isoflurane in oxygen, and the animal was imaged for up to 5 hr (see Extended Experimental Procedures). Cells in blood vessels were tracked and analyzed as described in Extended Experimental Procedures. Transmission Electron Microscopy The full methods for TEM are described in Extended Experimental Procedures. In brief, kidneys were prepared as for intravital imaging but not illuminated. Instead, after 5 hr, the animal was euthanized and the kidney tissue was fixed in 2.5% gluteraldehyde overnight at 4°C. Samples were processed and sectioned to reveal superficial peritubular capillaries and glomeruli. Mononuclear and polymorhonuclear cells were counted for each grid square imaged. Endothelial thickness was measured from the outer edge of the nearest basal lamina to the lumen of the vessel to the outer edge of the lumenal side of the endothelial cell. We were careful to measure equivalent areas in all vessels. Oncocytic endothelial cells and the related features of subendothelial swelling, basal membrane exposure, mitochondrial abnormality, and phagocytosis were quantified and normalized per image and leukocyte. Statistical Tests In the figures, the asterisk represents p ≤ 0.05 in an unpaired Student’s t test. Otherwise, p values from unpaired Student’s t test are indicated. Flow Cytometry Flow cytometry was performed as described in Extended Experimental Procedures. Multiplexed ELISA for In Vitro Cytokine Production Multiplexed ELISA for in vitro cytokine production was performed as described in Extended Experimental Procedures. Animal Experiments Animal experiments were performed in strict adherence to our United Kingdom Home Office project license issued under the Animals (Scientific Procedures) Act 1986. Extended Experimental Procedures Mice Cx3cr1gfp/+, triple mutant CX3CR1 competent Cx3cr1gfp/+, Rag2-/-, IL2rg-/- mice and CX3CR1 deficient Cx3cr1gfp/gfp, Rag2-/-, IL2rg-/- mice, devoid of all lymphoid cells and in which monocytes are the only GFP-expressing cells, have been described previously (Auffray et al., 2007; Geissmann et al., 2003). C57BL/6 (B6) mice were generated in-house or purchased from Harlan Laboratories or Charles River UK. Cx3cr1gfp/gfp, Rag2-/-, IL2rg-/- mice were bred with B6 mice to produce Cx3cr1gfp/+, Rag2+/-, IL2rg+/- mice. Tlr7 null mice (on C57BL/6 background) were previously reported (Hemmi et al., 2002). Female B6 or Tlr7-/- mice were crossed with male Cx3cr1gfp/gfp, Rag2-/-, IL2rg-/- mice to generate male Cx3cr1gfp/+, Rag2+/-, IL2rg+/+, Tlr7+/+ or Cx3cr1gfp/+, Rag2+/-, IL2rg+/+, Tlr7-/- mice respectively. Nr4a1-/- (B6.129S2-Nr4a1tm1Jmi/J) mice (Lee et al., 1995), lacking in Ly6Clow monocytes (Hanna et al., 2011) were purchased from Jackson Laboratories as frozen embryos, rederived in-house and bred from heterozygotes to provide knockout and wild-type littermate controls. Itgal-/- mice, deficient for alpha-L integrin (CD11a)(Ding et al., 1999), crossed with UBC-EGFP mice (Schaefer et al., 2001) (Jackson Laboratories), were a kind gift from Ronen Alon (Weizmann Institute of Science, Israel) and were bred from heterozygotes to provide knockout and wild-type littermate controls. Icam1-/-,2-/- double knockout mice (Boscacci et al., 2010) deficient in both ICAM1 (CD54) and ICAM2 (CD102) were a kind gift from Britta Engelhardt and Jen Stein (University of Bern, Switzerland). They were rederived in house as Icam1-/+,2-/+ and bred to produce double and single knockouts and knockout and wild-type littermate controls. Solutions and Buffers Phosphate Buffered Saline (-)Ca, (-)Mg (PBS; Life Technologies). PBS containing 1% Bovine Serum Albumin (w/v) (Life Technologies) and 0.1% Tween20 (v/v)(Sigma) is referred to as PBS-T. Hank’s balanced salt solution (HBSS; Life Technologies) was supplemented with 20mM HEPES (Sigma). Opti-MEM serum free growth media (Life Technologies). Mouse RBC lysis buffer contained 8.3g NH4Cl 1g NaHCO3 1mL EDTA (100mM) in 1L ddH2O. PBS containing 0.5% (w/v) BSA and 2mM EDTA (PBS-BSA-EDTA). Electrom microscopy (EM) fixative was 2.5% EM grade gluteraldehyde in 0.1 M phosphate buffer pH7.3. Tris-EDTA (TE). Antibodies and Reagents Anti-human CD11a (Clone 38; Autogen Bioclear), DAPI (Invitrogen), Phalloidin AlexaFluor488 (Invitrogen), Vectashield Hard Set mounting medium with Prolong Gold Anti-fade (Vector Laboratories). Anti-mouse CD11a (M17/4; BD Parmingen). Rat anti-mouse CD11b PE, NA/LE, PE Cy7 or AlexaFluor647 (M1/70; BD Pharmingen), Rat IgG2b isotype control (A95-1; BD Pharmingen), Anti-mouse Gr1APC (Ly6C/Ly6G; RB6-8C5 BD Pharmingen), Anti-mouse Ly6G (1A8; Bio X Cell). Rat IgG2a isotype control (2A3; Bio X Cell or BD PharMingen) anti-mouse Ly6G PE (1A8; BD Pharmingen), Anti-mouse CD115 FITC (CSF1R; AFS98 BD PharMingen), Anti-mouse CD16/32 (2.4G2BD Pharmingen), Anti-mouse CD3 Biotin (145 2C-11; BD PharMingen), Anti-mouse NK1.1Biotin (PK136; BD Pharmingen), Anti-mouse CD19 Biotin (1D3; BD PharMingen). Streptavadin Pacific Blue (Invitrogen). Anti-mouse I-A(b) PE (AF6 120.1 BD Pharmingen) Anti-mouse I-A/E FITC (2G9 BD Pharmingen). Anti-mouse LAMP1 (Rabbit polyclonal; Sigma). DyLight 549 goat anti-mouse IgG2a (Jackson Immuno Research). MEK inhibitor PD98059 (PD; Enzo Lifescience), R848 (InvivoGEN) and LPS from E. Coli 0111:B4 (#L4391; Sigma). Pertussis Toxin (PT; Tocris #3097). R848 was reconstituted at 1 mg/ml with sterile water. LPS was reconstituted at 1 mg/ml with sterile PBS. Generation of Bone Marrow Chimeras Bone marrow (BM) recipient 6-week-old male C57BL/6 or Tlr7 −/− mice were exposed to a single lethal dose of 10Gy total body irradiation. Irradiated mice were allowed to rest for 3 hr. Sex and age matched donor Tlr7 +/+ (Cx3cr1 gfp/+ , Rag2 +/− , Il2rg +/+ , Tlr7 +/+ ) or Tlr7 −/− (Cx3cr1 gfp/+ , Rag2 +/− , Il2rg +/+ , Tlr7 −/− ) mice were sacrificed and BM cells were harvested in RPMI (Sigma; supplemented with 1% Penicillin/Streptomycin). 3x107 BM cells (in PBS) were injected iv via the tail vein into the congenic irradiated mice. Chimerism was assessed by flow cytometry after 6 weeks of BM reconstitution and mice were used for experiments 7 weeks after BM reconstitution. In Vivo Depletion of Neutrophils 7-8 weeks-old C57BL/6 mice were injected ip with 10mg/Kg of body weight neutrophil-depleting anti-Ly6G (clone 1A8; Bio X Cell, West Lebanon, NH, US) or isotype control antibody (clone 2A3; Bio X Cell). After 8 hr, neutrophil depletion was assesses by flow cytometry and the mice were subjected to kidney painting with R848 as below. Intravital Microscopy and Image Analysis of the Ear, Mesentery, and Kidney Microscopy Intravital confocal microscopy of monocytes in the ear and mesentery was performed similarly to previously described (Auffray et al., 2007). Briefly, mice were anesthetized using a cocktail of ketamine (50 mg/kg), xylazine (10 mg/kg), and acepromazine (1.7 mg/kg) injected intraperitoneally and were kept at 37°C and received oxygen (0.5 l/min). Anesthesia was maintained by half-dose boosts delivered subcutaneously every 30 min (ear and mesentery model) or by continuous inhalation of 0.5% isoflurane in oxygen (Merial, Harlow, United Kingdom) in the kidney model. The mouse was positioned on a custom made aluminum tray stage insert with circular 2.5 cm diameter hole, covered with a glass coverslip attached with silicone grease. Images were acquired using either an inverted Leica TCS SP5 DMI6000 confocal laser scanning system using Argon-ion 488nm, DPSS 561nm, HeNe 633nm laser lines through 10 × 0.4 N.A. HCX PL APO and 20x 0.5 N.A PL Fluotar air objectives or an inverted Zeiss LSM 510 confocal laser scanning system equipped with 10 × /0.5 Fluar and 20x/0.75 Plan Apochromat objectives. A thermostat controlled heated chamber (Life Imaging Services) was used to keep the whole microscope, mice, tray, and microscope objectives at 37°C during the experiment. Dermal Blood Vessels Mice were anesthetized and the inside of the unshaved ear was placed in a drop of PBS directly against the coverslip and held in position with tape over a second small square coverslip to hold it in place. 80 μl of TRITC conjugated 70kDa dextran (70 μM) was injected intravenously if using Cx3cr1 gfp/+ , Rag2 −/− , IL2rg −/− or Cx3cr1 gfp/gfp , Rag2 −/− , IL2rg −/− mice. In other mice, 10 μg PE-conjugated anti-CD11b (M1/70) or APC anti-Gr1 (Rb6-8c5) was injected intravenously, to stain the CD11b+ and Gr1+ cells and circulating unbound antibody revealed the blood vessels. Imaging was performed as described previously using the Zeiss LSM510 (Auffray et al., 2007), or using 10 × 0.4 N.A. HCX PL APO and 20 x 0.5 N.A PL Fluotar air objectives on the Leica SP5 with 488 and 561nm laser lines for GFP and PE respectively. Emission wavelengths were selected using the spectral scanning head to exclude cross channel bleed-through. Mesenteric Blood Vessels Mice were anesthetized and the skin and peritoneum were carefully cut and the longest portion of the intestine (proximal to the colon) was placed on the coverslip. To avoid perturbation by intestinal peristalsis, the intestine was immobilized using small sheets of paper. Vessel walls of the branches of the mesenteric vein and mesenteric artery were detected by bright-field transmitted light imaging. Images were acquired as described (Auffray et al., 2007), or using 10 × 0.4 N.A. HCX PL APO and 20 x 0.5 N.A PL Fluotar air objectives on the Leica SP5 with 488 and 561 nm laser lines for GFP and PE respectively. For intravital phenotyping experiments, anti-CD11b PE (10 μg) and/or anti-Gr1APC (10 μg) was injected intravenously. For steady-state intravital Gαi blocking experiments 100μg pertussis toxin (PT) was injected intravenously and the mice were imaged 2 hr later. Kidney Peritubular Capillaries Mice were anesthetized and the fur from the left flank region was removed using a hair trimmer. The left kidney was surgically exposed without removing the renal capsule or interrupting the blood flow, and placed on the coverslip on PBS-soaked strips of paper. The animal was further stabilized on the stage by two strips of tape applied gently over the front and back legs of the mouse. In order to visualize the blood vessels 120 μl of TRITC conjugated 70kDa (70 μM) or 2 MDa (2 μM) dextran was injected intravenously. Images were acquired using 20x 0.5 NA PL Fluotar air and 40x 1.25 NA APO CS oil objectives on the Leica SP5 with 488, 561 and 633nm laser lines for GFP, PE and APC respectively. For intravital phenotyping experiments, anti-CD11b PE (10 μg), anti-Gr1APC (10 μg) or anti-Ly6G PE (10 μg) was injected intravenously. For beads-scavenging experiments, 20 μl 2 μm TRITC-labeled beads were injected intravenously 5 min after starting imaging. Direct Treatment of Kidney with R848 The kidney was initially preimaged for 15 min. Then, (t = 0), 400 μl R848 or LPS 0.5 mg/ml was applied over the exteriorized kidney in order to induce kidney inflammation, and the animal was imaged for further 5 hr. As a control, the kidney was painted with PBS alone. For intravital Gαi blocking experiments 50 or 12.5 μg (dosage used stated in figure) PT was injected intravenously at t = 0 simultaneously with R848 kidney painting and the kidney was imaged for further 5 hr as previously. For intravital CD11b (Mac-1) blocking experiments 4 mg/kg anti-CD11b NA/LE or Rat IgG2b isotype control was injected intravenously at t = 0 simultaneously with R848 kidney painting and the kidney was imaged for further 5 hr as previously. Analysis of the Number of Crawling Monocytes per μl Volume Blood vessels were fitted with “isovolumes” using Imaris software (Bitplane) to calculate the imaged blood vessel volume. The sum of the fitted volume was calculated and the number of crawling monocytes within this volume quantified at 4-5 different time points. The number of crawling monocytes per time point was then was then divided by the volume calculated in μl. Cell Track Analysis To produce summed fluorescence images over time from differentially labeled cells, time-lapse z-stacks were individually maximally projected, then complete track paths were then generated by maximally projecting each snapshot of the time-series into a single image as described previously (Auffray et al., 2007). To compare crawling monocyte paths in different knockout animals and in in vivo blocking experiments in the mesenteric vessels, cells were tracked using the autoregressive-motion algorithm and filtered for a minimum track length of 30 μm from their origin and a minimum track duration of 3 min, then were manually assessed and edited for track continuity. Motile tissue GFP+ cells were excluded by masking. For the kidney, the numerous GFP+ cells made manual tracking of each individual monocyte necessary. In the kidney capillaries each cell was manually tracked (by marking its position in each snapshot of the time-series), accurate z positioning was achieved using a software function that automatically positions the point at the center-of-mass of the fluorescent signal in z. For each field, tracks were ‘translated’ to a common origin in space to allow direct comparison (number, direction and displacement). Tracks were then quantified for number, speed, length, duration, displacement and confinement ratio (defined as the quotient of track length and track displacement). Transmission Electron Microscopy Mice were anesthetized and the left kidney was exteriorized as before. Without any illumination or imaging, the animal was placed on a Petri dish, and transferred to a temperature controlled recovery chamber set at 37°C. The kidney was painted with R848 or PBS as a control. After 5 hr, the animal was euthanized and the kidney removed. The kidney was halved to just leave the half that was lying in the R848 solution, the tissue was sliced into approximately 1mm thick slices and fixed in 2.5% gluteradehyde (v/v) in 0.1M phosphate buffer (pH 7.3) overnight at 4°C. Subsequently samples were washed several times in phosphate buffer and postfixed in 1% osmium tetroxide in 0.1M phosphate buffer pH7.3 for 1.5 hr at 4°C. Samples were then washed, dehydrated in a graded series of ethanol and equilibrated with propylene oxide before infiltration with TAAB epoxy resin (TAAB Laboratories Equipment, Reading, UK). Tissue slices were cut into smaller pieces just before embedding and polymerized at 70°C for 24 hr. Ultrathin sections (70-90 nm) were prepared to reveal superficial peritubular capillaries and also slightly deeper to reveal glomeruli using a Reichert-Jung Ultracut E ultramicrotome (Leica), then mounted on 150 mesh copper grids, contrasted using uranyl acetate and lead citrate. Samples were imaged using a CCD camera (Hamamatsu) contained in a digital imaging system (AMT) and H7600 transmission electron microscope (Hitachi) at 75kV. TEM Quantification Mononuclear and polymorphonuclear cells were counted for each EM grid square imaged. Endothelial thickness was measured from the outer edge of the nearest basal membrane to the lumen of the vessel to the outer edge of the lumenal side of the endothelial cell. Care was taken to measure equivalent areas in all vessels. Endothelial cell nuclei and the corners of vessels were not measured. 5-10 measurements were taken for 10 randomly selected vessels per grid and additionally categorized for the presence or absence of leukocytes in the blood vessel. Oncoytic endothelial cells and the related features of endothelial / sub-endothelial swelling, basal membrane exposure and externalized or abnormal mitochondria and phagocytic vesicles were counted and the number of such lesions where normalized to the number of images or images containing leukocytes for each experimental condition as noted in figure legends. qPCR of Murine Renal Tissue Kidneys were treated with R848, LPS or PBS as a control in vivo as above for 5 hr without imaging. After removal of the kidney capsule, approx. 5mg of kidney tissue (a 1mm x 1mm block) from the cortex was taken and frozen using liquid nitrogen immediately in a nucleic acid and RNase free microcentrifuge tube. Tissue was stored at −80°C until it was homogenized in RLT plus buffer (QIAGEN) containing 1% 2-mercaptoethanol (Sigma-Aldrich) by drawing through a 21 g hypodermic needle > 15 times. Subsequently total RNA was purified using an RNeasy plus micro kit (QIAGEN), according to manufacturer’s instructions. RNA was quantified by absorbance spectroscopy (Nanodrop) and reverse transcription was performed using Superscript III reverse transcriptase and first strand buffer (Invitrogen) and random hexamer primers (Fermantas) according to manufacturer’s instructions (with the addition of RNasin; Promega). qPCR analysis was performed by the SYBRgreen method using a Rotorgene qPCR machine (QIAGEN) and SensiMix SYBR noROX qPCR mastermix reagents (Bioline) using the following primers: Gapdh, for 5′ATTGTGGAAGGGCTCATGACC3′ rev 5′TCTTCTGGGTGGCAGTGATG3′; 18 s, for 5′AACGGCTACCACATCCAAGG3′ rev 5′GGGAGTGGGTAATTTGCGC3′; Cx3cl1 (fractalkine), 5′GCGTGCCATTGTCCTGGAGACG3′ rev 5′TTCGGGTCAGCACAGAAGCGT3′; IL1b, for 5′TGAAAGACGGCACACCCACCC3′ rev. 5′TTGCTTGGGATCCACACTCTCCA 3′ (Sigma); Tnf, Mm_Tnf_1_SG QuantiTect Primer Assay QT00104006 (QIAGEN). mRNA was quantified using the standard curve method, samples were normalized using 18 s or Gapdh mRNA concentration and expressed as fold change over control PBS treated kidney tissue. Statistical Tests Where ∗ is used in the figures, p ≤ 0.05 in an unpaired Student’s t test otherwise the P value is given in the figure. N for the experiment is given in the figure legend. Tests were performed using GraphPad Prism (GraphPad). Flow Cytometry Flow Cytometry to Phenotype Mouse Blood Monocytes Red blood cell lysis was performed using mouse RBC lysis buffer (see recipe above) on 200-900 μl whole blood collected from the tail vein or by cardiac puncture. ∼2-12x106 leukocytes were resuspended in PBS-BSA 0.5% (w/v) and blocked with anti-mouse CD16/32 for 10 min on ice, then stained with anti-CD3, NK1.1, CD19 biotin (Lineage Stain; Lin−), anti-CD115 FITC, CD11b PE Cy7, I-A(b) PE, Gr1APC and Strepavadin Pacific Blue, or anti-CD3, NK1.1, CD19 biotin (Lineage Stain; Lin−), anti-CD115 PE, CD11b PE Cy7, I-A FITC, Gr1APC and Strepavadin Pacific Blue. Samples were analyzed on a Aria II custom FACS (BD) with 405, 488, 561 and 633 nm laser lines. Lin− cells were analyzed for CD11b, CD115, Gr1 and I-A expression. In order to analyze blood monocytes after R848 kidney painting, the following protocol was applied. The mice were anesthetized and the left kidney was exteriorized as previously. The animal was put on a petri dish, and then transferred to a temperature controlled recovery chamber set at 37°C. The kidney was painted with R848 or PBS as a control, and, at the indicated time points, blood was withdrawn by cardiac puncture with an EDTA-coated syringe for analysis with flow cytometry and the animal was sacrificed. Cell Sorting Mouse Ly6Clow or Ly6Chigh monocytes were sorted from Lin (CD3, CD19, NK1.1)− CD11b+, CD115+ gated cells using a Aria II FACS (BD) with 405, 488, 561 and 633nm laser lines. Human CD14dim monocytes were sorted from RBC lysed whole blood as described previously (Cros et al., 2010) into Opti-MEM (Life Technologies). Analysis of Circulating Blood Ly6Clow Monocytes after Blocking CD11a 11 week old littermate male C57BL6 mice were warmed to 37°C and then either 4mg/kg IgG2a Rat isotype control (2A3; BD Pharmingen) or 4mg/kg rat anti-mouse CD11a (M17/4; BD Pharmingen) was injected intravenously via the tail vein in 100 μl 0.9% NaCl. 15 min later, 700-900μl blood was taken via cardiac puncture and the mouse was euthanized. RBC lysis was performed as above and the leukocytes were counted. Flow cytometry analysis was performed as above. Immunofluorescence Staining and Confocal Microscopy of Fixed Samples ∼154 Sorted human CD14dim monocytes in HBSS were plated on 13mm glass coverslips that had been precoated overnight at 4°C with 3.5μg/ml human Fc-ICAM1 and 100 ng/ml recombinant human CSF1 (R&D systems) and blocked for 2 hr at room temperature with PBS-BSA 2% (w/v). Cells were incubated for 20 min at 37°C, 5% CO2 and paraformaldehyde solutions were preheated to 37°C then the cells were fixed for 5 min with 3% paraformaldehyde in k-PIPES pH6.5 and 10 min 3% paraformaldehyde in Sodium Borate pH11 at room temperature, then washed in PBS. Autofluorescence was quenched by incubating in 0.1mg/ml NaBH4 (sodium borohydride; Sigma) in PBS for 2 min. Cells were then permeabilized with PBS-BSA 1%- Triton X-100 0.1% for 5 min and washed with PBS-T. Following a 30 min incubation at room temperature with PBS-T, cells were incubated with anti-human CD11a (mAb 38) for 90 min and subsequently DyLight549 conjugated goat anti-mouse IgG2a and Phalloidin-AlexaFluor488 then mounted in Vectashield containing DAPI. Cells were imaged using a Leica SP5 with 405, 488 and 561 nm laser lines for DAPI, Phalloidin, and DyLight549 respectively, using sequential and spectral scanning to minimize cross channel bleed-through. A 63x 1.4 N.A. oil immersion objective was used to image the cells. Multiplexed ELISA for In Vitro Cytokine Production Lin- CD11b CD115+ Ly6C+ and Ly6Clow monocytes were sorted from the blood of mice by flow cytometry as described previously (Auffray et al., 2007) and above. Monocytes (0.1x106/ml) were incubated in medium (Opti-MEM) with or without the selective MEK inhibitor PD98059 (10 μM) for 45 min before addition of LPS (100 ng/ml; Sigma) or R848 (2 μg/ml; InvivoGen). Supernatants were collected after overnight incubation at 37°C. For cytokine measurements, plates were centrifuged, supernatant collected and stored at −80°C until analysis. IL1β, KC, CCL3, TNF and IL-6 cytokines were measured using the BioRad BioPlex murine cytokine kit according to manufacturer’s instructions. Bead fluorescence emission was detected using the Luminex LX100 multiplex system (Luminex) and data analyzed using STarStation3.0 (Applied Cytometry) according to manufacturer’s instructions.

0 comments Cited 302 times – based on 0 reviews      Review now

Bookmark

All references

Author and article information

Journal

Journal ID (iso-abbrev): Nat. Immunol.

Title: Nature immunology

ISSN (Electronic): 1529-2916

ISSN (Print): 1529-2908

Publication date (Electronic): Dec 2015

Volume: 16

Issue: 12

Affiliations

[1 ] Division of Inflammation Biology, La Jolla Institute for Allergy and Immunology, La Jolla, California, USA.

[2 ] Microscopy Core, La Jolla Institute for Allergy and Immunology, La Jolla, California, USA.

[3 ] Department of Pathology, Immunology &Laboratory Medicine, University of Florida College of Medicine, Gainesville, Florida, USA.

[4 ] Department of Pathology, University of Washington, Seattle, Washington, USA.

[5 ] Department of Biotechnology and Molecular Medicine, University of Eastern Finland, Kuopio, Finland.

[6 ] Montreal Neurological Institute, McGill University, Montreal, Canada.

[7 ] Department of Cellular &Molecular Medicine, University of California San Diego, San Diego, California, USA.

Article

Publisher Item ID: ni.3321 Mid ID: NIHMS775578

DOI: 10.1038/ni.3321

PMC ID: 4833087

PubMed ID: 26523867

SO-VID: decb2d96-3d78-4b7f-97ea-a2178baff236

History

Data availability:

Comments

Comment on this article

scite_

Cited by 49

See all cited by

Most referenced authors 635

See all reference authors

- Version 1
- Version 1

Transcription factor Nr4a1 couples sympathetic and inflammatory cues in CNS-recruited macrophages to limit neuroinflammation.

Read this article at

Abstract

Related collections

Biomarkers for Inflammatory Lung Disease

Most cited references 40

Infiltrating monocytes trigger EAE progression, but do not contribute to the resident microglia pool.

T cell receptor signal strength in Treg and iNKT cell development demonstrated by a novel fluorescent reporter mouse

Nr4a1-Dependent Ly6Clow Monocytes Monitor Endothelial Cells and Orchestrate Their Disposal

Author and article information

Journal

Affiliations

Article

History

Comments

Comment on this article

Similar content 247

Cited by 49

Most referenced authors 635