1
views
0
recommends
+1 Recommend
0 collections
    0
    shares
      • Record: found
      • Abstract: found
      • Article: not found

      Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element.

      Blood
      5' Untranslated Regions, genetics, Activating Transcription Factor 2, Cyclic AMP, physiology, Cyclic AMP Response Element-Binding Protein, metabolism, Fucosyltransferases, biosynthesis, Gene Expression Regulation, Viral, Gene Products, tax, Genes, pX, Human T-lymphotropic virus 1, Humans, Jurkat Cells, enzymology, virology, Models, Genetic, Phosphorylation, Promoter Regions, Genetic, Second Messenger Systems, Sequence Homology, Nucleic Acid, Structure-Activity Relationship, Terminal Repeat Sequences, Transcription Factors, Transcriptional Activation

      Read this article at

      ScienceOpenPublisherPubMed
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells express the fucosyltransferase (Fuc-T) VII gene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII transcription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5'-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)-responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C-rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)-promoter. Furthermore, CREM alpha, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.

          Related collections

          Author and article information

          Comments

          Comment on this article