- Record: found
- Abstract: found
- Article: found
Serine 363 of a Hydrophobic Region of Archaeal Ribulose 1,5-Bisphosphate Carboxylase/Oxygenase from Archaeoglobus fulgidus and Thermococcus kodakaraensis Affects CO 2/O 2 Substrate Specificity and Oxygen Sensitivity
research-article
Publication date (Electronic):
18 September 2015
Journal:
PLoS ONE
Publisher:
Public Library of Science
Read this article at
There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.
Abstract
Archaeal ribulose 1, 5-bisphospate carboxylase/oxygenase (RubisCO) is differentiated from other RubisCO enzymes and is classified as a form III enzyme, as opposed to the form I and form II RubisCOs typical of chemoautotrophic bacteria and prokaryotic and eukaryotic phototrophs. The form III enzyme from archaea is particularly interesting as several of these proteins exhibit unusual and reversible sensitivity to molecular oxygen, including the enzyme from Archaeoglobus fulgidus. Previous studies with A. fulgidus RbcL2 had shown the importance of Met-295 in oxygen sensitivity and pointed towards the potential significance of another residue (Ser-363) found in a hydrophobic pocket that is conserved in all RubisCO proteins. In the current study, further structure/function studies have been performed focusing on Ser-363 of A. fulgidus RbcL2; various changes in this and other residues of the hydrophobic pocket point to and definitively establish the importance of Ser-363 with respect to interactions with oxygen. In addition, previous findings had indicated discrepant CO 2/O 2 specificity determinations of the Thermococcus kodakaraensis RubisCO, a close homolog of A. fulgidus RbcL2. It is shown here that the T. kodakaraensis enzyme exhibits a similar substrate specificity as the A. fulgidus enzyme and is also oxygen sensitive, with equivalent residues involved in oxygen interactions.
Related collections
Most cited references31
- Record: found
- Abstract: found
- Article: not found
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
C Yanisch-Perron, J. Vieira, J Messing (1985)
Three kinds of improvements have been introduced into the M13-based cloning systems. (1) New Escherichia coli host strains have been constructed for the E. coli bacteriophage M13 and the high-copy-number pUC-plasmid cloning vectors. Mutations introduced into these strains improve cloning of unmodified DNA and of repetitive sequences. A new suppressorless strain facilitates the cloning of selected recombinants. (2) The complete nucleotide sequences of the M13mp and pUC vectors have been compiled from a number of sources, including the sequencing of selected segments. The M13mp18 sequence is revised to include the G-to-T substitution in its gene II at position 6 125 bp (in M13) or 6967 bp in M13mp18. (3) M13 clones suitable for sequencing have been obtained by a new method of generating unidirectional progressive deletions from the polycloning site using exonucleases HI and VII.
- Record: found
- Abstract: found
- Article: not found
Effect of temperature on the CO2/O 2 specificity of ribulose-1,5-bisphosphate carboxylase/oxygenase and the rate of respiration in the light : Estimates from gas-exchange measurements on spinach.
A. Brooks, G Farquhar (1985)
Responses of the rate of net CO2 assimilation (A) to the intercellular partial pressure of CO2 (p i ) were measured on intact spinach (Spinacia oleracea L.) leaves at different irradiances. These responses were analysed to find the value of p i at which the rate of photosynthetic CO2 uptake equalled that of photorespiratory CO2 evolution. At this CO2 partial pressure (denoted Г), net rate of CO2 assimilation was negative, indicating that there was non-photorespiratory CO2 evolution in the light. Hence Г was lower than the CO2 compensation point, Γ. Estimates of Г were obtained at leaf temperatures from 15 to 30°C, and the CO2/O2 specificity of ribulose 1,5-bisphosphate (RuBP) carboxylase/oxygenase (E.C. 4.1.1.39) was calculated from these data, taking into account changes in CO2 and O2 solubilities with temperature. The CO2/O2 specificity decreased with increasing temperature. Therefore we concluded that temperature effects on the ratio of photorespiration to photosynthesis were not solely the consequence of differential effects of temperature on the solubilities of CO2 and O2. Our estimates of the CO2/O2 specificity of RuBP carboxylase/oxygenase are compared with in-vitro measurements by other authors. The rate of nonphotorespiratory CO2 evolution in the light (R d ) was obtained from the value of A at Г. At this low CO2 partial pressure, R d was always less than the rate of CO2 evolution in darkness and appeared to decrease with increasing irradiance. The decline was most marked up to about 100 μmol quanta m(-2) s(-1) and less marked at higher irradiances. At one particular irradiance, however, R d as a proportion of the rate of CO2 evolution in darkness was similar in different leaves and this proportion was unaffected by leaf temperature or by [O2] (ambient and greater). After conditions of high [CO2] and high irradiance for several hours, the rate of CO2 evolution in darkness increased and R d also increased.
- Record: found
- Abstract: found
- Article: not found
A faster Rubisco with potential to increase photosynthesis in crops
In photosynthetic organisms, D-ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is the major enzyme assimilating atmospheric CO2 into the biosphere 1 . Due to the wasteful oxygenase activity and slow turnover of Rubisco, the enzyme is among the most important targets for improving the photosynthetic efficiency of vascular plants 2,3 . It is also anticipated that introducing the CO2-concentrating mechanism (CCM) from cyanobacteria into plants could enhance crop yield 4-6 . However, the complex nature of Rubisco’s assembly has made manipulation of the enzyme extremely challenging, and attempts to replace it in plants with the enzymes from cyanobacteria and red algae have not been successful 7,8 . Here we report two transplastomic tobacco lines with functional Rubisco from the cyanobacterium Synechococcus elongatus PCC7942 (Se7942). We knocked out the native tobacco gene encoding the large subunit of Rubisco by inserting the large and small subunit genes of the Se7942 enzyme, in combination with either the corresponding Se7942 assembly chaperone, RbcX, or an internal carboxysomal protein, CcmM35, which incorporates 3 small subunit-like domains 9,10 . Se7942 Rubisco and CcmM35 formed macromolecular complexes within the chloroplast stroma, mirroring an early step in the biogenesis of cyanobacterial β-carboxysomes 11,12 . Both transformed lines were photosynthetically competent, supporting autotrophic growth, and their respective forms of Rubisco had higher rates of CO2 fixation per unit of enzyme than the tobacco control. These transplastomic tobacco lines represent an important step towards improved photosynthesis in plants and will be valuable hosts for future addition of the remaining components of the cyanobacterial CCM, such as inorganic carbon transporters and the β-carboxysome shell proteins 4-6 . Rubisco catalyses the incorporation of CO2 into biological compounds in photosynthetic organisms 1 . During photorespiration, Rubisco also reacts wastefully with oxygen, leading to the release of previously fixed CO2, NH3 and energy 13 . Furthermore, catalysis by Rubisco is slow and very large amounts (up to 50% of leaf soluble protein, 25% leaf N) are needed to support adequate photosynthetic rates. Some variation in the catalytic properties of Rubisco from diverse sources is apparent. Harnessing this variation has the potential to confer superior photosynthetic characteristics to specific crops and environments 14 . C4 plants, cyanobacteria and hornworts have evolved forms of CO2-concentrating mechanisms (CCM) that allow them to utilize faster forms of Rubisco that have lower CO2 affinity, whereas C3 plants, which lack a CCM, are constrained to express forms of Rubisco with higher CO2 affinity but a relatively low rate of turnover 2 . In plants, Rubisco is a L8S8 hexadecamer consisting of eight small subunits (SSU) and eight large subunits (LSU). Although the SSU genes are located in the nucleus, the LSU is encoded by the chloroplast genome, which has complicated previous attempts to engineer improvements in higher plant Rubisco 2,15 . Introduction of a CCM has been proposed as a means to improve the performance of Rubisco in C3 plant chloroplasts 4-6,16 . In cyanobacteria and several autotrophic prokaryotes, Rubisco and carbonic anhydrase are enclosed within polyhedral microcompartments known as carboxysomes, which maintain elevated CO2 levels in the vicinity of Rubisco, which both increases carbon fixation and suppresses photorespiration 4,6 . However, when a tobacco transplastomic line was created in which the LSU gene, rbcL, from the cyanobacterium Synechococcus PCC6301 replaced the native tobacco rbcL, the cyanobacterial LSU did not form a functional complex with the native tobacco SSU 8 . Although a simpler L2 homodimer Rubisco from Rhodospirillum rubrum was able to assemble inside tobacco chloroplasts 17 , red algal Rubisco subunits failed to produce functional L8S8 complexes within chloroplasts 7 . In order to test whether cyanobacterial LSU and SSU can assemble into a functional enzyme within higher plant chloroplasts, we generated two transplastomic tobacco lines, named SeLSX and SeLSM35, using the biolistic delivery system 18 , to express the two Rubisco subunits from Se7942 along with either RbcX or CcmM35, respectively. In each chloroplast transformant, three genes were co-transcribed from the tobacco rbcL promoter. Each downstream gene was preceded by an intercistronic expression element (IEE) and a Shine-Dalgarno sequence (SD) and equipped with a terminator to facilitate processing into translatable monocistronic transcripts 19,20 (Fig. 1a). The two vectors we constructed were designed to replace the tobacco rbcL gene with the foreign DNA. To determine whether all chloroplasts in each plant contained the transgenic locus rather than endogenous tobacco rbcL, we examined blots of total leaf DNA digested with restriction enzymes that would produce fragment length polymorphism between the wild-type and transgenic loci (Fig. 1b). We found that shoots arising after two rounds on selective medium were homoplasmic for the transgene locus, lacking the fragment corresponding to the wild-type chloroplast genome (Fig. 1b). In order to verify these observations, we performed reverse transcription and PCR (RT-PCR) and observed no cDNA derived from the native rbcL transcript, while cDNAs produced from aadA, the selectable marker gene, and the cyanobacterial genes were detected (Fig. 1c). To observe the expression of the cyanobacterial proteins, we extracted total leaf proteins and examined them by SDS-PAGE and immunoblots. In Coomassie-stained gels, we detected protein bands at the predicted molecular masses of ~52 kDa for the LSU and ~13 kDa for the SSU of the cyanobacterial Rubisco in SeLSX and SeLSM35 samples, while wild-type tobacco exhibited a protein of the expected and distinct SSU mass of ~15 kDa (Fig. 2a). Immunoblots probed with antibodies specific for either the cyanobacterial LSU, tobacco Rubisco, tobacco SSU or cyanobacterial CcmM35 verified the presence of cyanobacterial proteins in the two transformants and tobacco Rubisco only in the wild-type plant (Fig. 2a). Although no engineering of tobacco SSU genes was performed in the transgenic lines, tobacco SSU protein was undetectable, as expected, since its stability is known to be severely affected in the absence of a compatible LSU 8,17 . The absence of the tobacco SSU in the transformants also indicated that it could not form a stable complex with the cyanobacterial LSU. The estimated stoichiometry of CcmM35 per Rubisco holoenzyme in SeLSM35 transformant is about 4.5, which is consistent with the values reported for cyanobacteria (Extended Data Fig. 1) 21 . In order to observe the configuration of the cyanobacterial Rubisco in the two transgenic lines, we examined the plant material by transmission electron microscopy (TEM) in combination with immunogold labeling. Although the enzyme was localized to the chloroplast stroma in both transgenic lines, we observed markedly different patterns of molecular organization. In leaves of the SeLSX line, the cyanobacterial Rubisco showed a diffuse localization similar to endogenous Rubisco in wild-type tobacco (Fig. 2b,c). In contrast, in the SeLSM35 line, in which the Rubisco is co-expressed with CcmM35, the proteins were aggregated into a giant complex in each chloroplast (Fig. 2d and Extended Data Fig. 2). In Se7942, CcmM35 is translated from an internal ribosome entry site of the ccmM transcript, which also produces the full length protein, CcmM58, with an additional N-terminal domain 22 . Previous estimation of protein ratios suggested that Rubisco in Se PCC7942 likely exists as L8S5 units cross-linked by the SSU-like domains of CcmM35 resulting in their paracrystalline arrangement in the lumen of β-carboxysomes 21 . The cyanobacterial mutant lacking CcmM58 produces large electron-dense bodies of 300-500 nm with rectangular cross-section composed of Rubisco and CcmM35 22 . However, the structures formed inside chloroplasts are generally rounded in appearance without apparent internal order. This discrepancy probably arises from different ratios of Rubisco and CcmM35 or additional carboxysomal components potentially present in the cyanobacterial bodies. Remarkably, the structures observed in chloroplasts are highly similar in appearance to procarboxysomes recently identified as an important early stage in the carboxysome assembly 11 and will potentially facilitate future attempts to assemble β-carboxysomes in chloroplasts through expression of other essential components. The specificity of the carboxylase activity of cyanobacterial Rubisco relative to its competing oxygenase activity (specificity factor) is known to be lower than that in higher plants, making it more sensitive to the inhibitory effects of oxygen than tobacco Rubisco 2 . SeLSX and SeLSM35 plants did not survive on soil at the normal atmospheric CO2 level of ~400 ppm, but were able to grow in CO2 enriched (9000 ppm) air at a rate slower than the wild-type plant. Both transgenic plants have normal appearance (Fig. 3). Previous efforts to engineer tobacco Rubisco demonstrated that the growth rate and photosynthetic properties of transplastomic plants are generally consistent with the expression levels and catalytic properties of the recombinant Rubisco 2,17 . We believe it is also the case in our transplastomic plants. Our preliminary analyses to quantify the Rubisco content using the CABP (2-carboxy-D-arabinitol-1,5-bisphosphate) binding method indicate that the Rubisco concentrations in the two chloroplast transformants are approximately 12-18 % of that in the wild-type plant (Extended Data Table 1) 23 . In addition, the lower levels of total soluble proteins and chlorophyll concentrations likely contribute to the observed slow growth of the two chloroplast transformants (Extended Data Table 1). The fact that both transgenic lines could grow autotrophically indicated that active cyanobacterial Rubisco has assembled. We measured the carboxylase activities of the cyanobacterial Rubisco in the leaf homogenates at room temperature using ribulose bisphosphate (RuBP) and several concentrations of radiolabeled sodium bicarbonate (NaH 14 CO3). The assays were performed in the presence of 10 mM, 20 mM and 50 mM NaH 14 CO3, which at pH 8.0 would generate dissolved CO2 concentrations ([CO2]) of approximately 125 μM, 250 μM and 640 μM, respectively. The carboxylase activity of Rubisco in the tobacco control did not increase upon increasing [CO2], confirming that the native enzyme was already saturated at 125 μM [CO2] (Fig. 4). In contrast, cyanobacterial Rubisco displayed greater carboxylase activity at higher [CO2] values, with a rate of catalysis which exceeded that of the tobacco enzyme at each [CO2]. Our measured kinetic values are consistent with the reported rate and Michaelis constants for CO2 (~3 s−1 &10.7 μM for tobacco and ~12 s−1 & 200 μM for the enzyme in Synechococcus PCC6301, respectively) 2,24 . We confirmed that the carboxylase activities detected in our samples were specific to Rubisco, since they were entirely dependent on the presence of RuBP and were inhibited by CABP 25 (Extended Data Fig. 3). The high carboxylase activities detected in the transformants are consistent with the absence of interference by tobacco SSU in the assembly of bona fide cyanobacterial Rubisco in the chloroplasts. Furthermore, both transgenic lines exhibited high Rubisco activities despite differences in its intra-organellar organization. We included RbcX in one of our chloroplast transformation vectors because it has been shown to enhance the assembly of the LSU core complex before formation of the final hexadecameric complex 9 . However, Se7942 lacking RbcX suffered no defect in growth rate or Rubisco activity 26 . As line SeLSM35 lacks RbcX but has active Rubisco, evidently Se-RbcX is not essential for the assembly of functional cyanobacterial Rubisco in chloroplasts. CcmM35, through its SSU-like domains, might assist in the assembly of cyanobacterial Rubisco in SeLSM35 in the absence of RbcX. The transgenic plants described here are absolutely dependent on the cyanobacterial Rubisco for carbon fixation. If the oxygenation reaction of cyanobacterial Rubisco can be suppressed and the local [CO2] in the vicinity of the enzyme can be raised by further engineering, CO2 assimilation may be enhanced, and the necessity to divert so much fixed nitrogen into this enzyme may be diminished. Recently, we demonstrated that the shell proteins of β-carboxysomes could form structures similar to empty microcompartments in the chloroplast stroma 27 . Introduction of the carboxysome shell proteins, the required internal proteins, and appropriate transporters into transgenic plants containing cyanobacterial Rubisco is predicted to result in significantly enhanced photosynthetic performance in vascular plants 5,6 . This report, demonstrating that cyanobacterial Rubisco can assemble into active enzyme in a C3 plant and support autotrophic photosynthesis, is an important step towards the introduction of a complete and functional CCM into the chloroplasts of vascular plants. Methods Construction of the transformation vectors The Se-rbcL and Se-rbcS genes with codons optimized for chloroplast translation system were designed by Muhammad Waqar Hameed and synthesized by Bioneer. Extended Data Table 2 contains the primers ordered from Integrated DNA Technologies and used in this work. The amplifications of DNA molecules were carried out with Phusion High-Fidelity DNA polymerase (Thermo Scientific). The restriction enzymes and T4 DNA ligase were also purchased from Thermo Scientific. The two tobacco chloroplast genomic loci (F1 and F2) immediately flanking the rbcL gene (bp56620-57599 and bp59034-60033 of NCBI Reference Sequence: NC_001879.2) were amplified from the DNA extracted from tobacco plants using the primer pairs F1for-F1rev and F2for-F2rev respectively and cloned into pCR8/GW/TOPO TA vector (Life Technologies) adding PstI and MluI restriction sites at the 5’ and 3’ end of F2, respectively. The Se-rbcL gene was amplified from pGEM-Teasy-Se-rbcL with F1OLrbcLfor and 4RErbcLrev primers adding an overlap to the 3’ end of F1 at the 5’ end of Se-rbcL and four restriction sites, MauBI, NotI, PstI and MluI, at the 3’ end of Se-rbcL. This amplified Se-rbcL gene was designed to replace the tobacco rbcL in frame and allow the synthetic expansion of the operon. F1for2 and F1rev primers were used to amplify F1 from its pCR8 vector and the resulting product was then joined with the Se-rbcL amplicon by the overlap extension PCR procedure. The F1-Se-rbcL segment was then digested with ApaI and MluI restriction enzymes and ligated into pGEM-Teasy-Se-rbcL template treated with the same two enzymes to obtain the pGEM-F1-rbcL vector. F2 was digested out of its pCR8 vector with PstI and MluI enzymes and ligated into the similarly disgested pGEM-F1-rbcL to yield the pGEM-F1-rbcL-F2 vector. The selectable marker operon (SMO) containing LoxP-PpsbA-aadA-Trps16-LoxP was amplified from a previously reported chloroplast transformation vector, pTetCBglC 28 , with SMOfor and SMOrev primers, digested with PstI and ligated in forward orientation to the PstI-digested pGEM-F1-rbcL-F2 vector to obtain the pGEM-F1-rbcL-SMO-F2 vector. The rbcL terminator (TrbcL) was amplified from the tobacco DNA with TrbcLfor and TrbcLrev primers, digested with MauBI and Bsp120I enzymes and ligated between the MauBI and NotI sites of the pGEM-F1-rbcL-SMO-F2 vector to obtain the pCT-rbcL vector, which is ready to replace the tobacco rbcL with Se-rbcL and the SMO by the chloroplast transformation procedure. The Se-rbcL operon driven by the native rbcL promoter in pCT-rbcL was then expanded at the MauBI site with Se-rbcS, Se-rbcX and Se-ccmM35 as follows. Three terminators from the Arabidopsis thaliana (At) chloroplast genome, TpetD(At), TpsbA(At) and Trps16(At), were amplified with their respective primer pairs, TpetDAtfor-TpetDAtrev, TpsbAAtfor-TpsbAAtrev and Trps16Atfor-Trps16Atrev, adding an overlap to the intercistronic expression element (IEE) at the 3’ end and two restriction sites, MluI and MauBI at the 5’ end of each terminator. Each terminator was extended at the 3’ end by IEE-SD or IEE-SD18 fragment with primers IEESDrev or IEESD18rev-SD18rev2 respectively, resulting in the four intergenic regions, IG1, IG2, IG3, and IG4 in Fig. 1a. The Se-rbcX and Se-ccmM35 genes were amplified from the genomic DNA extracted from Se7942 using the primer pairs rbcXfor-rbcXrev and M35for-M35rev respectively, adding an overlap to the IEE-SD fragment at the 5’ end and an MluI site at the 3’ end of each gene. Similarly, Se-rbcS was amplified from pGEM-Teasy-Se-rbcL using the primer pair rbcSfor-rbcSrev. Then, IG1-rbcS, IG2-rbcX, IG3-rbcS and IG4-ccmM35 fragments were similarly generated by joining each intergenic fragment with the corresponding gene using the overlap extension PCR procedure. The MluI-digested IG2-rbcX and IG4-ccmM35 modules were each inserted into the MauBI site of the pCT-rbcL to obtain pCT-rbcL-rbcX and pCT-rbcL-ccmM35, respectively. Then the MluI-digested IG1-rbcS and IG3-rbcS modules were each inserted into the MauBI site of pCT-rbcL-rbcX and pCT-rbcL-ccmM35 to obtain pCT-LSX and pCT-LSM vectors, respectively, which were used in the following chloroplast transformation procedure to replace the native rbcL gene with the cyanobacterial genes. Generation of transplastomic tobacco plants We used the Biolistic PDS-1000/He Particle Delivery System (Bio-Rad Laboratories, Inc.) and a tissue-culture based selection method 18 . Two-week-old tobacco (Nicotiana tabacum cv. Samsun) seedlings germinated in sterile MS agar medium were bombarded with 0.6 μm gold particles carrying the appropriate chloroplast transformation vector. Two days later, the leaves were cut in half and put on RMOP agar plates containing 500 mg/l of spectinomycin and incubated for 4-6 weeks at 23 °C with 14 hours of light per day. The shoots arising from this medium were cut into small pieces of about 5 mm 2 and subjected to the second round of regeneration in the same RMOP medium for about 4-6 weeks. The shoots from the second selection round were then transferred to MS agar medium containing 500 mg/l of spectinomycin for rooting and then to soil for growth in a greenhouse chamber with elevated atmospheric CO2. DNA blot analyses of the rbcL locus of the chloroplast genome We synthesized the digoxigenin(DIG)-sUTP-labeled DNA probe (bp56907-57411 of NCBI Reference Sequence: NC_001879.2) with PCR DIG Probe Synthesis Kit by Roche and SBprbfor-SBprbrev primer pair. The total DNA from leaf tissues were extracted with a standard CTAB-based procedure. The leaf tissues frozen in liquid nitrogen were finely ground in Eppendort tubes in 600 μl of 2x CTAB buffer (2% hexadecyltrimethyl ammonium bromide, 1.4 M sodium chloride, 20 mM EDTA, 100 mM Tris pH 8.0, 0.2% b-mercaptoethanol) and incubated at 65 °C for 1 hour. The DNA was extracted with 600 μl of chloroform containing 4% isopropanol. The DNA present in the upper layer transferred to a clean tube was precipitated with 0.8 volume of isopropanol at −70 °C for 1 hour and pelleted with a microcentrifuge. The DNA pellet was washed with 200 μl of 70% ethanol and air-dried before it was dissolved in 100 μl of double distilled water. After the DNA samples’ quality and concentration were determined by a NanoDrop method, 1 μg of each DNA sample was digested by NdeI and NheI restriction enzymes, and the digested fragments were separated on a 1% agarose gel. The DNA pieces in the gel were depurinated, denatured and then transferred and cross-linked to a Nylon membrane according to the manufacturer’s protocols. The DNA samples on the membrane blot were hybridized with the DIG-labeled probe, which was then detected with Anti-Digoxigenin-alkaline phosphatase antibody using CDP-star chemiluminescent substrate (Roche) according to the manufacturer’s specifications. Analyses of the transcripts by RT-PCR Total RNA was extracted from each leaf tissue sample with a standard TRIzol procedure. The leaf tissues frozen with liquid nitrogen were ground in 800 μl of trizol and incubated at 22 °C for 5 min. After the insoluble pieces were removed by centrifugation, 160 μl of chloroform was added to the supernatant, mixed vigorously for 15 seconds and incubated at 22 °C for 3 min. The two aqueous phases were separated in a centrifuged at 4 °C for 15 min and the upper layer transferred to a new tube was mixed with 500 μl of isopropanol. The sample was incubated at 22 °C for 10 min and centrifuged at 4 °C for 10 min. The pellet was resuspended in 800 μl of 75% ethanol and centrifuged again at 4 °C for 10 min. The pellet was air-dried and re-suspended in 50 μl of molecular biology grade water. The RNA samples were treated with DNase using Ambion DNA-free kit (Life Technologies) and the cDNA for each gene was generated with its corresponding reverse primer using Sensiscript® Reverse Transcription kit (Qiagen) according to the manufacturer’s protocols. The cDNA samples were amplified with the PCR master mix (Bioline) and analyzed in a 1% agarose gel. SDS page, immunoblot and determination of CcmM35/Rubisco content The crude leaf homogenates used in the carboxylase activity measurements were separated by SDS-PAGE using 4 - 20% polyacrylamide gradient gels (Thermo Scientific, UK). For each sample, the same amount of protein, as determined by Bradford assay, was loaded onto the gel. After electrophoresis, the resolved proteins were transferred to a nitrocellulose membrane (Hybond-C Extra from GE Healthcare Life Sciences) using a Western blot apparatus. The nitrocellulose membranes were immunoblotted using one of four primary polyclonal antibodies raised against: cyanobacterial (Se PCC6301) Rubisco; tobacco Rubisco; the small subunit of tobacco Rubisco; and CcmM from Se PCC7942. The primary polyclonal antibody to detect CcmM35 was generated in rabbit with His-tagged CcmM58 protein purified from E. coli (Cambridge Research Biochemicals, UK) and used at a dilution of 1:500 in the immunoblots and from 1:500 to 1:2,000 for immunogold labeling, and was highly specific for CcmM (Fig. 2a). The primary antibodies were visualized by means of a secondary, goat anti-rabbit, peroxidase-conjugated, antibody (Sigma). The absolute and relative content of Synechococcus Rubisco and CcmM35 in SeLSM35 leaves were determined using immunoblots with antibodies against CcmM and cyanobacterial Rubisco. The amounts of Rubisco and CcmM35 present in crude leaf homogenates were estimated by comparison with authentic protein standards (purified CcmM35 and cyanobacterial Rubisco). Amounts of CcmM35 and cyanobacterial Rubisco (nmols dm−2) were the mean ± standard deviation for duplicate determinations. The band intensities were obtained using ImageJ software (NIH, USA) and the standard curves using Microsoft Excel. Purification of cyanobacterial Rubisco and CcmM35 proteins Synechococcus Rubisco was expressed in E.coli BL21 (DE3) cells using the vector pAn92 as previously described 29 . This material was harvested by centrifugation and resuspended in buffer containing 0.1M Bicine-NaOH pH 8.0, 20 mM MgCl2, 50 mM NaHCO3, 100 mM PMSF and bacterial protease inhibitor cocktail (Sigma). All steps in the purification were conducted at 0°C. The harvested cells were sonicated and cell debris removed by centrifugation (17,400xg, 20 min, 4°C). PEG-4000 and MgCl2 were added to the supernatant, giving final concentrations of 20 % (w/v) and 20 mM, respectively. After 30 min at 0°C, the precipitated Rubisco was sedimented by centrifugation (17,400xg, 20 min, 4°C) and the pellet resuspended in 25 mM triethanolamine (pH 7.8, HCl), 5 mM MgCl2, 0.5 mM EDTA, 1 mM ε-aminocaproic acid, 1 mM benzamidine, 12.5 % (v/v) glycerol, 2 mM DTT and 5 mM NaHCO3. This material was subjected to anion-exchange chromatography using a 5 mL HiTrap Q column (GE-Healthcare) pre-equilibrated with the same buffer. Rubisco was eluted with a 0 – 600 mM NaCl gradient in the same buffer. Fractions containing the most Rubisco activity (as judged by RuBP-dependent 14 CO2 assimilation) were further purified and desalted by size-exclusion chromatography using a 20 cm × 2.6 cm dia. column of Sephacryl S-200 HR (GE-Healthcare) pre-equilibrated and developed with (50 mM Bicine-NaOH pH 8, 20 mM MgCl2, 0.2 mM EDTA, 2 mM DTT). The resulting protein peak was concentrated by ultrafiltration using 20 ml capacity /150 kDa cut off centrifugal concentrators (Thermo Pierce). The PCR-amplified ccmM35 gene from Se PCC7942 was cloned into pCR8/GW/TOPO TA vector (Life Technologies) and subsequently transferred to the Gateway pDEST17 E. coli expression vector (Life Technologies), which utilizes the T7 promoter to express the inserted gene and incorporates a 6xHis tag at the N-terminus of the translated protein. The expression vector was transformed into Rosetta (DE3) competent cells, and the protein expression was induced with 0.5 mM IPTG at OD600 of 0.5. The cells in 0.5 L LB culture were harvested after 4 hours of growth at 37 °C and 250 rpm. The cells were resuspended in about 10 ml of ice cold 50 mM sodium phosphate, 300 mM sodum chloride, 20 mM imidazole at pH 8.0 and broken with sonication. The cell debris were removed by centrifugation and the supernatant was mixed with 2 ml of Ni-NTA resin, which was then washed with 15 ml of the cell suspension buffer in a gravity-flow column and the bound protein was eluted with the buffer containing 200 mM imidazole. The purity of CcmM35 was assessed with SDS-PAGE, and its concentration was determined by the Bradford method. Cryo-preparation of leaf material and transmission electron microscopy Leaf material was cryo-fixed at a rate of 20,000 Kelvins /sec using a high pressure freezer unit (Leica Microsystems EM HPM100). The second step of freeze substitution of cryo-fixed samples was performed in an EM AFS unit (Leica Microsystems) at −85°C for 48 hours in 0.5% uranyl acetate in dry acetone. The samples were then infiltrated at low temperature in Lowicryl HM20 resin (Polysciences) and polymerized with a UV lamp. For the immunogold labelling, gold grids carrying ultrathin sections (60 – 90 nm) of leaf tissue embedded in HM20 were treated using different rabbit primary antibodies against: cyanobacterial Rubisco from Se PCC6301; tobacco Rubisco; and CcmM35 (produced by Cambridge Research Biochemicals). A secondary goat polyclonal antibody to rabbit IgG conjugated with 10 nm gold particles (Abcam, UK) was used for the labeling. Images were obtained using a transmission electron microscope (Jeol 2011 F) operating at 200kV, equipped with a Gatan Ultrascan CCD camera and a Gatan Dual Vision CCD camera. Plant material and growing conditions Both transgenic and wild-type Nicotiana tabacum var. Samsun NN were grown in the same controlled environment chamber. 16 hours of fluorescent light (43%) and 8 hours dark, at 24°C during the day and 22°C during the night. The humidity level was set at 70% during the day and 80% during the night. The atmospheric CO2 level was kept constant at 9000 ppm (air containing 0.9% v/v CO2). Quantification of protein,Rubisco, and chlorophyll Total soluble protein in the leaf homogenates was determined by the standard Bradford method. Rubisco active site concentration in the crude homogenate was determined using the [14C]-CABP binding assay 23 or by quantifying LSU band intensity by immunoblotting. Each approach gave very similar results. Chlorophyll concentration was determined from crude homogenates by spectrophotometry 30 . Carboxylase activity measurements Leaf discs (1 cm2) were cut and promptly homogenized using an ice-cold pestle and mortar, in the presence of 500 μL of ice-cold extraction buffer (50 mM EPPS-NaOH pH8.0; 10 mM MgCl2; 1 mM EDTA; 1 mM EGTA; 50 mM 2-mercaptoethanol; 20 mM DTT; 20 mM NaHCO3; 2 mM Na2HPO4; Sigma plant protease inhibitor cocktail (diluted 1:100); 1 mM PMSF; 2 mM benzamidine; 5 mM ε-aminocaproic acid). Rubisco carboxylase activity was measured immediately in 500 μL of assay buffer containing 100 mM EPPS-NaOH pH8.0, 20 mM MgCl2, 0.8 mM RuBP and 10 mM, 20 mM or 50 mM NaH 14 CO3 (18.5 kBq. mol−1) at room temperature (22°C). The assay was initiated by the addition of 20 μL of the leaf homogenate, and was quenched after 2, 4, 6 or 10 minutes, by the addition of 100 μL of 10M formic acid. The samples were oven dried and the acid stable 14C determined by liquid scintillation counting, following residue rehydration (400 μL H2O) and the addition of 3.6 mL liquid scintillation cocktail (Ultima Gold, PerkinElmer, UK). For Rubisco inhibition using the tight binding Rubisco inhibitor, 2-carboxy-D-arabinitol-1,5-bisphosphate (CABP), leaf homogenates were incubated on ice for 15 minutes in the presence of 50 μM CABP 25 . Residual carboxylase activity (if any) was then measured as described above. Extended Data Extended Data Figure 1 Rubisco and CcmM35 content of SeLSM35 tobacco leaves The stated concentrations of purified Se Rubisco (a) and CcmM35 (b) proteins were used as standards. a, Immunoblot using an antibody against cyanobacterial LSU (top) and the standard curve used to estimate the amount of cyanobacterial Rubisco in uk1-uk3 samples extracted from SeLSM35 tobacco leaves (bottom). b, Immunoblot using an antibody against CcmM (top) and the standard curve used to estimate the amount of CcmM35 in uk4-uk6 samples extracted from SeLSM35 tobacco leaves (bottom). The band intensities in the two standard curves were obtained with ImageJ software (NIH, USA) and the standard curves with Microsoft Excel. c, The absolute and relative amounts (mean ± standard deviation) of CcmM35 and cyanobacterial Rubisco in SeLSM35 tobacco line from two separate measurements. Each Rubisco holoenzyme is assumed to be composed of 8 LSU and an unknown quantity of SSU. Extended Data Figure 2 Electron micrographs of ultrathin sections of leaf mesophyll cells from the chloroplast transformant SeLSM35 showing big compartments (black arrows) containing cyanobacterial Rubisco and CcmM35 in the chloroplast stroma Leaf tissues were prepared by high pressure freeze fixation (HPF) in combination with immunogold labeling using an antibody against CcmM. A secondary antibody conjugated with 10 nm gold particles was used for the labelling. Scale bars = 500 nm. Extended Data Figure 3 Rubisco-specific 14CO2 fixation by crude leaf homogenates from tobacco lines expressing cyanobacterial Rubisco (SeLSX and SeLSM35) and wild type tobacco (wt) a, Carboxylase activity assayed with [+] and without [−] RuBP. b, Carboxylase activity assayed with [+] and without [−] the inhibitor CABP. The rates of carboxylase activity (mols fixed. mol act sites−1. s−1) are the means ± standard deviation of the 2,4 & 10 min data obtained in assays at 125 μM steady-state [14CO2] (i.e. 10 mM NaH14CO3, at pH 8.0). Table 1 Rubisco, total soluble protein and chlorophyll content of the wild-type and transformed homoplastomic tobacco leaves of similar size, development and canopy position. The wild-type plants were grown in air and the transformants in air supplemented with 0.9% (v/v) or 9000 ppm CO2. Fresh 4 cm2 leaf samples were homogenised in (1 ml) ice-cold extraction buffer. The crude homogenate was used for determination of chlorophyll and Rubisco content. The total soluble protein was determined by the Bradford method following extract clarification (13,200xg, 5 min, 4°C). Values are means ± standard deviation from 3 different leaves per sample. Sample Rubisco (mg/dm2) Total soluble protein (mg/dm2) Chlorophyll a & b (mg/dm2) Wild-type 9.06 ± 0.90 37.4 ± 0.60 3.17 ± 0.21 SeLSX 1.07 ± 0.14 18.5 ± 0.20 2.13 ± 0.08 SeLSM35 1.64 ± 0.07 14.6 ± 0.90 1.75 ± 0.10 Table 2 Oligonucleotides used in the construction of chloroplast transformation vectors, DNA blot analyses of the tobacco chloroplast rbcL locus and RT-PCR analyses of the tobacco chloroplast rbcL gene and transgenes introduced in the transplastomic lines. The restriction sites are underlined. Primers Nucleotide sequences F1OLrbcLfor CATGAGTTGTAGGGAGGGATTTATGCCTAAAACCCAAAGTGCTG 4RErbcLrev ATAACGCGTCTGCAGGGCAGGCGGCCGCCGCGCGCGTTAAAGCTTATCCATTGTCTCAAA F1for GGCCCCCACTATGTGGACCTTGAACTACC F1for2 AGCTCGGGCCCCAAATAATGATT F1rev AAATCCCTCCCTACAACTCATG F2for ATGCCTGCAGATGCAGGTCGAGCATATGAAACAGTAGACATTAGCAGATAAATTAG F2rev TCCAACGCGTTGGAAATAATCAACATTACTGCAACTAGAATTG SMOfor CTATTGCTCCTTTCTTTTTCTGCAG SMOrev ATGCCTGCAGGATAACTTCGTATAGCATACATTATACG TrbcLfor AGATCGCGCGCGAAACAGTAGACATTAGCAGATAAATTAG TrbcLrev AGATGGGCCCTTCAAATCTTGTATATCTAGGTAAGTATATAC IEESDrev GTATATCTCCTTCTTGAGATCTGTTGACTTTGTATACCATTCCGTTGTAAATAAATGATC IEESD18rev CCCATATGTATATCTCCTTCTCCCATATGTATATCTCCTTCTTGAGATCTGTTGAC SD18rev2 CATGGGTATATCTCCTTCTCCCATATGTATATCTCCTTCTCCCATATGTA TpetDAtfor AGATGGGCCCACGCGTCGCGCGCGTTCAATTTATTCAATTGTAAAATAAACGACG TpetDAtrev CCATTCCGTTGTAAATAAATGATCTTAACCCATTTTAATTAATTAATTAAATTAATTAG TpsbAAtfor AGATGGGCCCACGCGTCGCGCGCGTTCGTTAGTGTTAGTCTAGATCTAG TpsbAAtrev CCATTCCGTTGTAAATAAATGATCTTAAATATGATACTCTATAAAAATTTGCTC Trpsl6Atfor AGATGGGCCCACGCGTCGCGCGCGAGTCTTACTAAAACGAAATGAAATTAATG Trps16Atrev CCATTCCGTTGTAAATAAATGATCTTACAAAATAAATATGATGGAAGTGAAAGAG rbcSfor GTCAACAGATCTCAAGAAGGAGATATACCCATGAGTATGAAAACCTTGCCAAAAG rbcSrev AGATGCGGCCGCACGCGTTTAATATCTTCCAGGTCGATGCAC rbcXfor: GTCAACAGATCTCAAGAAGGAGATATACCCATGGCGTCAACGCAGAGG rbcXrev: AGATGCGGCCGCACGCGTTCAATCCGCATGGGAGGCATTAG M35for: GTCAACAGATCTCAAGAAGGAGATATACCCATGAGCGCTTATAACGGCCAAGG M35rev: AGATGCGGCCGCACGCGTTTACGGCTTTTGAATCAACAGTTCAGC aadAfor: ATGGCTCGTGAAGCGGTTATCG aadArev: TTATTTGCCAACTACCTTAGTGATCTCG SBprbfor: ACCATGCAATTGAACCGATTCAATTG SBprbrev: TGTATACTCTTTCATATATATAGCGCAAC Nt-rbcLfor: ATGTCACCACAAACAGAGACTAAAG Nt-rbcLrev: TTACTTATCCAAAACGTCCACTGCTG Supplementary Material 1 2 3 4 5
Author and article information
Contributors
Ivan Berg: Role: Editor
Journal
Journal ID (nlm-ta): PLoS One
Journal ID (iso-abbrev): PLoS ONE
Journal ID (publisher-id): plos
Journal ID (pmc): plosone
Title:
PLoS ONE
Publisher:
Public Library of Science
(San Francisco, CA USA
)
ISSN
(Electronic):
1932-6203
Publication date
(Electronic):
18
September
2015
Publication date Collection: 2015
Volume: 10
Issue: 9
Electronic Location Identifier: e0138351
Affiliations
[1
]The Ohio State University Biochemistry Program, The Ohio State University, 484 West
12th Avenue, Columbus, Ohio, 43210–1292, United States of America
Author notes
Conceived and designed the experiments: NEK FRT. Performed the experiments: NEK. Analyzed the data: NEK FRT. Contributed reagents/materials/analysis tools: NEK FRT. Wrote the paper: NEK FRT. Planned the overall study: FRT.
* E-mail:
tabita.1@
123456osu.edu
Article
Publisher ID: PONE-D-15-26384DOI: 10.1371/journal.pone.0138351
PMC ID: 4575112
PubMed ID: 26381513
SO-VID: 26ba97dd-fa7a-4447-b121-d49b9d3d55c6
Copyright statement:
Copyright @
2015
License:
This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
History
Date
received
: 16
June
2015
Date
accepted
: 28
August
2015
Page count
Figures: 6,
Tables: 3,
Pages: 25
Funding
This study was supported by grant DE-FG02-08ER15976 from the Chemical Sciences, Geosciences
and Biosciences Division, Office of Basic Energy Sciences, Office of Science, U. S.
Department of Energy.
Categories
Subject:
Research Article
Custom metadata
Data Availability Data are all contained within the paper and its Supporting Information files.
ScienceOpen disciplines: Uncategorized
Data availability:
ScienceOpen disciplines: Uncategorized