- Record: found
- Abstract: found
- Article: found
Loop mediated isothermal amplification: An innovative gene amplification technique for animal diseases
review-article
Read this article at
There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.
Abstract
India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease.
Related collections
Most cited references35
- Record: found
- Abstract: found
- Article: found
Loop-Mediated Isothermal Amplification (LAMP) Method for Rapid Detection of Trypanosoma brucei rhodesiense
Introduction Human African trypanosomiasis is endemic in tropical Africa. In eastern and southern Africa the disease is caused by Trypanosoma brucei rhodesiense, while T. b. gambiense infections are common in central and West Africa. T. b. rhodesiense causes an acute form of disease, whereas T. b. gambiense causes a more chronic form. Moreover, the treatment regimen for the two infections is different, expressing the need for a specific diagnostic test for each trypanosome. The geographical demarcation of T. b. rhodesiense and T. b. gambiense to a large extent forms the basis of trypanosome identification and treatment. In East Africa the introduction of T. b. rhodesiense into the T. b. gambiense region is certain to occur due to the closeness of the two disease foci and continuous movement of the livestock-reservoir host for T. b. rhodesiense. This prospect further obligates the development of test kits that can differentiate the two parasites. The serum resistance-associated (SRA) gene [1],[2] is conserved and specific to T. b. rhodesiense [3]–[5] and therefore provides unequivocal identification of this parasite. It is a low-copy gene, therefore the polymerase chain reaction (PCR) test is inadequate to amplify this target reliably in clinical samples without recourse to parasite multiplication in mice. Besides, available molecular methods of parasite detection require elaborate precision instruments [3]–[7], which make their use under field conditions unfeasible. There is therefore a need for a simplified method of amplification and product detection that would compliment the available tests and make feasible molecular diagnosis for case detection and confirmation of cure in the regions that are endemic for sleeping sickness. Recently, a technique called loop-mediated isothermal amplification (LAMP) of DNA has been developed [8]. The technique uses four to six primers that recognise six to eight regions of the target DNA, respectively, in conjunction with the enzyme Bst polymerase, which has strand displacement activity. The simultaneous initiation of DNA synthesis by multiple primers makes the technique highly specific. The LAMP test is carried out under isothermal conditions (60–65°C) and produces large amount of DNA [8]. The reaction shows high tolerance to biological products [9], meaning that DNA extraction may not be necessary [10], and the product can be inspected visually by the addition of SYBR Green I [11],[12]. Briefly, LAMP proceeds when the forward inner primer (FIP) anneals to the complementary region (F2c) in the target DNA and initiates the first strand synthesis, and then the outer forward primer (F3) hybridises and displaces the first strand, forming a loop structure at one end [8]. This single-stranded DNA serves as template for backward inner primer (BIP)-initiated DNA synthesis and subsequent outer backward (B3)-primed strand displacement DNA synthesis, leading to the formation of dumbbell-shaped DNA structures [8]. The stem-loop thus formed acts as a template, and subsequently one inner primer hybridises to the loop on the product and initiates the displacement DNA synthesis, forming the original stem loop and a new stem loop that is twice as long [13]. The final products are stem-loop DNAs with several inverted repeats of the target DNA, and cauliflower-like structures bearing multiple loops [8]. A number of LAMP tests to detect parasitic protozoa have been designed and used successfully [14]–[16]. The rapidity, specificity, and simplicity of the technique make it appealing for use in trypanosomiasis-endemic regions. The purpose of the present study was to develop a LAMP test for detection of T. b. rhodesiense based on the SRA gene and compare it with PCR test that is specific for T. b. rhodesiense. Our results indicate that the SRA LAMP is sensitive and specific and has the potential to be developed into a field-friendly diagnostic test. Materials and Methods Ethical clearance Institutional Ethical Clearance for the collection of human samples had been obtained from the Livestock Health Research Institute (LIRI), Tororo, Uganda, and the Uganda National Council of Science and Technology (UNCST), Kampala, Uganda, which records and regulates all research activities in the country. At Murdoch University, Perth, Australia, the use of mice was approved by Murdoch University Animal Ethics Committee (AEC). Preparation of template The trypanosome DNA samples used in this study are shown in Table 1. The samples which most had been passaged in mice were chosen to ensure a wide geographical representation, different times of isolation, and hosts (Table 1). Six samples designated as JE (three each from blood and cerebrospinal fluid [CSF]) were direct isolates from human hosts. The DNA had been prepared using several methods (see footnotes in Table 1). The samples for studying analytical sensitivity and tolerance of LAMP were obtained from the blood of mice infected with T. b. rhodesiense and divided into two portions. The first portion was centrifuged at 3,000 rpm for 10 min and the buffy coat was collected, and the second portion was divided into aliquots of 10 µl. Then each of the two portions was mixed with 40 µl of ultrapure water, boiled for 3 min, and centrifuged at 14,000 g for 5 min. Samples of 10–15 µl of supernatant were recovered and stored at −20°C for later use. 10.1371/journal.pntd.0000147.t001 Table 1 Trypanosome Isolates and Amplification Results Species/Subspecies Identification Code Origin Year of Isolation Original Host Specific PCR Results SRA-LAMP Results TBRa SRA Geneb TgsGPc SYBR Green I Gel Real Time T. b. rhodesiense ATCC 30027 Tanganyika 1934 Human + + − + + + T. b. rhodesiense Gambella IId Ethiopia 1968 Human + + − + + + T. b. rhodesiense LVH 058d Luangwa Valley, Zambia 1974 Human + + − + + + T. b. rhodesiense LVH 56d Lambwe Valley, Kenya 1978 Human + + − + + + T. b. rhodesiense LVH 108d Lambwe Valley, Kenya 1980 Human + + − + + + T. b. rhodesiense TMRS 010d Kasulu, Tanzania 1991 Human + + − + + + T. b. rhodesiense TMRS 127d Mpanda, Tanzania 1994 Human + + − + + + T. b. rhodesiense UTRO 2509d Uganda N/A Human + + − + + + T. b. rhodesiense WB56d Uganda N/A Human + + − + + + T. b. rhodesiense KETRI 2355d Busoga, Uganda 1977 Human + + − + + + T. b. rhodesiense KETRI 3739e Busia, Kenya 2001 Dog + + − + + + T. b. rhodesiense KETRI 1900e Lambwe Valley, Kenya 1971 Hyena + + − + + + T. b. rhodesiense KETRI 2492e Lambwe Valley, Kenya 1980 Tsetse fly + + − + + + T. b. rhodesiense KETRI 2532e Lambwe Valley, Kenya 1980 Cow + + − + + + T. b. rhodesiense KETRI 3007e Busia, Kenya 1987 Pig + + − + + + T. b. rhodesiense JE1 Busoga, Uganda 1990 Human + − − + + + T. b. rhodesiense JE2f Tororo, Uganda 1991 Human − − − + + + T. b. rhodesiense JE3f Tororo, Uganda 2005 Human − − − + + + T. b. rhodesiense JE4f Tororo, Uganda 2002 Human + − − + + + T. b. rhodesiense JE5 Serere, Uganda 2001 Human + + − + + + T. b. rhodesiense JE6 Serere, Uganda 2001 Human + + − + + + T. b. rhodesiense JE8g Tororo, Uganda 2001 Human − − − + + + T. b. rhodesiense JE9g Tororo, Uganda 2001 Human + − − + + + T. b. rhodesiense JE10g Tororo, Uganda 2001 Human + − − + + + T. b. rhodesiense JE12 Serere, Uganda 2003 Human + + − + + + T. b. rhodesiense JE13 Serere, Uganda 2003 Human + + − + + + T. b. rhodesiense JE14 Serere, Uganda 2001 Human + + − + + + T. b. rhodesiense STIB849h Uganda 1991 Human nd nd nd + + + T. b. rhodesiense AnTat25.1h Rwanda 1971 Human nd nd nd + + + T. b. rhodesiense AnTat12.1h Rwanda 1991 Human nd nd nd + + + T. b. rhodesiense JE15 Serere, Uganda 2003 Human + + − + + + T. b. rhodesiense EATRO 149 Nyanza, Kenya 1961 Human + − − + + + T. b. rhodesiense KETRI 2473 Nyanza, Kenya 1970 Human + + − + + + T. b. rhodesiense EATRO 2636 Mozambique 1983 Human + − − + + + T. b. rhodesiense KETRI 3537 Bugoma, Kenya 1998 Human + + − + + + T. b. rhodesiense KETRI 3624 Busia, Kenya 1998 Human + + − + + + T. b. rhodesiense KETRI 3639 Busia, Kenya 1999 Human + + − + + + T. b. rhodesiense TMRS 51a Kibondo, Tanzania 2004 Human + + − + + + T. b. rhodesiense TMRS 51b Kibondo, Tanzania 2004 Human + + − + + + T. b. rhodesiense TMRS 51c Kibondo 2005 Human + + − + + + T. b. rhodesiense TMRS 52a Urambo, Tanzania 2005 Human + + − + + + T. b. rhodesiense TMRS 52b Urambo, Tanzania 2004 Human − − − + + + T. b. rhodesiense TMRS 52c Urambo, Tanzania 2006 Human − − − + + + T. b. rhodesiense TMRS 53a Mpanda, Tanzania 2005 Human + − − + + + T. b. rhodesiense TMRS 53b Mpanda, Tanzania 2005 Human − − − + + + T. b. rhodesiense TMRS 53c Mpanda, Tanzania 2005 Human + + − + + + T. b. rhodesiense TMRS JM Kasulu, Tanzania 2001 Human + − − + + + T. b. rhodesiense TMRS 58 Mpanda, Tanzania 2006 Human + + − + + + T. b. rhodesiense TMRS 4M Urambo, Tanzania 2006 Human − − − + + + T. b. gambiense MOSd Mbam, Cameroon 1974 Human + − + − − − T. b. gambiense PT16d Ivory Coast 1992 Human + − + − − − T. b. gambiense Boulad Bouenza, Congo 1989 Human + − + − − − T. b. gambiense NW2d Uganda 1992 Human + − + − − − T. b. gambiense Dal 972d Daloa, Ivory Coast 1978 Human + − + − − − T. b. brucei LUMP 266d Kiboko, Kenya 1969 Fly, G. pallidipes + − − − − − T. b. brucei KP2Nd Kouassi-Perita, Ivory Coast 1982 Fly, G. palpalis + − − − − − T. b. brucei B8/18d Nsukka, Nigeria 1962 Pig + − − − − − T. b. brucei J10d Luangwa Valley, Zambia 1973 Hyena + − − − − − T. b. brucei STIB 215d Serengeti, Tanzania 1971 Lion + − − − − − T. b. brucei Kateremad Uganda 1990 Cow + − − − − − T. evansi SA17 Isiolo, Kenya 2003 Camel + − − − − − T. evansi KETRI 2426 Ukunda, Kenya 1978 Camel + − − − − − T. evansi KETRI 3093 Colombia, South America 1979 Horse + − − − − − T. evansi SA263 Samburu, Kenya 2003 Camel + − − − − − T. evansi KETRI 243 Kulal, Kenya 1979 Camel + − − − − − T. evansi KETRI 3565 Athi River, Kenya 1994 Camel + − − − − − T. congolense forest Cam 22d Mbetta, Cameroon 1984 Goat − − − − − − T. c. kilifi WG5d Kenya 1980 Sheep − − − − − − T. c. savannah KETRI 1869 Kenya — — − − − − − − T. simiae Ken 4d Keneba, The Gambia 1988 Fly − − − − − − T. simiae tsavo KETRI 1864d Kenya — Fly − − − − − − T. godfreyi Ken 7d Kenya 1988 Fly, G. morsitans − − − − − − T. vivax Y58 Nigeria — — − − − − − − JE samples are from Uganda and were processed using Sigma Genomic DNA extraction kit, followed by precipitation with 3 M sodium acetate and absolute alcohol. TMRS samples were from Tanzania and the DNA was prepared using Qiagen DNA extraction kit. a Subgenus Trypanozoon PCR test [7]. b T. b. rhodesiense PCR test [3]. c T. b. gambiense PCR test [17]. d Source: Wendy Gibson, University of Bristol, UK. e The samples were processed using the saponin lysis method [5]. f DNA prepared directly from human blood. g DNA prepared directly from human CSF. h Source: Philippe Büscher, Institute of Tropical Medicine Antwerp, Belgium. DNA prepared with Qiagen DNA extraction kit. nd, not done in this study (identification reported [17]). Polymerase chain reaction Trypanosomes belonging to the subgenus Trypanozoon were analysed using TBR1 and 2 primers [7]. Furthermore T. b. rhodesiense was detected by a PCR specific for the SRA gene [3]), whereas T. b. gambiense was detected using a PCR for the T. b. gambiense-specific glycoprotein (TgsGP) gene [17]. LAMP reaction LAMP reactions of 25 µl were standardised for optimal reagent concentrations, temperature, and time conditions using T. b. rhodesiense isolate LVH 56 and following the Taguchi design [18]. Briefly, the FIP and BIP were varied from 0.8 µM to 2.4 µM, dNTPs from 100 µM to 400 µM, betaine from 0.2 M to 0.8 M, and MgSO4 from 0 to 4 mM. The FIP, BIP, F3, and B3 primers were designed using the PrimerExplorer v3 software (http:/primerexplorer.jp/lamp) based on the SRA gene sequence (GenBank accession number Z37159) (Table 2). Loop primers [loop forward (LF) and loop backward (LB)] were designed manually. The reactions were optimised at 2.0 µM for FIP and BIP primers, 0.8 µM for loop primer (LF and LB), 0.2 µM for F3 and B3 outer primers, 200 µM for each dNTP, 0.8 M betaine (Sigma), 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, and 8 U of Bst DNA polymerase large fragment (New England Biolabs). For real-time reactions 3.34 µM SYTO-9 fluorescence dye (Molecular Probes) was added. The template was ∼100 pg for trypanosome lysate DNA samples and 2 µl of buffy coat and supernatant prepared from boiled blood. To find the optimum temperature for the LAMP test, the reactions were carried out for 1 h at 58, 60, 62, and 64°C using the Rotor-Gene 3000 thermocycler (Corbett Research) or in a water bath at the same temperature settings. The reaction was terminated by increasing the temperature to 80°C for 4 min. 10.1371/journal.pntd.0000147.t002 Table 2 Nucleotide Sequences for the SRA LAMP Primers Primer Type Sequencea (5′–3′) Length Amplicon Sizeb Target SRA-F3 F3 GCGGAAGCAAGAATGACC 18 162 SRA gene SRA-B3 B3 TCTTACCTTGTGACGCCTG 19 — — SRA-FIP FIP (F1c+F2) GGACTGCGTTGAGTACGCATCCGCAAGCACAGACCACAGC 40 — — SRA-BIP BIP (B1c+B2) CGCTCTTACAAGTCTTGCGCCCTTCTGAGATGTGCCCACTG 41 — — SRA-LF LF CGCGGCATAAAGCGCTGAG 19 — — SRA-LB LB GCAGCGACCAACGGAGCC 18 — — a Accession number Z37159. b The length between F2 and B2 is 162 bp. However, the amplified amplicon sizes will be more than 162 bp since the FIP and BIP primers consist of F1c (21 bp) and B1c (21 bp), respectively. Detection of LAMP product Three methods were used to analyse DNA amplification, and included electrophoresis in 1.5% agarose gels stained with ethidium bromide, direct visual inspection of the LAMP product after addition of 1 µl of 1/10 dilution of SYBR Green I (Invitrogen), and by monitoring fluorescence of the double-stranded DNA (dsDNA)-specific dye SYTO-9 [19] in a Rotor-Gene 3000 thermocycler. Real-time fluorescence data was obtained on the FAM channel (excitation at 470 nm and detection at 510 nm) [19]. Three approaches were used to confirm that the SRA LAMP test amplified the correct target: (1) the product was digested with restriction enzyme RsaI (New England Biolabs) at 37°C for 3 h, followed by electrophoresis in 3% agarose gel; (2) following amplification, the DNA melting curves were acquired on the FAM channel using 1°C steps, with a hold of 30 s, from 62 to 96°C [19]; and (3) some of the LAMP amplicon bands were excised from an agarose gel and cloned into a TOPO-TA vector (Invitrogen), transformed in E. coli and inserts sequenced using an automated DNA 3730 analyser (Applied Biosystems). The resulting sequences were aligned with the target sequence using the DNAman computer software version 5.0 (Lynnon Biosoft). Sensitivity and specificity of LAMP 10-fold dilutions were made from infected mouse blood containing 1.0×106 trypanosomes/ml and from 100 ng of purified T. b. rhodesiense DNA, and used to determine the analytical sensitivity of SRA LAMP and PCR tests. The reactions were done in triplicates and repeated after 2 wks. The LAMP test was carried out using both cold and heated templates. The specificity of the tests were assessed with DNA from human, tsetse fly, bovine, Plasmodium falciparum, and trypanosomes belonging to other species (Trypanosoma brucei brucei, T. b. gambiense, T. b. evansi, Trypanosoma congolense savannah, T. c. kilifi, T. c. forest, Trypanosoma simiae, T. s. tsavo, Trypanosoma godfreyi, Trypanosoma vivax, and Trypanosoma lewisi). Results LAMP test The results of the SRA LAMP assay are shown in Figures 1– 4 and Table 1. When the test was carried out without loop primers a product was detected after 50 min. The inclusion of loop primers reduced the reaction time from an average of 50 min down to between 20 and 25 min and increased the sensitivity 100-fold. The best results were obtained when the reaction temperature was maintained at 62°C. All the positive LAMP reactions produced a characteristic ladder of multiple bands on an agarose gel (Figure 1A and 1B), indicating that stem-loop DNA with inverted repeats of the target sequence was produced. Positive reactions turned green on addition of SYBR Green I, while the negative ones remained orange (Figure 3). RsaI restriction enzyme digestion and electrophoresis gave the predicted sizes of 90 bp and 114 bp (Figure 1B). The SRA LAMP amplicons showed reproducible melt curves with a Tm of ∼87.5°C, suggesting amplicons of the same sequence (Figure 4). The cloned sequence showed 100% identity with the target sequence, and revealed that the length varied with sequence repeats of primers and there complementary sequences. The analytical sensitivity of SRA LAMP assay improved from a dilution of 10−4 to 10−6 when a template (DNA or supernatant) was preheated before being added to a reaction (Figure 2), with the best detection limit of dilution 10−7 recorded with supernatant prepared from the buffy coat. The classical PCR based on the same gene [3] showed a detection limit of dilution 10−4. The SRA LAMP detected all the 49 (100%) T. b. rhodesiense (including the six samples isolated directly from HAT patients), while TBR1 and 2 primers detected 39 out of 46 (84.8%) and SRA PCR detected 31 out of 46 (67.4%) samples (Table 1). The SRA LAMP test was specific and no cross-reaction was recorded with nontarget DNA. 10.1371/journal.pntd.0000147.g001 Figure 1 Analytical Sensitivity of SRA LAMP and Restriction Enzyme Digestion Results. (A) Sensitivity of the SRA LAMP assay using DNA lysate from T. b. rhodesiense isolate LVH 56. Sensitivity results for 10-fold dilutions from infected mouse blood showed identical results. The lysate/supernatant was heated at 96°C for 1 min before being added to the reaction mixture. The reactions which were done in triplicates showed detection limit of ≈1 pg an equivalent of dilution 10−5. M, 100 bp marker, TMRS 127, T. b. rhodesiense, neat (100 ng), 10−1 (10 ng), 10−2 (1 ng), 10−3 (100 pg), 10−4 (10 pg), 10−5 (1 pg), 10−6 (100 fg), 10−7 (10 fg), and NC, negative control. The detection limit for SRA PCR was 10−2 (100 pg≈1,000 trypanosomes/ml). (B) Electrophoresis results for isolates TMRS 127 (lane 1) and LVH 56 (lane 3), and their RsaI restriction enzyme digests (lane 2 for TMRS 127 and lane 4 for LVH 56). M, 100 bp marker. 10.1371/journal.pntd.0000147.g002 Figure 2 Comparison of the Sensitivity of SRA LAMP Under Different Conditions. Sensitivity was compared using preheated and cold template for T. b. rhodesiense isolate LVH 56 (1 and 3) and 058 (2 and 4), respectively, and as monitored using the Rotor-Gene 3000 thermocycler. Preheating of the template accelerates the detection of a positive reaction by approximately 12 min. 10.1371/journal.pntd.0000147.g003 Figure 3 Visual Appearance of Postassay SRA LAMP Reactions from Isolates after the Addition of 1 µl of 1/10 Dilution of SYBR Green I. Positive samples produce a green colour almost immediately (tubes 1, 2, and 3 containing 100 pg of T. b. rhodesiense DNA) while negatives remain orange (tube 4 and NC, negative control). 10.1371/journal.pntd.0000147.g004 Figure 4 Melting Curves for T. b. rhodesiense SRA LAMP Product as Monitored in Rotor-Gene 3000. The curves were obtained after LAMP amplification for 35 min and detected on the FAM channel using 1°C steps, and a hold of 30 sec, at each step from 60 to 96°C. All isolates had a melting temperature (Tm) of ∼87.5°C indicating similar sequences, and hence similar amplicon. Discussion In the present study we were able to demonstrate the successful amplification of T. b. rhodesiense DNA within 20–25 min at 62°C using the SRA LAMP assay. However, we set the optimal time at 35 min to amplify DNA at low concentrations. The results of the SRA LAMP assay were identical when either a water bath or a thermocycler was used to maintain the temperature at 62°C, demonstrating its robustness. Preheating of the template increased the efficiency of the assay by shortening the duration (Figure 2) and increasing sensitivity of the test. DNA amplification is preceded by strand separation under isothermal conditions using betaine, which destabilises the DNA helix [8]. It would appear that preheating of the sample produced a faster and/or a greater amount of strand separation, which translated into a far more rapid assay. All positive samples detected by gel electrophoresis or in real-time using SYTO-9 fluorescence dye could also be detected visually by addition of SYBR Green I to the product. This ability highlights another advantage of LAMP technique: the results of amplification can visually be observed through addition of a DNA intercalating dye (Figure 3), eliminating the need for gel electrophoresis and greatly reducing the time taken for result analysis. When pure trypanosome DNA was used, the detection limit of the SRA LAMP test without loop primers was an equivalent of 1,000 trypanosomes/ml. This limit was improved to an equivalent of one trypanosome/ml with the inclusion of loop primers. Increased sensitivity and reduction in LAMP reaction time with the addition of loop primers is well documented [20] and has been demonstrated in detection of Mycobacterium [11], periodontal pathogens [12], and Plasmodium falciparum malaria [10]. Loop primers accelerate the LAMP reaction by hybridising to the stem-loop region, initiating further DNA amplification [20]. When different templates were used, heat-treated buffy coat from mice blood performed better than the supernatant obtained after boiling blood samples. The higher sensitivity recorded could be the effect of concentrating the parasites in the buffy coat through centrifugation; therefore, buffy coat seems a superior template for SRA LAMP test. The robustness of the LAMP test is demonstrated by the ability to amplify target DNA from various templates without the expensive and time-consuming process of DNA purification. We observed no inhibitory effects in using 2–5 µl of supernatant in a 25 µl reaction or an increase in sensitivity beyond 2 µl, indicating that this volume was the optimal for our samples. The possibility of using heat-processed samples without compromising sensitivity eliminates the need for DNA extraction and further shortens the LAMP reaction. Other studies have shown superior tolerance of LAMP tests for biological substances [9],[13] and heat processed blood has been used successfully in detection Malaria [10]. The method of template preparation for use in LAMP tests, however, needs to be further developed. The potential usefulness of SRA LAMP is confirmed by its ability to detect T. b. rhodesiense directly from parasitaemic and apparently aparasitaemic clinical samples (human blood and CSF). The human blood (JE2 and JE3) and CSF samples JE8–JE10 used in the present study were negative by microscopy at the time of sampling. Parasites were demonstrated only following inoculation of the samples in mice. When the samples were tested, they were positive by SRA LAMP assay while only JE4, JE9, and JE10 were positive using TBR PCR (Table 1) [7]. Detection of aparasitaemic samples demonstrates one of the practical values of SRA LAMP in sleeping sickness diagnosis-time-consuming parasite multiplication assays in mice are unnecessary, and early diagnosis increases the chances of cure after treatment. In the present study, amplification of the target sequence was confirmed by restriction enzyme digestion using RsaI, melting curve analysis, and sequence analysis. It is important to distinguish T b. rhodesiense and T. b. gambiense since the two parasitic infections have different treatments. In recent years the T. b. rhodesiense region in Southern Uganda has been expanding towards the T. b. gambiense focus as a result of livestock movement [21],[22]. There is therefore a need to continue development of rapid and sensitive techniques to differentiate the two parasites and to compliment the available PCR tests, and to this end the SRA LAMP assay has shown great potential for this application. The LAMP test should theoretically not amplify nontarget sequences, since the specificity is enhanced by using a set of six primers. However there is a high risk of amplicon contamination since the tubes have to be opened to add the dye. Analysis of any false positive reactions through sequencing and restriction enzyme analysis would easily distinguish between false positive and contamination. To reduce the chances of contamination, similar protocols to those followed for PCR are required. However, the great potential for LAMP is that reactions can be performed and results read without opening tubes [23]. On this end, more work is needed to develop such a closed reaction system for diagnosing sleeping sickness. This study has shown that the SRA LAMP assay could be developed into an assay for T. b. rhodesiense that is simple to use at point of care. The detection of the equivalent of one trypanosome/ml in the buffy coat (with the possibility of reducing this further to 0.1 trypanosomes/ml) compares well with the normal parasitaemia in humans. Since DNA amplification and reading of results require minimum equipment, the technique has great potential for use in the HAT-endemic countries as back-up test for other HAT tests currently in use.
- Record: found
- Abstract: found
- Article: not found
African trypanosomiasis: Sensitive and rapid detection of the sub-genus Trypanozoon by loop-mediated isothermal amplification (LAMP) of parasite DNA
Z.K. Njiru, A.S.J. Mikosza, E Matovu … (2007)
Control of human African trypanosomiasis (HAT) is dependent on accurate diagnosis and treatment of infected patients. However, sensitivities of tests in routine use are unsatisfactory, due to the characteristically low parasitaemias in naturally infected individuals. We have identified a conserved sequence in the repetitive insertion mobile element (RIME) of the sub-genus Trypanozoon and used it to design primers for a highly specific loop-mediated isothermal amplification (LAMP) test. The test was used to analyse Trypanozoon isolates and clinical samples from HAT patients. The RIME LAMP assay was performed at 62 °C using real-time PCR and a water bath. DNA amplification was detectable within 25 min. All positive samples detected by gel electrophoresis or in real-time using SYTO-9 fluorescence dye could also be detected visually by addition of SYBR Green I to the product. The amplicon was unequivocally confirmed through restriction enzyme NdeI digestion, analysis of melt curves and sequencing. The analytical sensitivity of the RIME LAMP assay was equivalent to 0.001 trypanosomes/ml while that of classical PCR tests ranged from 0.1 to 1000 trypanosomes/ml. LAMP detected all 75 Trypanozoon isolates while TBR1 and two primers (specific for sub-genus Trypanozoon) showed a sensitivity of 86.9%. The SRA gene PCR detected 21 out of 40 Trypanosoma brucei rhodesiense isolates while Trypanosoma gambiense-specific glycoprotein primers (TgsGP) detected 11 out of 13 T. b. gambiense isolates. Using clinical samples, the LAMP test detected parasite DNA in 18 out of 20 samples which included using supernatant prepared from boiled blood, CSF and direct native serum. The sensitivity and reproducibility of the LAMP assay coupled with the ability to detect the results visually without the need for sophisticated equipment indicate that the technique has strong potential for detection of HAT in clinical settings. Since the LAMP test shows a high tolerance to different biological substances, determination of the appropriate protocols for processing the template to make it a user-friendly technique, prior to large scale evaluation, is needed.
- Record: found
- Abstract: found
- Article: not found
Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus.
J Dukes, D. King, S Alexandersen (2006)
Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV transcript were detected in twenty-two minutes. Amplification products were detected by visual inspection, agarose gel electrophoresis, or in real-time by the addition of a fluorescent dye. The specificity of the reaction was demonstrated by the absence of amplification of RNA from other viruses that cause vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan assay, RT-LAMP appears to be sensitive, rapid, specific, and cost-effective, with the potential for field deployment and use by developing countries for FMDV surveillance.
Author and article information
Journal
Journal ID (nlm-ta): Vet World
Journal ID (iso-abbrev): Vet World
Title:
Veterinary World
Publisher:
Veterinary World
(India
)
ISSN
(Print):
0972-8988
ISSN
(Electronic):
2231-0916
Publication date
(Print):
May
2016
Publication date
(Electronic):
11
May
2016
Volume: 9
Issue: 5
Pages: 465-469
Affiliations
[1
]Department of Veterinary Biochemistry, Odisha University of Agriculture & Technology,
Bhubaneswar, Odisha, India
Author notes
Corresponding author: Pravas Ranjan Sahoo, e-mail:
pravasvet86@
123456gmail.com
, KS:
babuivri@
123456gmail.com
, SM:
swagat.physiology@
123456gmail.com
, DP:
bapu8280@
123456mail.com
Article
DOI: 10.14202/vetworld.2016.465-469
PMC ID: 4893716
PubMed ID: 27284221
SO-VID: f6b6f875-0a7b-4c74-b639-a7460d9c5bea
Copyright © Copyright: © Sahoo,
et al.
License:
Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License ( http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
History
Date
received
: 23
February
2016
Date
accepted
: 05
April
2016
Categories
Subject:
Review Article
Data availability: