Introduction
Somatic gain-of-function mutations in exons encoding the epidermal growth factor receptor
(EGFR) tyrosine kinase domain are found in about 10% of non-small cell lung cancers
(NSCLCs) from the United States [1,2,3], with higher percentages observed in east
Asia [2,4,5,6]. Some 90% of NSCLC-associated mutations occur as either multi-nucleotide
in-frame deletions in exon 19, involving elimination of four amino acids, Leu-Arg-Glu-Ala,
or as a single nucleotide substitution at nucleotide 2573 (T→G) in exon 21, resulting
in substitution of arginine for leucine at position 858 (L858R). Both of these mutations
are associated with sensitivity to the small-molecule kinase inhibitors gefitinib
or erlotinib [1,2,3]. Unfortunately, nearly all patients who experience marked improvement
on these drugs eventually develop progression of disease. While KRAS mutations have
been associated with some cases of primary resistance to gefitinib or erlotinib [7],
mechanisms underlying “acquired” or “secondary” resistance are unknown.
Acquired resistance to kinase-targeted anticancer therapy has been most extensively
studied with imatinib, an inhibitor of the aberrant BCR-ABL kinase, in chronic myelogenous
leukemia (CML). Mutations in the ABL kinase domain are found in 50%–90% of patients
with secondary resistance to the drug (reviewed in [8]). Such mutations, which cluster
in four distinct regions of the ABL kinase domain (the ATP binding loop, T315, M351,
and the activation loop), interfere with binding of imatinib to ABL [9,10,11]. Crystallographic
studies of various ABL mutants predict that most should remain sensitive to inhibitors
that bind ABL with less stringent structural requirements. Using this insight, new
small-molecule inhibitors have been identified that retain activity against the majority
of imatinib-resistant BCR-ABL mutants [12,13].
Although imatinib inhibits different kinases in various diseases (BCR-ABL in CML,
KIT or PDGFR-alpha in gastrointestinal stromal tumors [GISTs], and PDGFR-alpha in
hypereosinophilic syndrome [HES]) (reviewed in [14]), some tumors that become refractory
to treatment with imatinib appear to have analogous secondary mutations in the kinase-coding
domain of the genes encoding these three enzymes. For example, in CML, a commonly
found mutation is a C→T single nucleotide change that replaces threonine with isoleucine
at position 315 (T315I) in the ABL kinase domain [9,10,11]. In GIST and HES, respectively,
the analogous T670I mutation in KIT and T674I mutation in PDGFR-alpha have been associated
with acquired resistance to this drug [15,16].
To determine whether lung cancers that acquire clinical resistance to either gefitinib
or erlotinib display additional mutations in the EGFR kinase domain, we have examined
the status of EGFR exons 18 to 24 in tumors from five patients who initially responded
but subsequently progressed while on these drugs. These exons were also assessed in
tumor cells from a sixth patient whose disease rapidly recurred while on gefitinib
therapy after complete gross tumor resection. Because of the association of KRAS mutations
with primary resistance to gefitinib and erlotinib [7], we also examined the status
of KRAS in tumor cells from these six patients. In an effort to explain the selective
advantage of cells with a newly identified “resistance” mutation in EGFR—a T790M amino
acid substitution—we further characterized the drug sensitivity of putatively resistant
EGFR mutants versus wild-type or drug-sensitive EGFR mutants, using both a NSCLC cell
line fortuitously found to contain the T790M mutation and lysates from cells transiently
transfected with wild-type and mutant EGFR cDNAs.
Methods
Tissue Procurement
Tumor specimens, including paraffin blocks, fine needle biopsies, and pleural effusions,
were obtained through protocols approved by the Institutional Review Board of Memorial
Sloan-Kettering Cancer Center (protocol 92–055 [7] and protocol 04–103 [Protocol S1]).
All patients provided informed consent.
Mutational Analyses of EGFR and KRAS in Lung Tumors
Genomic DNA was extracted from tumor specimens, and primers for EGFR (exons 18–24)
and KRAS2 (exon 2) analyses were as published [3,7]. All sequencing reactions were
performed in both forward and reverse directions, and all mutations were confirmed
at least twice from independent PCR isolates.
A specific exon 20 mutation (T790M) was also detected by length analysis of fluorescently
labeled (FAM) PCR products on a capillary electrophoresis device (ABI 3100 Avant,
Applied Biosystems, Foster City, California, United States), based on a new NlaIII
restriction site created by the T790M mutation (2369 C→T), using the following primers:
EGFR Ex20F, 5′-FAM-
CTCCCTCCAGGAAGCCTACGTGAT-3′ and EGFR Ex20R 5′-
TTTGCGATCTGCACACACCA-3′. Using serially mixed dilutions of DNA from NSCLC cell
lines (H1975, L858R- and T790M-positive; H-2030, EGFR wild-type) for calibration,
this assay detects the presence of the T790M mutation when H1975 DNA comprises 3%
or more of the total DNA tested, compared to a sensitivity of 6% for direct sequencing
(data not shown).
RT-PCR
The following primers were used to generate EGFR cDNA fragments spanning exon 20:
EGFR 2095F 5′-
CCCAACCAAGCTCTCTTGAG-3′ and EGFR 2943R 5′-
ATGACAAGGTAGCGCTGGGGG-3′. PCR products were ligated into plasmids using the TOPO
TA-cloning kit (Invitrogen, Carlsbad, California, United States), as per manufacturer's
instructions. Minipreps of DNA from individual clones were sequenced using the T7
priming site of the cloning vector.
Functional Analyses of Mutant EGFRs
Two numbering systems are used for EGFR. The first denotes the initiating methionine
in the signal sequence as amino acid −24. The second, used here, denotes the methionine
as amino acid +1. Commercial suppliers of antibodies, such as the Y1068-specific anti-phospho-EGFR,
use the first nomenclature. To be consistent, we consider Y1068 as Y1092. Likewise,
the T790M mutation reported here has also been called T766M. Mutations were introduced
into full-length wild-type and mutant EGFR cDNAs using a QuikChange Site-Directed
Mutagenesis Kit (Stratagene, La Jolla, California, United States) and cloned into
expression vectors as described [3]. The following primers were used to generate the
deletion (del) L747–E749;A750P mutant: forward 5′-
TAAAATTCCCGTCGCTATCAAGGAGCCAACATCTCCGAAAGCCAACAAGG-3′ and reverse 5′-
CCTTGTTGGCTTTCGGAGATGTTGGCTCCTTGATAGCGACGGGAATTTTA-3′. The following primers
were used to introduce the T790M mutation: forward 5′-
AGCTCATCATGCAGCTCAT-3′ and reverse 5′-
ATGAGCTGCATGATGAGCT-3′. The L858R mutant cDNA was generated previously [3]. All
mutant clones were fully re-sequenced bidirectionally to ensure that no additional
mutations were introduced. Various EGFRs were transiently expressed in 293T human
embryonic kidney cells as published [3]. Cells were treated with different concentrations
of gefitinib or erlotinib.
Immunoblotting
See Methods and supplementary methods in [3] for details on cell lysis, immunoblotting,
and antibody reagents. At least three independent experiments were performed for all
analyses.
Cell Culture
The NSCLC cell lines H1650, H1975, H2030, H2347, H2444, H358, and H1734 were purchased
from American Type Culture Collection (Manassas, Virginia, United States). H3255 was
a gift of B. Johnson and P. Janne. Cells were grown in complete growth medium (RPMI-1640;
American Type Culture Collection catalog no. 30–2001) supplemented with 10% fetal
calf serum, 10 units/ml penicillin, and 10 μg/ml streptomycin) at 37 °C and 5% CO2.
For viability studies, cells were seeded in complete growth medium in black 96-well
clear bottom ViewPlates (PerkinElmer, Wellesley, Massachusetts, United States) at
a density of 5,000 (H1975 and H2030) or 7,500 cells per well (H3255). Following overnight
incubation, cells were grown for 24 h in the supplemented RPMI-1640 medium with 0.1%
serum. Cells (in supplemented RPMI-1640 medium containing 0.1% serum) were then incubated
for 48 h in the continued presence of gefitinib or erlotinib.
Viability Assay
Cell viability was assayed using Calcein AM (acetoxymethyl ester of Calcein, Molecular
Probes, Eugene, Oregon, United States). Following incubation with gefitinib or erlotinib,
monolayers were washed twice with PBS (containing calcium and magnesium) and incubated
with 7.5 μmol Calcein AM in supplemented RPMI-1640 (no serum) for 30 min. Labeling
medium was removed, and cells were washed three times with PBS. Calcein fluorescence
(Ex, 485 nm; Em, 535 nM) was detected immediately using a Victor V multi-label plate
reader (PerkinElmer). Three independent experiments were performed for each cell line;
each experiment included four to eight replicates per condition.
Results
Case Reports
We identified secondary EGFR mutations in three of six individuals whose disease progressed
on either gefitinib or erlotinib (Table 1). Brief case histories of these three patients
are presented below.
Patient 1
This 63-y-old female “never smoker” (smoked less than 100 cigarettes in her lifetime)
initially presented with bilateral diffuse chest opacities and a right-sided pleural
effusion. Transbronchial biopsy revealed adenocarcinoma. Disease progressed on two
cycles of systemic chemotherapy, after which gefitinib, 250 mg daily, was started.
Comparison of chest radiographs obtained prior to starting gefitinib (Figure S1A,
left panel) and 2 wk later (Figure S1A, middle panel) showed dramatic improvement.
Nine months later, a chest radiograph revealed progression of disease (Figure S1A,
right panel). Subsequently, the patient underwent a computed tomography (CT)–guided
biopsy of an area in the right lung base (Figure 1A, left panel). Despite continued
treatment with gefitinib, either with chemotherapy or at 500 mg daily, the pleural
effusion recurred, 12 mo after initiating gefitinib (Figure 1A, right panel). Pleural
fluid was obtained for molecular studies. In total, this patient had three tumor specimens
available for analysis: the original lung tumor biopsy, a biopsy of the progressing
lung lesion, and pleural fluid. However, re-review of the original transbronchial
biopsy showed that it had scant tumor cells (Table 1).
Patient 2.
This 55-y-old woman with a nine pack-year history of smoking underwent two surgical
resections within 2 y (right lower and left upper lobectomies) for bronchioloalveolar
carcinoma with focal invasion. Two years later, her disease recurred with bilateral
pulmonary nodules and further progressed on systemic chemotherapy. Thereafter, the
patient began erlotinib, 150 mg daily. A baseline CT scan of the chest demonstrated
innumerable bilateral nodules (Figure S1B, left panel), which were markedly reduced
in number and size 4 mo after treatment (Figure S1B, middle panel). After 14 mo of
therapy, the patient's dose of erlotinib was decreased to 100 mg daily owing to fatigue.
At 23 mo of treatment with erlotinib, a CT scan demonstrated an enlarging sclerotic
lesion in the thoracic spine. The patient underwent CT-guided biopsy of this lesion
(Figure 1B, left panel), and the erlotinib dose was increased to 150 mg daily. After
25 mo of treatment, she progressed within the lung (Figure S1B, right panel). Erlotinib
was discontinued, and a fluoroscopically guided core needle biopsy was performed at
a site of progressive disease in the lung (Figure 1B, right panel). In total, this
patient had three tumor specimens available for analysis: the original resected lung
tumor, the biopsy of the enlarging spinal lesion, and the biopsy of the progressing
lung lesion (Table 1).
Patient 3
This 55-y-old female “never smoker” was treated for nearly 4.5 y with weekly paclitaxel
and trastuzumab [17] for adenocarcinoma with bronchioloalveolar carcinoma features
involving her left lower lobe, pleura, and mediastinal lymph nodes. Treatment was
discontinued owing to fatigue. Subsequently, the patient underwent surgical resection.
Because of metastatic involvement of multiple mediastinal lymph nodes and clinical
features known at that time to be predictive of response to gefitinib (female, never
smoker, bronchioloalveolar variant histology), she was placed on “adjuvant” gefitinib
1 mo later (Figure S1C, left panel). This drug was discontinued after 3 mo when she
developed a new left-sided malignant pleural effusion (Figure S1C, middle panel).
Despite drainage and systemic chemotherapy, the pleural effusion recurred 4 mo later
(Figure S1C, right panel), at which time pleural fluid was collected for analysis.
In total, this patient had two clinical specimens available for analysis: tumor from
the surgical resection and pleural fluid (Table 1).
Patients' Tumors Contain EGFR Tyrosine Kinase Domain Mutations Associated with Sensitivity
to EGFR Tyrosine Kinase Inhibitors
We screened all available tumor samples from these three patients for previously described
drug-sensitive EGFR mutations, by direct DNA sequencing of exons 19 and 21 [3]. Tumor
samples from patient 1 showed a T→G change at nucleotide 2573, resulting in the exon
21 L858R amino acid substitution commonly observed in drug-responsive tumors. This
mutation was present in the biopsy material from the progressing lung lesion (Figure
S2A, upper panels) and from cells from the pleural effusion (Figure S2A, lower panels),
both of which on cytopathologic examination consisted of a majority of tumor cells
(Table 1). Interestingly, comparisons of the tracings suggest that an increase in
copy number of the mutant allele may have occurred. Specifically, while the ratio
of wild-type (nucleotide T) to mutant (nucleotide G) peaks at position 2573 was approximately
1:1 or 1:2 in the lung biopsy specimen (Figure S2A, upper panels), sequencing of DNA
from the pleural fluid cells demonstrated a dominant mutant G peak (Figure S2A, lower
panels). Consistent with this, a single nucleotide polymorphism (SNP) noted at nucleotide
2361 (A or G) demonstrated a corresponding change in the ratios of A:G, with a 1:1
ratio in the transbronchial biopsy, and a nearly 5:1 ratio in the pleural fluid (Figure
2A). Notably, we did not detect the 2573 T→G mutation in the original transbronchial
biopsy specimen (Table 1; data not shown). As stated above, this latter specimen contained
scant tumor cells, most likely fewer than needed for detection of an EGFR mutation
by direct sequencing (see [7]).
All three specimens from patient 2, including the original lung tumor and the two
metastatic samples from bone and lung, showed an exon 19 deletion involving elimination
of 11 nucleotides (2238–2248) and insertion of two nucleotides, G and C (Figure S2B,
all panels; Table 1). These nucleotide changes delete amino acids L747–E749 and change
amino acid 750 from alanine to proline (A750P). A del L747–E749;A750P mutation was
previously reported with different nucleotide changes [2]. In all samples from patient
2, the wild-type sequence predominated at a ratio of about 3:1 over the mutant sequence.
Both of the available tumor samples from patient 3 contained a deletion of 15 nucleotides
(2236–2250) in exon 19 (Table 1; data not shown), resulting in elimination of five
amino acids (del E746–A750). This specific deletion has been previously reported [3].
The ratio of mutant to wild-type peaks was approximately 1:1 in both specimens (data
not shown).
Collectively, these results demonstrate that tumors from all three patients contain
EGFR mutations associated with sensitivity to the tyrosine kinase inhibitors gefitinib
and erlotinib. In addition, these data show that within individual patients, metastatic
or recurrent lesions to the spine, lung, and pleural fluid contain the same mutations.
These latter observations support the idea that relapsing and metastatic tumor cells
within individuals are derived from original progenitor clones.
A Secondary Missense Mutation in the EGFR Kinase Domain Detected in Lesions That Progressed
while on Treatment with Either Gefitinib or Erlotinib
To determine whether additional mutations in the EGFR kinase domain were associated
with progression of disease in these patients, we performed direct sequencing of all
of the exons (18 through 24) encoding the EGFR catalytic region in the available tumor
specimens.
Analysis of patient 1's pre-gefitinib specimen, which contained scant tumor cells
(Table 1; see above), not surprisingly showed only wild-type EGFR sequence (Table
1; data not shown). However, careful analysis of the exon 20 sequence chromatograms
in both forward and reverse directions from this patient's lung biopsy specimen obtained
after disease progression on gefitinib demonstrated an additional small peak at nucleotide
2369, suggesting a C→T mutation (Figure 2A, upper panels; Table 1). This nucleotide
change leads to substitution of methionine for threonine at position 790 (T790M).
The 2369 C→T mutant peak was even more prominent in cells from the patient's pleural
fluid, which were obtained after further disease progression on gefitinib (Figure
2A, lower panels; Table 1). The increase in the ratio of mutant to wild-type peaks
obtained from analyses of the lung specimen and pleural fluid paralleled the increase
in the ratio of the mutant G peak (leading to the L858R mutation) to the wild-type
T peak at nucleotide 2573 (see above; Figure S2A), as well as the increase in the
ratio of the A:G SNP at position 2361 (Figure 2A). Collectively, these findings imply
that the exon 20 T790M mutation was present on the same allele as the exon 21 L858R
mutation, and that a subclone of cells harboring these mutations emerged during drug
treatment.
In patient 2, the tumor-rich sample obtained prior to treatment with erlotinib did
not contain any additional mutations in the exons encoding the EGFR tyrosine kinase
domain (Figure 2B, upper panels; Table 1). By contrast, her progressing bone and lung
lesions contained an additional small peak at nucleotide 2369, suggesting the existence
of a subclone of tumor cells with the same C→T mutation observed in patient 1 (Figure
2B, middle and lower panels; Table 1). The relative sizes of the 2369 T mutant peaks
seen in these latter two samples appeared to correlate with the relative size of the
corresponding peaks of the exon 19 deletion (Figure S2B). Interestingly, the SNP at
nucleotide 2361 (A or G) was detected in specimens from patient 2 before but not after
treatment with erlotinib, suggesting that one EGFR allele underwent amplification
or deletion during the course of treatment (Figure S2B).
Patient 3 showed results analogous to those of patient 2. A tumor-rich pre-treatment
specimen did not demonstrate EGFR mutations other than the del E746–A750 exon 19 deletion;
specifically, in exon 20, no secondary changes were detected (Figure 2C, upper panels;
Table 1). However, analysis of DNA from cells in the pleural effusion that developed
after treatment with gefitinib showed the C→T mutation at nucleotide 2369 in exon
20 (Figure 2C, lower panels; Table 1), corresponding to the T790M mutation described
above. There was no dramatic change between the two samples in the ratio of the A:G
SNP at position 2361. The mutant 2369 T peak was small, possibly because gefitinib
had been discontinued in this patient for 4 mo at the time pleural fluid tumor cells
were collected; thus, there was no selective advantage conferred upon cells bearing
the T790M mutation.
To determine whether the 2369 C→T mutation was a previously overlooked EGFR mutation
found in NSCLCs, we re-reviewed exon 20 sequence tracings derived from analysis of
96 fresh-frozen resected tumors [3] and 59 paraffin-embedded tumors [7], all of which
were removed from patients prior to treatment with an EGFR tyrosine kinase inhibitor.
We did not detect any evidence of the T790M mutation in these 155 tumors (data not
shown; see Discussion). Collectively, our results suggest that the T790M mutation
is associated with lesions that progress while on gefitinib or erlotinib. Moreover,
at least in patients 1 and 2, the subclones of tumor cells bearing this mutation probably
emerged between the time of initial treatment with a tyrosine kinase inhibitor and
the appearance of drug resistance.
In three additional patients (case histories not described here) with lung adenocarcinomas
who improved but subsequently progressed on therapy with either gefitinib or erlotinib,
we examined DNA from tumor specimens obtained during disease progression. In all three
patients, we found EGFR mutations associated with drug sensitivity (all exon 19 deletions).
However, we did not find any additional mutations in exons 18 to 24 of EGFR, including
the C→T change at position 2369 (data not shown). These results imply that alternative
mechanisms of acquired drug resistance exist.
Patients' Progressive Tumors Lack KRAS Mutations
Mutations in exon 2 of KRAS2 occur in about one-fourth of NSCLCs. Such mutations rarely,
if ever, accompany EGFR mutations and are associated with primary resistance to gefitinib
or erlotinib [7]. To evaluate the possibility that secondary KRAS mutations confer
acquired resistance to these drugs, we performed mutational profiling of KRAS2 exon
2 from tumor specimens from patients 1 to 3, as well as the three additional patients
lacking evidence of the T790M mutation. None of the specimens contained any changes
in KRAS (Table 1; data not shown), indicating that KRAS mutations were not responsible
for drug resistance and tumor progression in these six patients.
An Established NSCLC Cell Line Also Contains Both T790M and L858R Mutations
We profiled the EGFR tyrosine kinase domain (exons 18 to 24) and KRAS exon 2 in eight
established NSCLC lines (Table 2). Surprisingly, one cell line—H1975—contained the
same C→T mutation at position 2369 (T790M) as described above (Figure 2D, lower panel).
This cell line had previously been shown by others to contain a 2573 T→G mutation
in exon 21 (L858R) [18], which we confirmed (Figure 2D, upper panel); in addition,
H1975 was reported to be more sensitive to gefitinib inhibition than other lung cancer
cell lines bearing wild-type EGFR [18]. Only exons 19 and 21 were apparently examined
in this published study.
In our own analysis of H1975 (exons 18 to 24), the mutant 2369 T peak resulting in
the T790M amino acid substitution was dominant, suggesting an increase in copy number
of the mutant allele in comparison to the wild-type allele. The ratio of mutant to
wild-type peaks was similar to that of the mutant 2573 G (corresponding to the L858R
amino acid substitution) to wild-type T peaks (Figure 2D, all panels), implying that
the T790M and L858R mutations were in the same amplified allele. To further investigate
this possibility, we performed RT-PCR to generate cDNAs that spanned exon 20 of EGFR
and included sequences from exon 19 and 21. PCR products were then cloned, and individual
colonies were analyzed for EGFR mutations. Sequencing chromatograms of DNA from four
of four clones showed both the 2369 C→T and 2573 T→G mutations, confirming that both
mutations were in the same allele (data not shown).
Other NSCLC cell lines carried either EGFR or KRAS mutations, but none had both (Table
2). As reported, H3255 contained an L858R mutation [19] and H1650 contained an exon
19 deletion [18]. No other cell lines analyzed contained additional mutations in the
exons encoding the EGFR tyrosine kinase domain.
A Novel PCR Restriction Fragment Length Polymorphism Assay Independently Confirms
the Absence or Presence of the T790M Mutation
As stated above, the mutant peaks suggestive of a T790M mutation in exon 20 were small
in some sequence chromatograms. To eliminate the possibility that these peaks were
due to background “noise,” we sought to confirm the presence of the 2369 C→T mutation
in specific samples, by developing an independent test, based on a fluorescence detection
assay that takes advantage of a PCR restriction fragment length polymorphism (PCR-RFLP)
generated by the specific missense mutation. After PCR amplification with exon-20-specific
primers spanning nucleotide 2369, wild-type sequence contains specific NlaIII sites,
which upon digestion yield a 106-bp product (see Methods; Figure 3A). Presence of
the mutant 2369 T nucleotide creates a new NlaIII restriction digest site, yielding
a slightly shorter product (97 bp), readily detected by fluorescent capillary electrophoresis.
This test is about 2 -fold more sensitive than direct sequencing (see Methods; data
not shown).
We first used DNA from the H1975 cell line (which contains both T790M and L858R mutations)
to confirm the specificity of the PCR-RFLP assay. As expected, analysis of these cells
produced both the 97- and 106-bp fragments. By contrast, analysis of DNA from H2030
(which contains wild-type EGFR; Table 2) showed only the 106-bp fragment (Figure 3A).
These data show that this test can readily indicate the absence or presence of the
mutant allele in DNA samples. However, this test was only semi-quantitative, as the
ratio of the mutant 97-bp product versus the wild-type 106-bp product varied in independent
experiments from approximately 1:1 to 2:1.
We next used this PCR-RFLP assay to assess various patient samples for the presence
of the specific 2369 C→T mutation corresponding to the T790M amino acid substitution.
DNA from the progressing bone and lung lesions in patient 1 produced both the 97-
and 106-bp fragments, but DNA from the original lung tumor did not (Figure 3B). The
ratio of mutant to wild-type products was higher in the cells from the pleural fluid,
consistent with the higher peaks seen on the chromatograms from direct sequencing
of exon 20 (see Figure 2A). Likewise, DNA from progressive lesions from patients 2
and 3 yielded both 97- and 106-bp fragments in the PCR-RFLP assay (Figure 3B), whereas
the pre-treatment specimens did not produce the 97-bp product. Collectively, these
data from an independent assay confirm that the T790M mutation was present in progressing
lesions from all three patients. We were also unable to detect the T790M mutation
in any specimens from the three additional patients with acquired resistance that
failed to demonstrate secondary mutations in EGFR exons 18 to 24 by direct sequencing
(data not shown).
Biochemical Properties of EGFR Mutants
To determine how the T790M mutation would affect EGFR proteins already containing
mutations associated with sensitivity to EGFR tyrosine kinase inhibitors, we introduced
the specific mutation into EGFR cDNAs that encoded the exon 21 and 19 mutations found
in patients 1 and 2, respectively. Corresponding proteins ([i] L858R and L858R plus
T790M, [ii] del L747–E749;A750P and del L747–E749;A750P plus T790M, and [iii] wild-type
EGFR and wild-type EGFR plus T790M) were then produced by transient transfection with
expression vectors in 293T cells, which have very low levels of endogenous EGFR [3].
Various lysates from cells that were serum-starved and pre-treated with gefitinib
or erlotinib were analyzed by immunoblotting. Amounts of total EGFR (t-EGFR) were
determined using an anti-EGFR monoclonal antibody, and actin served as an indicator
of relative levels of protein per sample. To assess the drug sensitivity of the various
EGFR kinases in surrogate assays, we used a Y1092-phosphate-specific antibody (i.e.,
phospho-EGFR [p-EGFR]) to measure the levels of “autophosphorylated” Tyr-1092 on EGFR
in relation to levels of t-EGFR protein. We also assessed the global pattern and levels
of induced tyrosine phosphorylation of cell proteins by using a generalized anti-phosphotyrosine
reagent (RC-20).
Gefitinib inhibited the activity of wild-type and L858R EGFRs progressively with increasing
concentrations of drug, as demonstrated by a reduction of tyrosine-phosphorylated
proteins (Figure 4A) and a decrease in p-EGFR:t-EGFR ratios (Figure 4B). By contrast,
wild-type and mutant EGFRs containing the T790M mutation did not display a significant
change in either phosphotyrosine induction or p-EGFR:t-EGFR ratios (Figure 4A and
4B). Similar results were obtained using erlotinib against wild-type and del E747–L747;A750P
EGFRs in comparison to the corresponding mutants containing the T790M mutation (Figure
4C). These results suggest that the T790M mutation may impair the ability of gefitinib
or erlotinib to inhibit EGFR tyrosine kinase activity, even in EGFR mutants (i.e.,
L858R or an exon 19 deletion) that are clinically associated with drug sensitivity.
Resistance of a NSCLC Cell Line Harboring Both T790M and L858R Mutations to Gefitinib
or Erlotinib
To further explore the functional consequences of the T790M mutation, we determined
the sensitivity of various NSCLC cells lines grown in the presence of either gefitinib
or erlotinib, using an assay based upon Calcein AM. Uptake and retention of this fluorogenic
esterase substrate by vehicle- versus drug-treated live cells allows for a comparison
of relative cell viability among cell lines [20]. The H3255 cell line, which harbors
the L858R mutation and no other EGFR TK domain mutations (Table 2), was sensitive
to treatment with gefitinib, with an IC50 of about 0.01 μmol (Figure 5). By contrast,
the H1975 cell line, which contains both L858R and T790M mutations (Table 2), was
approximately 100-fold less sensitive to drug, with an IC50 of about 1 μmol (Figure
5). In fact, the sensitivity of H1975 cells was more similar to that of H2030, which
contains wild-type EGFR (exons 18 to 24) and mutant KRAS (Figure 5). Very similar
results were obtained with erlotinib (Figure S3).
Discussion
Specific mutations in the tyrosine kinase domain of EGFR are associated with sensitivity
to either gefitinib or erlotinib, but mechanisms of acquired resistance have not yet
been reported. Based upon analogous studies in other diseases with another kinase
inhibitor, imatinib, a single amino acid substitution from threonine to methionine
at position 790 in the wild-type EGFR kinase domain was predicted to lead to drug
resistance, even before the association of exon 19 and 21 mutations of EGFR with drug
responsiveness in NSCLC was reported. The T790M mutation was shown in vitro in the
context of wild-type EGFR to confer resistance to gefitinib [21] and a related quinazoline
inhibitor, PD153035 [22].
We show here, through molecular analysis of tumor material from three patients and
one NSCLC cell line, as well as additional biochemical studies, that acquired clinical
drug resistance to gefitinib or erlotinib is indeed associated with the T790M mutation.
Importantly, we find that the T790M mutation confers drug resistance not just to wild-type
EGFR but also to mutant EGFRs associated with clinical responsiveness to EGFR tyrosine
kinase inhibitors [1,2,3]. Our results further demonstrate that an analogous mechanism
of acquired resistance exists for imatinib and EGFR tyrosine kinase inhibitors (Table
3), despite the fact that the various agents target different kinases in distinct
diseases.
In tumors from patients not treated with either gefitinib or erlotinib, the 2369 C→T
mutation (T790M) appears to be extremely rare. We have not identified this mutation
in 155 tumors (see above), and among nearly 1,300 lung cancers in which analysis of
EGFR exons 18 to 21 has been performed [1,2,3,4,5,6], only one tumor (which also harbored
an L858R mutation) was reported to contain the T790M mutation. Whether the patient
from which this tumor was resected had received gefitinib or erlotinib is unclear,
and the report did not note an association with acquired resistance to either drug
[5].
How tumor cells bearing the T790M mutation emerge within gefitinib- or erlotinib-treated
patients is a matter of investigation. Subclones bearing this mutation could arise
de novo during treatment. However, based upon analogous studies in CML, it is also
possible that NSCLC subclones bearing this secondary mutation pre-exist within the
primary tumor clone in individual patients, albeit at low frequency [23]. In either
scenario, treatment with gefitinib or erlotinib subsequently allows these resistant
subclones to become apparent, because most cells bearing sensitivity-conferring mutations
die, while cells with the T790M mutation persist.
From analysis of the crystal structure of the EGFR kinase domain bound to erlotinib,
it is has been shown that the wild-type threonine residue at position 790 is located
in the hydrophobic ATP-binding pocket of the catalytic region, where it forms a critical
hydrogen bond with the drug [24]. The related compound, gefitinib, is predicted to
interact with this threonine residue as well. Substitution of the threonine at position
790 by a larger residue like methionine would probably result in steric clash with
the aromatic moieties on these two drugs [25]. By contrast, ATP would likely not depend
on the accessibility of the same hydrophobic cavity and is therefore probably not
affected by the incorporation of a bulky methionine side chain [25]. Consistent with
this, the T790M mutation has been shown not to abrogate the catalytic activity of
wild-type EGFR [22].
The T790M mutation could also affect the kinase activity or alter the substrate specificity
of mutant EGFRs, such that a proliferative advantage would be conferred upon cells
bearing the mutation. Consistent with this, the H1975 NSCLC cell line reported here
to contain both T790M and L858R did not to our knowledge undergo any prior treatment
with gefitinib or erlotinib; the doubly mutated cells must have become dominant over
time through multiple passages in vitro. This scenario could explain the seemingly
contradictory report by others who found the H1975 cell line to be highly sensitive
to gefitinib [18]; our H1975 cells could represent a subclone that emerged over time.
Analysis of earlier passages of H1975 cells for the T790M mutation would be informative
in this regard.
Recently, new small-molecule inhibitors have been identified that retain activity
against the majority of imatinib-resistant BCR-ABL mutants. The new drugs bind to
ABL in an “open” conformation, as opposed to imatinib, which binds ABL in a “closed”
conformation [12,13]. Analogously, it may be possible to find EGFR tyrosine kinase
inhibitors that bind to the EGFR kinase domain in different ways than gefitinib and
erlotinib. For example, the crystal structure of another EGFR inhibitor, lapatinib
(GW572016), was recently solved bound to EGFR [26]. This study revealed that the quinazoline
rings of erlotinib and lapatinib interact differently with the EGFR kinase domain,
suggesting that while the T790M mutation may affect inhibition by erlotinib and gefitinib,
it may not affect inhibition of EGFR by compounds similar to lapatinib. To our knowledge,
no NSCLC patient who initially responded to but then progressed on either gefitinib
or erlotinib has yet been treated with lapatinib.
In some of the patient specimens analyzed, the actual sequencing peaks demonstrating
the T790M mutation were smaller than originally anticipated. These results differ
from those of acquired resistance mutation in CML [10], GIST [15,27], and HES [16].
However, in contrast to all of these diseases, in which tumor cells are readily accessible,
lung-cancer-related tumors are more difficult to access, as illustrated by the limited
manner in which we were able to obtain tumor cells from various sites of disease (see
Figure 1). Moreover, re-biopsy of patients with lung cancer is not routinely performed.
The use of position emission tomography scans to identify the most metabolically active
lesions for biopsy could possibly circumvent this factor in the future, as long as
such lesions are resectable. Additionally, as more molecularly tailored treatment
options become available for lung cancer, re-biopsy of progressive sites of disease
should become a standard procedure, especially for patients on clinical trials of
targeted agents.
Since tumor specimens from three additional patients with acquired resistance to EGFR
tyrosine kinase inhibitors did not demonstrate the T790M mutation, this specific lesion
does not account for all mechanisms of acquired resistance to gefitinib or erlotinib.
Given the paradigm established with imatinib, other drug-resistance mutations in EGFR,
either within or outside the tyrosine kinase domain, are likely to exist. It is also
possible that EGFR amplification itself plays a role in acquired resistance, since
imatinib-resistant clones have been shown to lack resistance mutations but contain
amplified copies of BCR-ABL [11,28]. Nonetheless, studies presented here provide a
basis for the rational development of “second generation” kinase inhibitors for use
in NSCLC.
Supporting Information
Figure S1
Imaging Studies from Patients 1, 2, and 3
(A) Patient 1. Serial chest radiographs from before (day 0) and during gefitinib treatment
(14 d and 9 mo), demonstrating initial response and subsequent progression.
(B) Patient 2. Serial CT studies of the chest before (day 0) and during erlotinib
treatment (4 mo and 25 mo), demonstrating initial response and subsequent progression.
(C) Patient 3. Serial chest radiographs before (day 0) and during adjuvant gefitinib
treatment (3 mo), following complete resection of grossly visible disease. The left-sided
pleural effusion seen at 3 mo recurred 4 mo later, at which time fluid was collected
for molecular analysis.
(951 KB PPT).
Click here for additional data file.
Figure S2
Sequencing Chromatograms with the EGFR Exon 19 and 21 Mutations Identified in Patients
1 and 2
(A) Status of EGFR exon 21 in tumor specimens from patient 1. DNA from the growing
lung lesion and the pleural effusion demonstrated a heterozygous T→G mutation at position
2573, leading to the common L858R amino acid substitution.
(B) All three specimens from patient 2 showed the same heterozygous exon 19 deletion,
removing residues 747–749 and changing the alanine at position 750 to proline.
(104 KB PPT).
Click here for additional data file.
Figure S3
Sensitivity to Erlotinib Differs among NSCLC Cell Lines Containing Various Mutations
in EGFR or KRAS
See legend for Figure 5.
(153 KB PPT).
Click here for additional data file.
Protocol S1
Memorial Sloan-Kettering Cancer Center IRB Protocol 04–103
(566 KB PDF).
Click here for additional data file.
Accession Numbers
The LocusLink (http://www.ncbi.nlm.nih.gov/LocusLink/) accession number for the KRAS2
sequence discussed in this paper is 3845; the GenBank (http://www.ncbi.nlm.nih.gov/Genbank/)
accession number for the KRAS2 sequence discussed in this paper is NT_009714.16. Reference
EGFR sequence was obtained from LocusLink accession number 1956 and GenBank accession
number NT_033968.
Patient Summary
Background
Normal cells in our body have safety mechanisms that keep them from growing out of
control. Tumor cells have somehow found ways around these safety mechanisms, in some
cases through activating particular growth-promoting genes. One of these, the EGFR
gene, is often activated in lung cancer. Two drugs, gefitinib (also known as Iressa)
and erlotinib (also called Tarceva), have been developed to inhibit activated EGFR,
and studies have shown that they can shrink tumors in some patients. Most patients
who respond to these drugs have tumors that carry an alteration (or mutation) in the
EGFR gene, which somehow makes their tumors responsive to the drugs.
Why Was This Study Done?
In those patients in whom the drugs work, the tumors shrink initially, but after a
while they stop responding and the cancer comes back. The cancer has, as researchers
describe it, become resistant to the drugs. Understanding how tumors become resistant
is important to develop new and better drugs.
What Did the Researchers Do?
They asked patients who initially responded to erlotinib or gefitinib but then became
resistant to consent to studies allowing further analysis of tumor tissue during and
after drug treatment. They then re-examined the EGFR gene in these tumor samples.
What Did They Find?
They found that tumors from all patients carried mutations in the EGFR gene that are
known to make them responsive to the drugs. In addition, three of the post-treatment
tumors had an identical second mutation in their EGFR gene. Biochemical studies showed
that these secondary alterations made the original drug-sensitive EGFR less sensitive
to drug treatment. The numbers are small but suggest that this secondary resistance
mutation could be quite common. Tumor cells from the three other patients didn't have
this mutation, which suggests that there are other ways for lung cancers to become
resistant to gefitinib and erlotinib.
What Next?
Larger studies are needed to confirm that this particular mutation is a major cause
of resistance against the two drugs. It is also important to find out what causes
resistance in the other cases. And knowing about this resistance mutation will help
researchers to develop drugs that will work even against tumors with the mutation.
More Information Online
The following pages contain some information on the EGFR kinase inhibitors.
U. S. Food and Drug Administration information page on Iressa (gefitinib): http://www.fda.gov/cder/drug/infopage/iressa/iressaQ&A.htm
Cancer Research UK information page about erlotinib (Tarceva): http://www.cancerhelp.org.uk/help/default.asp?page=10296