5
views
0
recommends
+1 Recommend
0 collections
    0
    shares
      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      Airborne influenza virus shedding by patients in health care units: Removal mechanisms affecting virus transmission

      research-article

      Read this article at

      Bookmark
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          In this study, we characterize the distribution of airborne viruses (influenza A/B) in hospital rooms of patients with confirmed infections. Concurrently, we monitored fine particulate matter (PM 2.5 & PM 10) and several physical parameters including the room air exchange rate, temperature, and relative humidity to identify corresponding correlations with virus transport and removal determinants. The results continue to raise concerns about indoor air quality (IAQ) in healthcare facilities and the potential exposure of patients, staff and visitors to aerosolized viruses as well as elevated indoor PM levels caused by outdoor sources and/or re-suspension of settled particles by indoor activities. The influenza A virus was detected in 42% of 33 monitored rooms, with viruses detectible up to 1.5 m away from the infected patient. Active coughing was a statistically significant variable that contributed to a higher positive rate of virus detection in the collected air samples. Viral load across patient rooms ranged between 222 and 5,760 copies/m 3, with a mean of 820 copies/m 3. Measured PM 2.5 and PM 10 levels exceeded IAQ daily exposure guidelines in most monitored rooms. Statistical and numerical analyses showed that dispersion was the dominant viral removal pathway followed by settling. Changes in the relative humidity and the room’s temperature were had a significant impact on the viral load removal. In closure, we highlight the need for an integrated approach to control determinants of IAQ in patients’ rooms.

          Related collections

          Most cited references107

          • Record: found
          • Abstract: found
          • Article: found

          Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus–Infected Pneumonia in Wuhan, China

          In December 2019, novel coronavirus (2019-nCoV)-infected pneumonia (NCIP) occurred in Wuhan, China. The number of cases has increased rapidly but information on the clinical characteristics of affected patients is limited.
            Bookmark
            • Record: found
            • Abstract: found
            • Article: not found

            Influenza Virus Transmission Is Dependent on Relative Humidity and Temperature

            Introduction Influenza A virus, of the family Orthomyxoviridae, carries an RNA genome consisting of eight segments of negative-stranded RNA. This genome encodes one or two non-structural proteins and nine structural proteins, which, together with a host cell–derived lipid envelope, comprise the influenza virus particle. Influenza virus causes widespread morbidity and mortality among human populations worldwide: in the United States alone, an average of 41,400 deaths and 1.68 million hospitalizations [1] are attributed to influenza each year. In temperate regions like the United States, this impact is felt predominantly during the winter months; that is, epidemics recur with a highly predictable seasonal pattern. In northern latitudes, influenza viruses circulate from November to March, while in the southern hemisphere influenza occurs primarily from May to September [2]. Tropical regions, by contrast, experience influenza throughout the year, although increased incidence has been correlated with rainy seasons [2,3]. Despite extensive documentation of the seasonal cycles of influenza and curiosity as to their causes, little concrete data is available to indicate why influenza virus infections peak in the wintertime. Theories to explain the seasonal variation of influenza have therefore proliferated over the years (reviewed in [4]). Current hypotheses include fluctuations in host immune competence mediated by seasonal factors such as melatonin [5] and vitamin D [6] levels; seasonal changes in host behavior, such as school attendance, air travel [7], and indoor crowding during cold or rainy weather; and environmental factors, including temperature [8], relative humidity (RH), and the direction of air movement in the upper atmosphere [9]. In early studies using mouse-adapted strains of influenza virus, experiments performed in the winter months yielded a transmission rate of 58.2%; in contrast, a rate of only 34.1% was observed in the summer months [10]. While these data suggested that the seasonal influences acting on humans also affect laboratory mice, no mechanism to explain the observations was identified. Herein, we directly tested the hypotheses that ambient air temperature and RH impact the efficiency with which influenza virus is spread. As a mammalian animal model we used Hartley strain guinea pigs, which we have recently shown to be highly susceptible to infection with human influenza viruses [11]. Importantly, we also found that naïve guinea pigs readily become infected when exposed to inoculated guinea pigs, unlike mice, which do not efficiently transmit influenza virus [11]. Thus, by housing infected and naïve guinea pigs together in an environmental chamber, we were able to assess the efficiency of transmission under conditions of controlled RH and temperature. Our data show that both RH and temperature do indeed affect the frequency of influenza virus transmission among guinea pigs, although via apparently differing mechanisms. Results Twenty replicate experiments were performed in which all factors remained constant except for the RH and/or temperature inside the environmental chamber. Each experiment involved eight guinea pigs, and transmission under each set of conditions was assessed in duplicate. The arrangement of animals in the environmental chamber is illustrated in Figure 1. Virus contained in nasal wash samples collected on alternating days post-inoculation (p.i.) was titrated by plaque assay to determine the infection status of each animal. Serum samples were collected from each animal prior to infection and on day 17 p.i., and seroconversion was assessed by hemagglutination inhibition assay (results in Table S1). Figure 1 Arrangement of Infected and Exposed Guinea Pigs in Environmental Chamber In each experiment, eight animals were housed in a Caron 6030 environmental chamber. Each guinea pig was placed in its own cage, and two cages were positioned on each shelf. Naïve animals were placed behind infected animals, such that the direction of airflow was toward the naïve animals. The cages used were open to airflow through the top and one side, both of which were covered by wire mesh. Although infected and exposed guinea pigs were placed in pairs, air flowed freely between shelves, allowing transmission to occur from any infected to any naïve animal. In general, the behavior (level of activity, food and water consumption, symptoms of infection) of guinea pigs was not observed to change with the ambient relative humidity. Likewise, animals housed at 5 °C behaved in a similar manner to those housed at 20 °C. Guinea pigs kept at 30 °C consumed more water than those housed under cooler conditions, and appeared lethargic. Consistent with our previous observations [11], influenza virus–infected guinea pigs did not display detectable symptoms of disease (e.g., weight loss, fever, sneezing, coughing) during the experiments described. Transmission Efficiency Is Dependent on Relative Humidity The results of transmission experiments performed at 20 °C and five different RHs (20%, 35%, 50%, 65%, and 80%) indicated that the efficiency of aerosol spread of influenza virus varied with RH. Transmission was highly efficient (occurred to three or four of four exposed guinea pigs) at low RH values of 20% or 35%. At an intermediate RH of 50%, however, only one of four naïve animals contracted infection. Three of four exposed guinea pigs were infected at 65% RH, while no transmission was observed at a high RH of 80% (Figure 2). Where transmission was observed, the kinetics with which infection was detected in each exposed animal varied between and within experiments. To an extent, we believe this variation is due to the stochastic nature of infection. However, while most infection events were the product of primary transmission from an inoculated animal, others could be the result of secondary transmission from a previously infected, exposed guinea pig. With the exception of the lack of transmission at 80% RH, the observed relationship between transmission and RH is similar to that between influenza virus stability in an aerosol and RH [12], suggesting that at 20 °C the sensitivity of transmission to humidity is due largely to virus stability. Figure 2 Transmission of Influenza Virus from Guinea Pig to Guinea Pig Is Dependent on Relative Humidity Titers of influenza virus in nasal wash samples are plotted as a function of day p.i. Overall transmission rate and the RH and temperature conditions of each experiment are stated underneath the graph. Titers from intranasally inoculated guinea pigs are represented as dashed lines; titers from exposed guinea pigs are shown with solid lines. Virus titrations were performed by plaque assay on Madin Darby canine kidney cells. Transmission Efficiency Is Inversely Correlated with Temperature To test whether cold temperatures would increase transmission, the ambient temperature in the chamber was lowered to 5 °C and experiments were performed at 35%–80% RH. Overall, transmission was more efficient at 5 °C: 75%–100% transmission occurred at 35% and 50% RH, and 50% transmission was observed at 65% and 80% RH (Figure 3A–3H). The statistical significance of differences in transmission rates at 5 °C compared to 20 °C was assessed using the Fisher's exact test. While at 35% and 65% RH the difference was not found to be significant, at both 50% and 80% RH, transmissibility at 5 °C was found to be greater than that at 20 °C (p 20 °C) and either intermediate (50%) or high (80%) RHs. Materials and Methods Virus. Influenza A/Panama/2007/99 virus (Pan/99; H3N2) was kindly supplied by Adolfo García-Sastre and was propagated in Madin Darby canine kidney cells. Animals. Female Hartley strain guinea pigs weighing 300–350 g were obtained from Charles River Laboratories. Animals were allowed free access to food and water and kept on a 12-h light/dark cycle. Guinea pigs were anesthetized for the collection of blood and of nasal wash samples, using a mixture of ketamine (30 mg/kg) and xylazine (2 mg/kg), administered intramuscularly. All procedures were performed in accordance with the Institutional Animal Care and Used Committee guidelines. During guinea pig transmission experiments, strict measures were followed to prevent aberrant cross-contamination between cages: sentinel animals were handled before inoculated animals, gloves were changed between cages, and work surfaces were sanitized between guinea pigs. Transmission experiments. The term “aerosol” is used herein to describe respiratory droplets of all sizes. The term “droplet nuclei” is used to refer to droplets that remain airborne (typically less than 5 μm in diameter). Each transmission experiment involved eight guinea pigs. On day 0, four of the eight guinea pigs were inoculated intranasally with 103 PFU of influenza A/Panama/2007/99 virus (150 μl per nostril in phosphate buffered saline [PBS] supplemented with 0.3% bovine serum albumin [BSA]) and housed in a separate room from the remaining animals. At 24 h p.i., each of the eight guinea pigs was placed in a “transmission cage”, a standard rat cage (Ancare R20 series) with an open wire top, which has been modified by replacing one side panel with a wire grid. The transmission cages were then placed into the environmental chamber (Caron model 6030) with two cages per shelf, such that the wire grids opposed each other (Figure 1). In this arrangement, the guinea pigs cannot come into physical contact with each other. Each infected animal was paired on a shelf with a naïve animal. The guinea pigs were housed in this way for 7 d, after which they were removed from the chamber and separated. On day 2 p.i. (day 1 post-exposure) and every second day thereafter up to day 12 p.i., nasal wash samples were collected from anesthetized guinea pigs by instilling 1 ml of PBS-BSA into the nostrils and collecting the wash in a Petri dish. Titers in nasal wash samples were determined by plaque assay of 10-fold serial dilutions on Madin Darby canine kidney cells. Serum samples were collected from each animal prior to infection and on day 17 post-infection, and seroconversion was assessed by hemagglutination inhibition assay. All transmission experiments reported herein were performed between September 2006 and April 2007. Analysis of expression levels of mediators of innate immunity. Guinea pigs were inoculated with 103 PFU of Pan/99 virus intranasally and immediately housed under the appropriate conditions (5 °C or 20 °C and 35% RH). At days 1, 2, 3, 5, and 7 post-infection, three guinea pigs were killed and their nasal turbinates removed. Tissues were placed immediately in RNAlater reagent (Qiagen), and stored at 4 °C for 1 to 5 d. RNA was extracted from equivalent masses of tissue using the RNAeasy Protect Mini kit (Qiagen) and subjected to DNAse treatment (Qiagen). One microgram of RNA was subjected to reverse transcription using MMLV reverse transcriptase (Roche). One microlitre of the resultant product was used as the template in a SYBR green (Invitrogen) real-time PCR assay (Roche Light Cycler 480) with Ampli-taq Gold polymerase (Perkin-Elmer). Primers used were as follows: β-actin f AAACTGGAACGGTGAAGGTG; β-actin r CTTCCTCTGTGGAGGAGTGG; Mx1 f CATCCCYTTGrTCATCCAGT; Mx1 r CATCCCyTTGRTCATCCAGT; MDA-5 f GAGCCAGAGCTGATGARAGC; MDA-5 r TCTTATGWGCATACTCCTCTGG; IL-1β f GAAGAAGAGCCCATCGTCTG; IL-1β r CATGGGTCAGACAACACCAG; RANTES f GCAATGCTAGCAGCTTCTCC; RANTES r TTGCCTTGAAAGATGTGCTG; TLR3 f TAACCACGCACTCTGTTTGC; TLR3 r ACAGTATTGCGGGATCCAAG; TNFα f TTCCGGGCAGATCTACTTTG; TNFα r TGAACCAGGAGAAGGTGAGG; MCP-1 f ATTGCCAAACTGGACCAGAG; MCP-1 r CTACGGTTCTTGGGGTCTTG; MCP-3 f TCATTGCAGTCCTTCTGTGC; MCP-3 r TAGTCTCTGCACCCGAATCC; IFNγ f GACCTGAGCAAGACCCTGAG; IFNγ r TGGCTCAGAATGCAGAGATG; STAT1 f AAGGGGCCATCACATTCAC; STAT1 r GCTTCCTTTGGCCTGGAG; TBK1 f CAAGAAACTyTGCCwCAGAAA; TBK1 r AGGCCACCATCCAykGTTA; IRF5 f CAAACCCCGaGAGAAGAAG; IRF5 r CTGCTGGGACtGCCAGA; IRF7 f TGCAAGGTGTACTGGGAGGT; IRF7 r TCACCAGGATCAGGGTCTTC (where R = A or G, Y = C or T, W = A or T, K = T or G). Primer sequences were based either on guinea pig mRNA sequences available in GenBank (MCP1, MCP3, IL-1b, IFNγ, RANTES, TLR3, TNFα, and β-actin), or on the consensus sequence of all species available in GenBank (Mx1, MDA-5, IRF5, IRF7, STAT1, and TBK1). Sequencing of each PCR product indicated that all primer pairs were specific for the expected transcript. Reactions were performed in duplicate and normalized by dividing the mean value of the cycle threshold (Ct) of β-actin expressed as an exponent of 2 (2Ct) by the mean value of 2Ct for the target gene. The fold-induction over the mock-infected was then calculated by dividing the normalized value by the normalized mock value. Data is represented in Figure 5 as the mean of three like samples (nasal turbinates harvested on the same day p.i. from three guinea pigs) ± standard deviation. Statistical analyses. Statistical analyses were performed using GraphPad Prism 5 software. Supporting Information Table S1 Seroconversion of Inoculated and Exposed Guinea Pigs Results of hemagglutination inhibition tests for each transmission experiment are shown. (58 KB DOC) Click here for additional data file. Accession Numbers The GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html) accession numbers of guinea pig genes used for primer design are as follows: β-actin (AF508792.1); IFNγ (AY151287.1); IL-1β (AF119622); MCP-1 (L04985); MCP-3 (AB014340); RANTES (CPU77037); TLR3 (DQ415679.1); and TNFα (CPU77036).
              Bookmark
              • Record: found
              • Abstract: found
              • Article: not found

              How can airborne transmission of COVID-19 indoors be minimised?

              During the rapid rise in COVID-19 illnesses and deaths globally, and notwithstanding recommended precautions, questions are voiced about routes of transmission for this pandemic disease. Inhaling small airborne droplets is probable as a third route of infection, in addition to more widely recognized transmission via larger respiratory droplets and direct contact with infected people or contaminated surfaces. While uncertainties remain regarding the relative contributions of the different transmission pathways, we argue that existing evidence is sufficiently strong to warrant engineering controls targeting airborne transmission as part of an overall strategy to limit infection risk indoors. Appropriate building engineering controls include sufficient and effective ventilation, possibly enhanced by particle filtration and air disinfection, avoiding air recirculation and avoiding overcrowding. Often, such measures can be easily implemented and without much cost, but if only they are recognised as significant in contributing to infection control goals. We believe that the use of engineering controls in public buildings, including hospitals, shops, offices, schools, kindergartens, libraries, restaurants, cruise ships, elevators, conference rooms or public transport, in parallel with effective application of other controls (including isolation and quarantine, social distancing and hand hygiene), would be an additional important measure globally to reduce the likelihood of transmission and thereby protect healthcare workers, patients and the general public.
                Bookmark

                Author and article information

                Contributors
                Role: Data curationRole: Formal analysisRole: InvestigationRole: SoftwareRole: ValidationRole: VisualizationRole: Writing – original draft
                Role: Formal analysisRole: MethodologyRole: SoftwareRole: ValidationRole: VisualizationRole: Writing – review & editing
                Role: ConceptualizationRole: Formal analysisRole: MethodologyRole: ValidationRole: VisualizationRole: Writing – review & editing
                Role: Data curationRole: Formal analysisRole: InvestigationRole: ValidationRole: VisualizationRole: Writing – review & editing
                Role: ConceptualizationRole: Formal analysisRole: Funding acquisitionRole: MethodologyRole: Project administrationRole: ResourcesRole: SupervisionRole: ValidationRole: VisualizationRole: Writing – review & editing
                Role: Editor
                Journal
                PLoS One
                PLoS One
                plos
                PLOS ONE
                Public Library of Science (San Francisco, CA USA )
                1932-6203
                25 October 2023
                2023
                : 18
                : 10
                : e0290124
                Affiliations
                [1 ] Department of Civil Infrastructure & Environmental Engineering, College of Engineering, Khalifa University, United Arab Emirates
                [2 ] Department of Civil & Environmental Engineering, Faculty of Engineering & Architecture, American University of Beirut, Lebanon
                [3 ] Department of Experimental Pathology, Immunology & Microbiology, Faculty of Medicine, American University of Beirut, Lebanon
                Center for Disease control and Prevention, UNITED STATES
                Author notes

                Competing Interests: The authors have declared that no competing interests exist

                ‡ HZ and HA also contributed equally to this work.

                Author information
                https://orcid.org/0000-0003-3807-6409
                https://orcid.org/0000-0003-2379-9006
                Article
                PONE-D-23-10986
                10.1371/journal.pone.0290124
                10599543
                37878553
                6470741d-1aeb-40c8-b4f7-9e4c957b13f5
                © 2023 Hanna et al

                This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

                History
                : 13 April 2023
                : 1 August 2023
                Page count
                Figures: 5, Tables: 2, Pages: 20
                Funding
                The author(s) received no specific funding for this work
                Categories
                Research Article
                Biology and Life Sciences
                Physiology
                Physiological Processes
                Coughing
                Medicine and Health Sciences
                Clinical Medicine
                Signs and Symptoms
                Coughing
                Biology and life sciences
                Organisms
                Viruses
                RNA viruses
                Orthomyxoviruses
                Influenza Viruses
                Biology and Life Sciences
                Microbiology
                Medical Microbiology
                Microbial Pathogens
                Viral Pathogens
                Orthomyxoviruses
                Influenza Viruses
                Medicine and Health Sciences
                Pathology and Laboratory Medicine
                Pathogens
                Microbial Pathogens
                Viral Pathogens
                Orthomyxoviruses
                Influenza Viruses
                Biology and Life Sciences
                Organisms
                Viruses
                Viral Pathogens
                Orthomyxoviruses
                Influenza Viruses
                Biology and life sciences
                Organisms
                Viruses
                RNA viruses
                Orthomyxoviruses
                Influenza viruses
                Influenza A virus
                Biology and life sciences
                Microbiology
                Medical microbiology
                Microbial pathogens
                Viral pathogens
                Orthomyxoviruses
                Influenza viruses
                Influenza A virus
                Medicine and health sciences
                Pathology and laboratory medicine
                Pathogens
                Microbial pathogens
                Viral pathogens
                Orthomyxoviruses
                Influenza viruses
                Influenza A virus
                Biology and life sciences
                Organisms
                Viruses
                Viral pathogens
                Orthomyxoviruses
                Influenza viruses
                Influenza A virus
                Biology and Life Sciences
                Microbiology
                Virology
                Viral Transmission and Infection
                Viral Load
                Physical Sciences
                Materials Science
                Materials
                Mixtures
                Aerosols
                Biology and life sciences
                Organisms
                Viruses
                RNA viruses
                Paramyxoviruses
                Respiratory Syncytial Virus
                Biology and Life Sciences
                Microbiology
                Medical Microbiology
                Microbial Pathogens
                Viral Pathogens
                Paramyxoviruses
                Respiratory Syncytial Virus
                Medicine and Health Sciences
                Pathology and Laboratory Medicine
                Pathogens
                Microbial Pathogens
                Viral Pathogens
                Paramyxoviruses
                Respiratory Syncytial Virus
                Biology and Life Sciences
                Organisms
                Viruses
                Viral Pathogens
                Paramyxoviruses
                Respiratory Syncytial Virus
                Medicine and Health Sciences
                Medical Conditions
                Infectious Diseases
                Viral Diseases
                Influenza
                Earth Sciences
                Atmospheric Science
                Meteorology
                Humidity
                Custom metadata
                All relevant data are within the manuscript and its Supporting Information files.

                Uncategorized
                Uncategorized

                Comments

                Comment on this article