LCT‐22018G>A single nucleotide polymorphism is a better predictor of adult‐type hypolactasia/lactase persistence in Japanese‐Brazilians than LCT‐13910C>T

Abstract

INTRODUCTION Adult type hypolactasia, the genetically programmed down‐regulation of lactase enzyme activity in the intestinal wall after weaning, is a common condition worldwide, except for in northwestern Europe, where the prevalence is less than 10%. Lactose intolerant individuals complain of abdominal cramps, bloating, distention, flatulence and diarrhea after milk or lactose‐containing food ingestion.1 The diagnosis of adult‐type hypolactasia can be achieved by a hydrogen breath test that is cumbersome and provokes symptoms, or more recently, using a genetic approach.2 Lactase persistence and adult‐type hypolactasia have been associated with the LCT‐13910C>T and LCT ‐22018G>A polymorphisms in introns 13 and 9, respectively, of the minichromosome maintenance type 6 gene (MCM6) upstream of the LCT locus in several populations.3 In Brazil, the lactase persistence allele, LCT‐13910T, was found in approximately 43% of both white (European descent) and brown (European and African descent), and 20% of black (African descent) Brazilians, but was absent in all Japanese‐Brazilians studied.4 Recent epidemiological data regarding lactose intolerance/hypolactasia are lacking in Japan. This lack of information may be because of the relative rarity of symptoms; it has been shown that, although 92% of tested subjects were lactase deficient, only 2% were milk intolerant and 13% were lactose intolerant.5 Recent evidence in northern China suggests that LCT‐22018G>A, rather than LCT‐13910C>T, LCT‐13907C>G, LCT‐13915T>G, or LCT‐14010G>C, matched the lactase persistence phenotype.6 Therefore, the purpose of this study was to ascertain whether LCT‐22018G>A would also be a predictor of lactase persistence in Japanese‐Brazilians. MATERIALS AND METHODS This study was approved by the local Ethics Committee. The study population consisted of 56 Japanese‐Brazilians with the LCT‐13910CC genotype according to a previously described genotyping technique,4 with a mean age of 47.1 ± 17.6 years. Seventeen (30.4%) men gave written informed consent to participate. DNA was extracted from leukocytes. Primers 5′‐AACAGGCACGTGGAGGAGTT‐3′ (position 18261‐18280) and 5′‐CCCACCTCAGCCTCTTGAGT‐3′ (position 18708‐18689), Accession number AY220757, spanning the LCT‐22018 region, were used in a polymerase chain reaction (PCR) with Premium Taq DNA polymerase (Invitrogen, São Paulo, Brazil) and 2.5 mM MgCl2. Amplification was performed in 38 cycles at 95°C for 1 min, 67°C for 1 min, and 72°C for 1 min. The PCR product was digested with HhaI, resulting in one fragment of 448 bp (the AA genotype), two fragments of 264 and 184 bp (the GG genotype) and three fragments of 448, 264, and 184 bp (the GA genotype), which were visualized on a 2% agarose gel stained with ethidium bromide, as has been previously described by Büning et al.7 RESULTS AND DISCUSSION Among the 56 Japanese‐Brazilians who were previously genotyped as LCT‐13910CC (hypolactasia),4 3 (5.4%) had the LCT‐22018GA genotype associated with lactase persistence (Fig. 1), and 53 (94.6%) had the LCT‐22018GG genotype associated with hypolactasia (Table 1). The incidence of lactase deficiency gradually increases with age from 3 years, and approximately 90% of all normal Japanese adults are lactase‐deficient.8 Among Japanese‐Brazilians, 100% had lactose malabsorption;9 therefore, these values are in accordance with lactose malabsorption in Japanese people who have been diagnosed by the hydrogen breath test. In Brazilians, both the LCT‐13910C>T allele2 and the LCT‐22018G>A allele10 have been associated with lactase persistence phenotypes. As such, genetic analysis for Japanese‐Brazilians should include an assessment for the LCT‐22018G>A allele, as the LCT‐13910C>T polymorphism is already routinely performed for hypolactasia/lactase persistence diagnosis.2 CONCLUSION The LCT‐22018G>A allele is a better predictor of lactase persistence in Japanese‐Brazilians than the LCT‐13910C>T allele.