Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation

There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

Abstract

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.

Related collections

Most cited references 41

Record: found
Abstract: found
Article: not found

Version 1.2 of the Crystallography and NMR system.

Axel T. Brunger (2007)

Version 1.2 of the software system, termed Crystallography and NMR system (CNS), for crystallographic and NMR structure determination has been released. Since its first release, the goals of CNS have been (i) to create a flexible computational framework for exploration of new approaches to structure determination, (ii) to provide tools for structure solution of difficult or large structures, (iii) to develop models for analyzing structural and dynamical properties of macromolecules and (iv) to integrate all sources of information into all stages of the structure determination process. Version 1.2 includes an improved model for the treatment of disordered solvent for crystallographic refinement that employs a combined grid search and least-squares optimization of the bulk solvent model parameters. The method is more robust than previous implementations, especially at lower resolution, generally resulting in lower R values. Other advances include the ability to apply thermal factor sharpening to electron density maps. Consistent with the modular design of CNS, these additions and changes were implemented in the high-level computing language of CNS.

0 comments Cited 414 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: not found

DNA and its associated processes as targets for cancer therapy.

Laurence H. Hurley (2002)

DNA is the molecular target for many of the drugs that are used in cancer therapeutics, and is viewed as a non-specific target of cytotoxic agents. Although this is true for traditional chemotherapeutics, other agents that were discovered more recently have shown enhanced efficacy. Furthermore, a new generation of agents that target DNA-associated processes are anticipated to be far more specific and effective. How have these agents evolved, and what are their molecular targets?

0 comments Cited 220 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: found

Is Open Access

Gene function correlates with potential for G4 DNA formation in the human genome

Johanna Eddy, Nancy Maizels (2006)

G-rich genomic regions can form G4 DNA upon transcription or replication. We have quantified the potential for G4 DNA formation (G4P) of the 16 654 genes in the human RefSeq database, and then correlated gene function with G4P. We have found that very low and very high G4P correlates with specific functional classes of genes. Notably, tumor suppressor genes have very low G4P and proto-oncogenes have very high G4P. G4P of these genes is evenly distributed between exons and introns, and it does not reflect enrichment for CpG islands or local chromosomal environment. These results show that genomic structure undergoes selection based on gene function. Selection based on G4P could promote genomic stability (or instability) of specific classes of genes; or reflect mechanisms for global regulation of gene expression.

0 comments Cited 186 times – based on 0 reviews      Review now

Bookmark

All references

Author and article information

Contributors

Xiaojie Cui: xiaojiecui@muc.edu.cn

Jiang Zhou:

ORCID: http://orcid.org/0000-0002-2982-2601

zhoujiang@pku.edu.cn

Journal

Journal ID (nlm-ta): Sci Rep

Journal ID (iso-abbrev): Sci Rep

Title: Scientific Reports

Publisher: Nature Publishing Group UK (London )

ISSN (Electronic): 2045-2322

Publication date (Electronic): 8 March 2019

Publication date PMC-release: 8 March 2019

Publication date Collection: 2019

Volume: 9

Electronic Location Identifier: 3966

Affiliations

[1 ]ISNI 0000 0001 2256 9319, GRID grid.11135.37, Beijing National Laboratory for Molecular Sciences, Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Department of Chemical Biology, College of Chemistry and Molecular Engineering, , Peking University, ; Beijing, 100871 China

[2 ]ISNI 0000 0004 0369 0529, GRID grid.411077.4, College of Life and Environmental Sciences, , Minzu University of China, ; Beijing, 100081 China

[3 ]ISNI 0000 0004 0605 3760, GRID grid.411642.4, Department of Cardiology, Institute of Vascular Medicine, Department of Cardiology, , Peking University Third Hospital, ; Beijing, 100191 China

Author information

Jiang Zhou http://orcid.org/0000-0002-2982-2601

Article

Publisher ID: 39941

DOI: 10.1038/s41598-019-39941-5

PMC ID: 6408435

PubMed ID: 30850693

SO-VID: 904c4891-0327-431a-b5f7-27cd45613563

License:

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

History

Date received : 5 October 2018

Date accepted : 23 January 2019

Funding

Funded by: FundRef https://doi.org/10.13039/501100001809, National Natural Science Foundation of China (National Science Foundation of China);

Award ID: 91339105

Award ID: 81625001

Award ID: 91339105

Award Recipient : Xiaojie Cui Ming Xu Jiang Zhou

Funded by: FundRef https://doi.org/10.13039/501100002855, Ministry of Science and Technology of the People's Republic of China (Chinese Ministry of Science and Technology);

Award ID: 2012CB720601

Award ID: 2012CB720600

Award ID: 2012CB720601

Award Recipient : Xiaojie Cui Han Chen Qiang Zhang Gu Yuan Jiang Zhou

Custom metadata

ScienceOpen disciplines: Uncategorized

Data availability:

ScienceOpen disciplines: Uncategorized

Comments

Comment on this article

scite_

Cited by 6

See all cited by

Most referenced authors 2,023

See all reference authors

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation

Read this article at

Abstract

Related collections

HLA-G and immune tolerance in pregnancy

Most cited references 41

Version 1.2 of the Crystallography and NMR system.

DNA and its associated processes as targets for cancer therapy.

Gene function correlates with potential for G4 DNA formation in the human genome

Author and article information

Contributors

Journal

Affiliations

Author information

Article

History

Funding

Categories

Custom metadata

Comments

Comment on this article

Similar content 443

Cited by 6

Most referenced authors 2,023