- Record: found
- Abstract: found
- Article: not found
Prevalence and Genomic Structure of Bacteriophage phi3 in Human-Derived Livestock-Associated Methicillin-Resistant Staphylococcus aureus Isolates from 2000 to 2015
Publication date Created:
September 2018
Publication date (Electronic):
August 27 2018
Journal:
Journal of Clinical Microbiology
Publisher:
American Society for Microbiology
Read this article at
There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.
ABSTRACT
Whereas the emergence of livestock-associated methicillin-resistant Staphylococcus aureus (LA-MRSA) clonal complex 398 (CC398) in animal husbandry and its transmission to humans are well documented, less is known about factors driving the epidemic spread of this zoonotic lineage within the human population. One factor could be the bacteriophage phi3, which is rarely detected in S. aureus isolates from animals but commonly found among isolates from humans, including those of the human-adapted methicillin-susceptible S. aureus (MSSA) CC398 clade. The proportion of phi3-carrying MRSA spa-CC011 isolates, which constitute presumptively LA-MRSA within the multilocus sequence type (MLST) clonal complex 398, was systematically assessed for a period of 16 years to investigate the role of phi3 in the adaptation process of LA-MRSA to the human host. For this purpose, 632 MRSA spa-CC011 isolates from patients of a university hospital located in a pig farming-dense area in Germany were analyzed. Livestock-associated acquisition of MRSA spa-CC011 was previously reported as having increased from 1.8% in 2000 to 29.4% in 2014 in MRSA-positive patients admitted to this hospital. However, in this study, the proportion of phi3-carrying isolates rose only from 1.1% (2000 to 2006) to 3.9% (2007 to 2015). Characterization of the phi3 genomes revealed 12 different phage types ranging in size from 40,712 kb up to 44,003 kb, with four hitherto unknown integration sites (genes or intergenic regions) and several modified bacterial attachment ( attB) sites. In contrast to the MSSA CC398 clade, phi3 acquisition seems to be no major driver for the readaptation of MRSA spa-CC011 to the human host.
Related collections
Most cited references46
- Record: found
- Abstract: found
- Article: found
Staphylococcus aureus CC398: Host Adaptation and Emergence of Methicillin Resistance in Livestock
Lance Price, Marc Stegger, Henrik Hasman … (2012)
Introduction Methicillin-resistant Staphylococcus aureus (MRSA) has been described in animals since 1972 (1), but a new lineage, clonal complex 398 (CC398), has emerged among livestock and begun colonizing and infecting humans. Human MRSA infections have been categorized into three groups based on their putative sources: health care-associated MRSA, community-associated MRSA, and health care-associated MRSA with community onset. A fourth category has recently been added to describe human MRSA cases associated with exposure to livestock (livestock-associated MRSA [LA-MRSA]). Human colonization with LA-MRSA multilocus sequence type 398 (ST398) was first recognized among swine farmers in France and The Netherlands in the early 2000s (2, 3). Since those early reports, ST398 and closely related STs within CC398 have been reported in diverse livestock hosts in many countries around the world (4–8). Human cases of MRSA CC398 have also been increasing rapidly and now account for up to 25% of the total MRSA cases in some parts of The Netherlands (9). Given its rapid emergence and trajectory of increasing importance in humans, the evolutionary history of MRSA CC398 has relevance for the epidemiology of MRSA and global health. Methicillin-susceptible S. aureus (MSSA) CC398 is prevalent among pigs in Europe (10), but the evolution and global dispersal of this group have yet to be clarified. A microarray-based study revealed that the core genomes of 6 CC398 isolates were distinct from those of more than 2,000 S. aureus isolates from humans (11), and it has been generally presumed that pigs or other animals are the natural hosts of CC398. Attempts to better characterize the evolution and epidemiology of CC398 have been hampered by the limited resolution of conventional S. aureus typing methods, including multilocus sequence typing (MLST) and spa sequence typing. While MLST defines CC398 and is useful for placing CC398 in the context of other S. aureus clonal complexes, it is of no use for characterizing variation within the group. spa typing has revealed geographic clustering among CC398 isolates in Europe (12, 13); however, the limited number of common spa types among CC398 isolates and the potential for homoplasy in the spa gene data restrict its phylogenetic utility (14). Whole-genome sequencing provides a superior genetic fingerprint, which can be used for source tracking and evolutionary studies. Thus far, whole-genome sequencing has been used to study the hospital transmission and spatiotemporal spread of ST239 (15). In this study, we applied whole-genome sequence typing (WGST) to a diverse collection of 89 CC398 isolates to study the origins and evolution of S. aureus CC398. RESULTS We sequenced the genomes of 88 S. aureus CC398 isolates (see Data set S1 in the supplemental material). Among the isolates, we sequenced an average of 2,651,848 bases (standard deviation [SD] = 80,311) at ≥10× coverage. Genomes were sequenced at an average depth of 104.36× (SD = 35.7, using the 2,872,582-base SO385 chromosome as a reference). Rooting the CC398 tree using ST36 as the outgroup revealed that a cluster of four isolates, characterized by the t899 spa type, was the first lineage to diverge from the other CC398 isolates (see Fig. S1 in the supplemental material). Much of the similarity between the t899 cluster and the ST36 isolate was mapped to the same ~123,000-bp region surrounding the spa gene. However, this region was incongruent with the phylogenetic signal generated by the rest of the chromosome in the t899 isolates. Comparative genomic analysis with other STs suggested that this region was acquired horizontally from an ST9 donor (see Fig. S2 in the supplemental material). When single nucleotide polymorphisms (SNPs) from this region were excluded from the phylogenetic analysis, the t899 lineage clustered with a more derived clade of European isolates and a clade of human-associated MSSA isolates from France, French Guiana, and the United States was identified as the first divergent CC398 lineage (see Fig. S3 in the supplemental material). This lineage was used to root the final CC398 WGST tree (Fig. 1). With the ST36 genome removed and excluding the SNPs from the 123,000-bp putative horizontally transferred region, we identified 4,238 SNPs, including 1,102 parsimony-informative SNPs with a consistency index (CI) of 0.9591. Among the SNPs, 3,552 were from coding regions (1,071 synonymous and 2,481 nonsynonymous). FIG 1 Maximum-parsimony tree of the 89 CC398 isolates (including ST398SO385) based on 4,238 total SNPs, including 1,102 parsimony-informative SNPs with a CI of 0.9591. Clades and groups of importance are labeled in a hierarchical fashion to facilitate description in the text. The tree was rooted with clade I based on an iterative selection process that identified this group as the most ancestral (see Materials and Methods). COO, country of origin; AT, Austria; BE, Belgium; CA, Canada; CH, Switzerland; CN, China; DE, Germany; DK, Denmark; ES, Spain; FI, Finland; FR, France; GF, French Guiana; HU, Hungary; IT, Italy; NL, The Netherlands; PE, Peru; PL, Poland; PT, Portugal; SI, Slovenia; US, United States; P, pig; H, human; R, horse; T, turkey; B, bovine; MET, methicillin susceptibility; R, resistant; S, susceptible. The phylogenetic tree presented in Fig. 1 is a highly accurate depiction of the evolutionary relationships among the 89 CC398 strains included in this study (including the reference). The lack of homoplasy among informative SNPs (CI = 0.9591) obviated the need for additional measures of robustness such as bootstrapping (16). The most ancestral lineage (clade I) was composed entirely of MSSA strains from humans in North America, South America, and Europe. In addition, with the exception of one isolate (P23-14_SD4.1), the strains that accounted for the most ancestral lineages within clade II (II group of interest [II-GOI]) were human-associated S. aureus from China (including two MRSA strains isolated from Danish adoptees from China). All but one of the livestock-associated strains belonged to clade IIa, which was derived from the human-associated lineages. Clade IIa was composed of several lineages whose evolutionary relationships could not be determined due to poor hierarchical resolution. The lack of resolution was likely due to a rapid radiation following introduction into livestock, as homoplasy was exceedingly rare among the parsimony-informative SNPs. The isolates within clades IIa1 and IIa2 consisted almost entirely of European isolates, while the 10 remaining lineages consisted almost entirely of North American isolates. The IIa1i lineage was dominated by Danish isolates, one-third of which were MSSA, while the IIa1ii lineage consisted largely of MRSA isolates from several European countries, except Denmark. Interestingly, 6 of the 10 smaller lineages included MSSA strains isolated from turkey meat from the United States (IIa-GOI). In this report, we use the term “human associated” for isolates belonging to clade I and clade II-GOI (n = 19) and use the term “livestock associated” for isolates belonging to subclade IIa (n = 70). Fifteen different spa types were identified among the 89 CC398 isolates, including t011, t034, t108, t567, t571, t899, t1250, t1451, t1793, t2876, t3085, t3625, t5462, t5463, and t5719 (Fig. 1). The two most common spa types, t011 and t034, represented 67% of the isolates. While some spa types were more common within individual clusters (e.g., t571 was disproportionately common among human-associated isolates), spa types were inconsistent with the overall CC398 phylogeny (Fig. 1). Sixty-one percent (30/49) of the CC398 MRSA isolates harbored staphylococcal cassette chromosome mec element (SCCmec) subtype Vc (5C2&5) containing the cadmium-zinc resistance gene czrC. All of the SCCmec Vc (5C2&5) cassettes were present in LA-MRSA strains. Of note, the czrC gene was also found in two livestock-associated MSSA isolates. The remaining LA-MRSA isolates carried SCCmec (sub)types IVa (2B), IVa (2B&5), IVc (2B), Vb (5C2&5), V*, and V**; a novel VII-like SCCmec cassette; and a nontypeable (NT) SCCmec cassette. The mecA gene was detected in only two human-associated isolates; in both cases, the mecA gene was coded within SCCmec subtype Vb (5C2&5). The type V* and V** SCCmec cassettes contained structurally different J1 regions that did not match the J1 regions associated with subtypes a to c. The type VII-like SCCmec cassette contained ccr type 5 (ccrC) and a class C1-like mec gene complex element previously identified in SCCmec type X (7C1-like) (17). Accordingly, this novel SCCmec type was referred to as VII-like (5C1-like) to distinguish it from archetypal SCCmec type VII (5C1). The NT cassette contained a class C1-like mec gene complex without any previously described ccr gene complex. The tetracycline resistance gene tet(M) was present in 99% (69/70) of the livestock-associated isolates but absent from the human-associated isolates (Fig. 1; see Data set S1 in the supplemental material). The prophage integrase gene Sa3int was detected in 29 CC398 isolates. Phylogenetic analysis of the Sa3int sequences showed that they belong to three separate clusters; one clade was typical of φSa3 prophages, one was typical of φAvβ prophages, and the third was suggestive of a novel φSa3 integrase variant (see Fig. S4 in the supplemental material). φSa3 prophages in association with one or more human innate immunomodulatory genes were detected in 95% (18/19) of the human-associated S. aureus isolates (Fig. 1; see Data set 1 in the supplemental material). All 18 positive isolates were from human samples, whereas the single isolate lacking φSa3 prophages originated from a pig farm. All 10 isolates belonging to clade I carried chp and scn (type C φSa3 prophages), whereas 6 of 8 isolates belonging to clade II-GOI carried sak, chp, and scn (type B φSa3 prophages) and 2 isolates carried scn only (an IEC type not previously described). In comparison, only 1 of 70 isolates belonging to clade II harbored a φSa3 prophage in association with sak, chp, and scn (type B). Interestingly, 10 livestock-associated isolates belonging to IIa-GOI were largely from turkey meat samples and carried a φAvβ prophage along with the associated genes SAAV_2008 and SAAV_2009 but lacked human innate immunomodulatory genes carried by φSa3 prophages. Sa2int and the lukF-lukS genes carried by φSa2 prophages were present in 6 of 19 human-associated isolates. Conversely, all livestock-associated S. aureus isolates lacked the lukF-lukS genes. DISCUSSION Since its discovery, MRSA CC398 has been perceived as a livestock-associated pathogen; however, the WGST-based phylogeny presented here strongly suggests that the CC398 lineage originated in humans as MSSA and then spread to livestock, where it subsequently acquired the SCCmec cassette and methicillin resistance. The isolates that formed the most basal clades (I and II-GOI) on the WGST-based phylogenetic trees were almost all human-associated MSSA strains, suggesting that these isolates were the most ancestral of those tested in this study (Fig. 1). Likewise, the clade structure observed in the livestock-dominated IIa clade supports a rapid radiation as CC398 moved from humans to animals (see Fig. S5 in the supplemental material). Thus, livestock-associated CC398 infections in humans may be seen as a reintroduction to the original host. Epidemiological data suggest that livestock-associated CC398 strains have lower transfer rates, and may be less virulent, in humans than other well-known STs (18). In this study, we showed that the lukF-lukS genes encoding Panton-Valentine leukocidin (PVL) were present in only 6 of the 89 genomes, all of which were human associated (see Data set S1 in the supplemental material). Strikingly, we found that all of the human-associated MSSA strains from clade I and clade II-GOI carried φSa3 in association with human innate immunomodulatory genes, whereas φSa3 was identified in only one livestock-associated isolate (see Fig. S6 in the supplemental material). Instead, a φAvβ prophage and the associated genes SAAV_2008 and SAAV_2009 were identified among a group of mainly turkey meat isolates in the livestock-associated clade IIa-GOI. It therefore appears that φSa3 was lost prior to (or early in) the formation of clade II, while φAvβ was introduced into avian MSSA CC398 isolates thereafter (Fig. 1). The human innate immunomodulatory genes carried by φSa3 prophages play crucial roles in human niche adaptation (19, 20), whereas the φAvβ-carried SAAV_2008 and SAAV_2009 genes (encoding a putative ornithine cyclodeaminase and a putative membrane protease of the CAAX family, respectively) belong to the avian-niche-specific accessory gene pool for broiler chicken-associated S. aureus ST5 (21). The loss of human-niche-specific genes in livestock-associated isolates, including those from turkeys, may be a result of adaptation to nonhuman hosts. A similar natural history has been reconstructed for broiler chicken-associated S. aureus ST5, which appears to have been introduced from humans into the chicken-breeding system, transmitted vertically, and disseminated worldwide (21). The ST5 jump from humans to chickens also appears to have been followed by the acquisition of avian-niche-specific genes (including the SAAV_2008 and SAAV_2009 genes carried by φAvβ prophages) and partial loss of human-niche-specific genes (including human innate immunomodulatory genes carried by φSa3 prophages) (21). The data presented here strongly suggest that CC398 acquired resistance to methicillin and tetracycline after the introduction to livestock from humans (see Fig. S7a and b in the supplemental material). The tetracycline resistance gene tet(M) was nearly universal among livestock-associated CC398 MRSA and MSSA isolates and completely missing from human-associated strains. Consequently, tetracycline use in food animal production is likely to select for livestock-associated S. aureus CC398 without differentially selecting for MRSA strains. MRSA can be selected for by a number of broad-spectrum cephalosporins that are used in food animal production in the United States and Europe. Likewise, zinc and other metals are frequently used in animal feed formulations and may coselect for MRSA CC398 strains that carry the czrC zinc resistance gene, as suggested previously (22). This hypothesis is supported by our findings that the vast majority of LA-MRSA strains carry SCCmec type Vc (5C2&5), which contains the czrC gene. This study demonstrates the potential power of WGST for epidemiological investigations. For example, two of the Danish MRSA isolates came from infants adopted from China. Both isolates were spa type t034, which is consistent with the majority of Danish CC398 isolates from pigs and humans; however, WGST showed that the isolates shared a recent common ancestor with a French isolate and that this clade was derived from other clades within II-GOI that were strictly Chinese in origin (Fig. 1, II-GOI). Although the French isolate obscures these results, they are most consistent with a Chinese rather than Danish origin of the isolates. WGST revealed thousands of SNPs among the 89 CC398 strains. These mutations may provide robust phylogenetic signals for future epidemiological and epizootological investigations involving CC398 strains. spa typing is routinely used for S. aureus epidemiology; however, in this study, homoplasy within the spa gene led to inconsistencies between the WGST CC398 phylogeny and spa types. Some spa types, such as t571 and t034, were observed in distant clades of the highly accurate WGST phylogenetic tree (Fig. 1). The t899 isolates exemplified the limitations of any single-locus typing method, as the spa gene was part of a ~123,000-bp region of DNA acquired from a distantly related S. aureus clone. A similar observation was made previously with S. aureus ST239, which originated as a hybrid between ST8-like and ST30-like chromosomes (23). Here, reliance on spa typing would have incorrectly placed these isolates outside of CC398. Interestingly, the large horizontally acquired region observed among the t899 CC398 strains also carries the SCCmec cassette, thus possibly presenting an alternative mechanism for SCCmec dissemination among S. aureus strains. In this study, we provide strong evidence that CC398 originated in humans as MSSA and then spread to livestock, where it acquired resistance to methicillin and tetracycline. Genomic analyses presented here, in conjunction with previous epidemiological data, suggest that the jump from humans to animals was followed by a decreased capacity for human colonization, transmission, and virulence, yet livestock-associated CC398 has been linked to an increase in MRSA infections in northern Europe. Further research is required to characterize the full scope of the genetic changes associated with the shift from humans to livestock. Likewise, additional research and surveillance are required to predict the public health impact of MRSA CC398 in the future. MATERIALS AND METHODS Bacterial isolates. This study included MRSA (n = 48) and MSSA (n = 40) CC398 isolates from 19 countries on four continents with strains from humans (n = 25) and livestock (n = 63, including strains from live animals, meat samples, and environmental contamination) (see Data set S1 in the supplemental material). A previously sequenced ST398 strain, SO385, from The Netherlands was used as the reference and included in all analyses (24). MLST. MLST was performed as described previously (http://saureus.mlst.net/misc/info.asp) (25). STs were assigned through the MLST database (http://www.mlst.net). The eBURST algorithm v3 was used to assign individual STs to specific CCs (http://eburst.mlst.net). spa typing. Amplification of the spa repeat region was performed using primers spa 1113f (5′ AAAGACGATCCTTCGGTGAGC 3′) and spa 1514r (5′ CAGCAGTAGTGCCGTTTGCTT 3′) and the conditions described previously (http://www.SeqNet.org). The spa types were determined based on the sequencing results using the spa plug-in included in the BioNumerics v4.6 software (Applied Math, Sint-Martens-Latem, Belgium). Genome sequencing. DNA samples were prepared for multiplexed, paired-end sequencing on an Illumina Genome Analyzer IIx (Illumina, Inc., San Diego, CA). For each isolate, 1 to 5 µg DNA in 200 µl was sheared in a 96-well plate with the SonicMAN (part no. SCM1000-3; Matrical BioScience, Spokane, WA) to a size range of 200 to 1,000 bp, with the majority of material at ca. 600 bp, using the following parameters: prechill, 0°C for 75 s; cycles, 20; sonication, 10 s; power, 100%; lid chill, 0°C for 75 s; plate chill, 0°C for 10 s; postchill, 0°C for 75 s. The sheared DNA was purified using the QIAquick PCR Purification kit (catalog no. 28106; Qiagen, Valencia, CA). The enzymatic processing (end repair, phosphorylation, A tailing, and adaptor ligation) of the DNA followed the guidelines described in the Illumina protocol (Preparing Samples for Multiplexed Paired-End Sequencing, catalog no. PE-930-1002, part no.1005361). The enzymes for processing were obtained from New England Biolabs (catalog no. E6000L; New England BioLabs, Ipswich, MA), and the oligonucleotides and adaptors were obtained from Illumina (catalog no. PE-400-1001). After ligation of the adaptors, the DNA was run on a 2% agarose gel for 2 h, after which a gel slice containing 500- to 600-bp fragments of each DNA sample was isolated and purified using the QIAquick Gel Extraction kit (catalog no. 28706; Qiagen, Valencia, CA). Individual libraries were quantified by quantitative PCR on an ABI 7900HT (part no. 4329001; Life Technologies Corporation, Carlsbad, CA) in triplicate at two concentrations, 1:1,000 and 1:2,000, using the Kapa Library Quantification kit (part no. KK4832 or KK4835; Kapa Biosystems, Woburn, MA). Based on the individual library concentrations, equimolar pools of no more than 12 indexed S. aureus libraries were prepared at a concentration of at least 1 nM using 10 mM Tris-HCl (pH 8.0)-0.05% Tween 20 as the diluent. To ensure accurate loading onto the flow cell, the same quantification method was used to quantify the final pools. The pooled paired-end libraries were sequenced on an Illumina Genome Analyzer IIx to a read length of at least 76 bp. Identification of SNPs. Illumina WGS data sets were aligned against the chromosome of the published ST398 reference genome (strain SO385; GenBank accession no. AM990992) (24) using the short-read alignment component of the Burrows-Wheeler Aligner. Each alignment was analyzed for SNPs using SolSNP (http://sourceforge.net/projects/solsnp/). In order to avoid false calls due to sequencing errors, SNP loci were excluded if they did not meet a minimum coverage of 10× and if the variant was present in less than 90% of the base calls for that position. SNP calls were combined for all of the sequenced genomes such that for the locus to be included in the final SNP matrix, it had to be present in all of the genomes. SNPs falling in the duplicated regions on the reference genome were discarded. Phylogenetic analysis. Phylogenetic trees were generated using the maximum-parsimony method in PAUP v4.0b10. For maximum-parsimony bootstrapping analysis, the analysis was constrained to build a maximum of 1,000 trees (100 replicates, 10 trees each). The root of the tree was determined through an iterative process as follows. A distance matrix and phylogenetic tree was generated comparing the chromosomes of ST398 (GenBank accession no. AM990992), ST36 (GenBank accession no. BX571856), ST8 (GenBank accession no. CP000255), ST1 (GenBank accession no. BA000033), and ST5 (GenBank accession no. BA000018). Through this process, ST36 was determined to be the most closely related non-CC398 STs. ST36 was used as an outgroup to root the CC398 WGST tree and identify the most ancient CC398 bifurcation point. CC398 descendants nearest to this bifurcation point were used to root subsequent trees. SCCmec typing. The presence of mecA and SCCmec types and subtypes was assessed in all 89 S. aureus CC398 isolates. The structural features unique to each of the type 1 to 5 ccr gene complexes; class A, B, and C2 mec gene complexes; and four J1 subtypes (a to d) of type IV SCCmec were determined by a PCR-based multiplex assay described by Kondo et al. (26). Structural features unique to the class C1 and C1-like mec gene complexes (17, 27) and the three subtypes of type V SCCmec (17) were determined by aligning the Illumina WGS data sets against reference sequences using CLC Genomics Workbench v4.7.2 (CLC bio, Aarhus, Denmark). The following reference sequences were used: mec class C1 (GenBank accession no. AB373032); mec class C1-like (GenBank accession no. AB505630); and SCCmec subtypes Va (5C2) (GenBank accession no. AB121219), Vb (5C2&5) (GenBank accession no. AB462393), and Vc (5C2&5) (GenBank accession no. AB505629). SCCmec nomenclature was applied as proposed by the International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements (28). For brevity, the type is indicated by roman numerals and the subtype is identified by a lowercase latin letter. The combination of ccr and mec gene complexes is indicated by an arabic number and a latin letter, respectively, in parentheses. When a composite of two SCC elements carrying distinct ccr gene complexes is identified, this is indicated by an ampersand and an arabic numeral designating the ccr type. Detection of genes associated with antimicrobial resistance and host adaptation. All 89 genomes were analyzed for the presence of the tetracycline resistance gene tet(M), the cadmium-zinc resistance gene czrC, the φSa3 and φSa2 prophages (identified by Sa3int and Sa2int integrase genes), five genes carried by φSa3 prophages (sea, sep, sak, chp, and scn), two putative avian-niche-specific genes carried by φAvβ (a φSa3-like prophage) (SAAV_2008 and SAAV_2009), and two PVL genes carried by φSa2 prophages (lukF-PV and lukS-PV). Local BLASTN searches were performed on de novo contigs assembled from the Illumina WGS data sets, as well as a reference assembly, using CLC Genomics Workbench v4.7.2. The presence or absence of genes was determined using thresholds of 90% nucleotide identity, 90% coverage of the query sequence length, and a sequence depth of >10×. The query sequences used were tet(M) and czrC (GenBank accession no. AM990992); Sa3int, sea, sak, chp, and scn (GenBank accession no. NC_009641); sep (GenBank accession no. BA000018); SAAV_2008 and SAAV_2009 (GenBank accession no. CP001781); and Sa2int, lukF-PV, and lukS-PV (GenBank accession no. AB006796). All de novo contigs with BLASTN matches to Sa3int were selected, and the Sa3int genes were retrieved for phylogenetic reconstruction using Sa3int (GenBank accession no. NC_009641) and Avβint (GenBank accession no. CP001781) as reference sequences. Gene sequences were aligned using ClustalW v 2.0 (29), and the trees were generated using the maximum-parsimony method in PAUP v4.0b10. The φSa3 prophages received letter designations to reflect unique combinations of the five prophage-carried genes that modulate human innate immune responses (sea, sep, sak, chp, and scn) as described elsewhere (30). SUPPLEMENTAL MATERIAL Data set S1 Isolates included in this study. Download Data set S1, XLSX file, 0.1 MB. Data set S1, XLSX file, 0.1 MB Figure S1 Maximum-parsimony tree based on 27,475 SNPs from 89 isolates (including ST398SO385) rooted with an ST36 isolate (USA200-MRSA252) as the outgroup. The CI for the parsimony-informative SNPs was 0.8969. The t899 group (12152-5, UB08116, 30116, and 44523-1) was identified as the most ancestral and is highlighted in gray. Download Figure S1, PDF file, 0.3 MB. Figure S1, PDF file, 0.3 MB Figure S2 Graphic representation of the region flanking the spa gene of S. aureus ST398 strain SO385 (t011; MRSA), ST398 strain 12152-5 (t899; MRSA), and ST9 strain 2007-70-94-4 (t1334; MSSA). Light gray indicates areas with high homology to ST398 sequences, and dark gray indicates areas with high homology to ST9. The location of the spa gene is indicated in black. Approximate insertion nucleotides are reported based on the SO385 reference genome. Download Figure S2, PDF file, 0.7 MB. Figure S2, PDF file, 0.7 MB Figure S3 Maximum-parsimony tree based on 26,324 SNPS from 89 isolates (including ST398SO385) rooted with ST36 (USA200-MRSA252) as the outgroup. The SNPs from the horizontally transferred region surrounding the spa gene were excluded (region in reference ST398SO385, 12252 to 135180). The CI for the parsimony-informative SNPs was 0.9089. The most ancestral isolates within the CC398 lineage are highlighted in gray. Download Figure S3, PDF file, 0.3 MB. Figure S3, PDF file, 0.3 MB Figure S4 Phage tree. Shown is a maximum-parsimony tree of the Sa3int genes from 30 ST398 isolates, Sa3int (GenBank accession no. NC_009641), and Avβint (GenBank accession no. CP001781). Download Figure S4, PDF file, 0.7 MB. Figure S4, PDF file, 0.7 MB Figure S5 Cladograms colored to show host species. Download Figure S5, PDF file, 0.2 MB. Figure S5, PDF file, 0.2 MB Figure S6 Cladogram colored to show φSa3-positive isolates. Download Figure S6, PDF file, 0.2 MB. Figure S6, PDF file, 0.2 MB Figure S7a Cladogram colored to show SCCmec types. Download Figure S7a, PDF file, 0.2 MB. Figure S7a, PDF file, 0.2 MB Figure S7b Cladogram colored to show tet(M)-positive isolates. Download Figure S7b, PDF file, 0.2 MB. Figure S7b, PDF file, 0.2 MB
- Record: found
- Abstract: found
- Article: found
Emergence of Methicillin-Resistant Staphylococcus aureus of Animal Origin in Humans
Inge van Loo, Xander W. Huijsdens, Edine Tiemersma … (2007)
Methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been considered a nosocomial pathogen. However, for several years the number of reports of so-called community-onset MRSA (CO-MRSA) has been rapidly increasing ( 1 ). CO-MRSA has no relation to healthcare and is usually associated with the presence of Panton-Valentine leukocidin toxin (PVL) and SCCmec types IV and V ( 2 , 3 ). In 2004 and 2005, some unexpected cases of MRSA were found in patients who were associated with pig farms ( 4 , 5 ). Genotyping showed that these MRSA isolates were nontypable by pulsed-field gel electrophoresis (PFGE) and belonged to 1 spa type (t108). The aims of this study were to determine if nontypable MRSA (NT-MRSA) isolates are associated with pig farming and to compare the phenotypic, genotypic, and epidemiologic features of NT-MRSA with those of typable MRSA strains. Methods National MRSA Database The National Institute for Public Health and the Environment (RIVM) is the national reference center for MRSA in the Netherlands (www.rivm.nl/mrsa). According to national guidelines, all microbiology laboratories send the first isolate of newly identified carriers of MRSA to RIVM. Strains are confirmed to be MRSA by a Martineau PCR and by mecA PCR assay ( 6 , 7 ). Since 2002, all strains are typed by using PFGE ( 8 ), and the presence of PVL genes is determined ( 9 ). Selection of Cases and Controls Cases and controls were selected from the national MRSA database at RIVM. Case-patients were defined as persons carrying NT-MRSA who provided the first isolate from a cluster of 1 particular referring laboratory (index-patient) in the period January 2003 to September 2005. Cases were considered to be secondary to an index case when the strain was isolated within 3 months after the previous isolate with the same PFGE typing result. Controls were persons who carried MRSA that was typable with PFGE and who also fulfilled the index-patient definition. Controls were derived from the laboratories that provided cases and were selected at random. Twice as many controls as case-patients were selected. Collection of Epidemiologic Background Information Data were collected by questionnaires that were sent to the referring laboratories. The questionnaire contained items about patient characteristics (birth date, sex, postal code, presence or absence of infection, hospital admission dates, profession, profession of partner, profession of parents, and contact with animals, e.g., pigs, cows, horses, chickens, cats, or dogs) and microbiologic data (isolation date, source of culture, medical specialty). All data were collected and entered into the database without our knowing whether it concerned a case or control. Initially, 41 cases and 82 controls from 26 different laboratories were selected from the national database. The response rate was 98% (40 cases and 81 controls). During workup, 5 cases and 5 controls were excluded for the following reasons: the confirmation test of the isolate indicated that it was not methicillin resistant (1 case), or the case did not fulfill the case definition because it was not the first case from a cluster (4 cases). Since 2 of these cases were from laboratories that had no other case in the study, the accompanying controls were excluded (n = 3). Two controls were identified outside the study period. Finally, 35 cases and 76 controls from 24 different laboratories were included in the analysis. Molecular Typing and Susceptibility Testing All MRSA isolates were typed by PFGE ( 8 ). All isolates from case-patients and 74 isolates from controls were typed by spa typing ( 10 ). Multilocus sequence typing (MLST) was performed on all case isolates, as well as on 1 strain of each spa type of the control isolates (n = 37) ( 11 ). PCR of the staphylococcal chromosome cassette (SCCmec) was performed according to Zhang et al. on all isolates from case-patients and 74 isolates from controls ( 12 ). The presence or absence of PVL genes (lukS-PV/lukF-PV) was determined in all case isolates and in 71 control isolates. The PVL genes were detected by PCR according to the method of Lina et al. ( 13 ). The susceptibility to antimicrobial agents was tested for 32 case isolates and 74 control isolates, according to CLSI guidelines that used Mueller-Hinton agar and multipoint inoculation ( 14 ). Statistical Analysis Data were entered into an Excel database (Microsoft Windows version 97 SR-2, Redmond, WA, USA) and further analyzed by using SAS (version 9.1) software package (SAS Institute Inc., Cary, NC, USA). Chi-square test and Fisher exact test for ordinal variables and Student t test for continuous variables were used for univariate analysis. Variables associated with both case-control status and the exposure (i.e., contact with pigs or cattle, respectively) with a p value 10%, they were left in the model. All statistical tests were 2-sided, and a p value 21% in the second half of 2006, after the introduction of intensified surveillance in July 2006. Geographic Distribution Figure 1 shows the geographic distribution of NT-MRSA and typable MRSA isolates, plotted over the density of the pig and human populations, respectively. The density of NT-MRSA isolates corresponds to the density of pig farming, whereas the density of typable strains corresponds to the density of the human population. The density of cattle farms is more or less identical to the density of pig farms. Figure 1 A) Number of nontypable methicillin-resistant Staphylococcus aureus (NT-MRSA) isolates per municipality received at the National Institute for Public Health and the Environment (RIVM), Bilthoven, the Netherlands, January 2003–June 2005. The background color represents the density of pigs per km2 in 2003. B) Number of typable MRSA per municipality received at the RIVM January 2003–June 2005. The background color represents the population density per km2 (source: CBS Statline). Epidemiologic Data Results of the univariate analysis are shown in Table 1. Comparable values were observed for the baseline characteristics of sex and age. Case-patients more often lived in rural areas and indicated more frequent contact with pigs or cattle than did controls. Controls were more often associated with healthcare facilities. Table 1 Results of univariate analysis of case-control study, the Netherlands, February 2007* Variable Cases Controls Odds ratio
(95% CI)† p value No. No. (%) or mean ± SD with variable No. No. (%) or mean ± SD with variable Gender (male) 35 20 (57) 76 36 (47) 1.5 (0.7–3.3) 0.34 Age, y 35 42.7 ± 25.3 76 47.3 ± 24.7 0.37 Residence 35 75 Rural area 14 (40) 6 (8) 7.7 (2.6–22.7)§ <0.01 Urban area 20 (57) 66 (85) Foreign country 1 (3) 3 (4) Contact with pigs 29 11 (38) 63 3 (5) 12.2 (3.1–48.6) <0.01 Contact with cattle 29 7 (24) 63 1 (2) 19.7 (2.3–169.5) <0.01 Unexpected MRSA 35 27 (77) 76 34 (45) 4.2 (1.7–10.4) <0.01 Probable source 35 76 Healthcare 5 (14) 39 (51) 0.01 Foreign country 3 (9) 5 (7) Other 12 (34) 10 (13) Unknown 15 (43) 22 (29) Active infection 35 19 (54) 76 29 (38) 1.9 (0.9–4.3) 0.11 Skin/soft tissue 10 (56) 24 (83) 0.3 (0.1–1.0) 0.05 Airways 3 (17) 0 Other 6 (28) 5 (17) Hospital admission 35 17 (49) 76 24 (32) 2.0 (0.9–4.6) 0.08 Hospital stay, d 16 18.9 ± 20.2 22 23.5 ± 30.9 0.60 *SD, standard deviation; CI, confidence interval; No., number of cases or controls for whom data are available.
†Odds ratio was determined for rural area relative to urban area. Among case-patients, MRSA was more frequently found in clinical samples (an unexpected finding) compared with controls, whose MRSA was found more often by targeted screening in nose, throat, and perineum. Among persons infected by MRSA, respiratory tract infections were more frequent in case-patients, whereas skin and soft tissue infections predominated in controls. Multivariate analysis that used a model with the variables describing type of residence (rural vs. other) and contact with pigs, cattle, cats, and dogs (yes, no, or unknown) showed that contact with pigs and contact with cattle were independent statistically significant variables. The adjusted odds ratios (OR) for pigs and cattle were 9.4 (95% confidence interval [CI] 1.8–47.7) and 13.5 (95% CI 1.0–179.3), respectively. Molecular Typing Thirty-two of 35 case-patients had MLST sequence type (ST) 398; 1 had ST 9; and the remaining 2 had ST 752 and 753, closely related to 398 (Figure 2). Among case-patients, the most frequent spa types were t108, t011, and t034 (Table 2). These MLST and spa types were not found among the controls. Twenty-two different STs and 37 different spa types were found in the controls (Table 2 and Figure 2). Figure 2 Genetic relatedness of methicillin-resistant Staphylococcus aureus from cases and controls, represented as a minimum spanning tree based on multilocus sequence typing (MLST) profiles. Each circle represents a sequence type, and numbers in the circles denote the sequence type. The size of the circle indicates the number of isolates with this sequence type. The number under and right of the lines connecting types denotes the number of differences in MLST profiles. The halos surrounding the circles indicate complexes of sequence types that differ by <3 loci. Table 2 Typing results for cases and the number of controls with the same type, the Netherlands, February 2007 Type Cases,
no. (%) Controls, no. (%) p value spa t108 14 (40) 0 <0.01 t011 8 (23) 0 t034 6 (17) 0 t571 3 (9) 0 t567 2 (6) 0 t337 1 (3) 0 t898 1 (3) 0 SCCmec I 0 4 (9) <0.01 II 0 7 (16) III 4 (17) 6 (14) IV 2 (8) 21 (49) V 18 (75) 5 (12) Panton-Valentine leukocidin 3 (9) 10 (14) 0.21 SCCmec typing showed that in isolates from cases SCCmec types III, IV, and V were found, whereas in isolates from controls all SCCmec types were found (Table 2). For 11 cases and 33 controls, the SCCmec type could not be determined. There was no difference in the presence of the PVL genes (Table 2). Antimicrobial Agent Susceptibility Table 3 shows the percentage of strains that were resistant to various antimicrobial agents. Isolates from case-patients were significantly more often resistant to doxycycline and clindamycin than were isolates from controls. Table 3 Number and percentage of resistant MRSA isolates for various antimicrobial agents, the Netherlands, February 2007* Agent Cases,
no. (%) Controls,
no. (%) p value Doxycycline 25 (78) 10 (14) <0.01 Ciprofloxacin 1 (3) 36 (49) <0.01 Tobramycin 4 (13) 25 (34) 0.02 Gentamicin 2 (6) 12(16) 0.14 Clindamycin 12 (38) 15 (20) 0.05 Erythromycin 15 (46) 29 (39) 0.35 Cotrimoxazole 0 7 (10) 0.07 Rifampin 0 6 (8) 0.11 Mupirocin 0 5 (7) 0.15 Vancomycin 0 0 *MRSA, methicillin-resistant Staphylococcus aureus. Discussion A new type of MRSA recently emerged in the Netherlands. The first isolate was found in 2003, and since then it has been found with increasing frequency. The geographic origin of NT-MRSA correlates with the density of pig populations. This association was confirmed by the results from this case-control study, which show that NT-MRSA is significantly related to contact with pigs. In addition, a significant association was found with cattle. After multivariate analysis, contact with pigs and cattle were the only 2 significant independent variables. Screening of a representative sample of pigs in the Netherlands was recently performed and showed that nearly 40% of the pigs were colonized with a comparable strain of MRSA (MLST 398) and that ≈80% of the pig farms were affected ( 15 ). The association between NT-MRSA and cattle was not expected when this study was initiated and needs further evaluation. On the basis of the above-mentioned findings, we conclude that this new MRSA strain is of animal origin (pigs and probably cows). Transmission of MRSA between animals and humans has previously been described, e.g., associated with colonized companion animals, horses, and persons who take care of them ( 16 – 19 ). However, the MRSA clones in these reports were known human clones, suggesting human-to-animal transmission in origin. Baptiste et al. found specific PFGE clones in horses that were never observed before ( 20 ). Until now, transmission of these clones to humans has not been reported. We assume that this problem is not limited to the Netherlands. First, widespread dissemination in pigs in the Netherlands has been found. When one considers the intensive international transport of pigs, it is unlikely that this situation is limited to the Netherlands. Second, 3 of the case-patients came from abroad, 1 tourist and 2 adopted children from Asia. Also, MLST 398 was recently found in animals (pig, dog, and foal) and in humans in Germany ( 21 ). Finally, in Hong Kong Special Administrative Region, People’s Republic of China, MRSA with MLST 398 has been found in 2 patients with bacteremia ( 22 ). The origin of the current NT-MRSA situation is difficult to elucidate. One earlier study can be found on carriage of S. aureus in pig farmers and pigs in France ( 23 ). It reported an increased carriage rate in pig farmers caused by transmission of S. aureus from pigs that also carried MLST ST 9 and 398. Further typing of the French ST 398 isolates at RIVM showed homology with the Dutch isolates. However, in the French study most of the MLST 398 strains were susceptible to β-lactam antimicrobial agents. The most likely explanation for the current findings is that MLST 398 is a commensal strain in pigs, which originally was methicillin susceptible. As most NT-MRSA isolates were resistant to doxycycline, the spread is facilitated by the abundant use of tetracyclines in pig and cattle farming ( 15 ). What are the implications of these findings? Persons working or living in close contact with pigs or cows are at increased risk of becoming colonized and infected with MRSA. Infections can be severe, as is indicated by the hospital admission rate. Also, a case of endocarditis has been reported recently ( 24 ). At present, whether this strain is spreading further in the community is not clear. Before final recommendations for control can be made, the current size of the reservoir in farm animals and in humans has to be determined at an international level.
- Record: found
- Abstract: found
- Article: not found
Diversity of prophages in dominant Staphylococcus aureus clonal lineages.
Christiane Goerke, Christiane Wolz, Jiri Doskar … (2009)
Temperate bacteriophages play an important role in the pathogenicity of Staphylococcus aureus, for instance, by mediating the horizontal gene transfer of virulence factors. Here we established a classification scheme for staphylococcal prophages of the major Siphoviridae family based on integrase gene polymorphism. Seventy-one published genome sequences of staphylococcal phages were clustered into distinct integrase groups which were related to the chromosomal integration site and to the encoded virulence gene content. Analysis of three marker modules (lysogeny, tail, and lysis) for phage functional units revealed that these phages exhibit different degrees of genome mosaicism. The prevalence of prophages in a representative S. aureus strain collection consisting of 386 isolates of diverse origin was determined. By linking the phage content to dominant S. aureus clonal complexes we could show that the distribution of bacteriophages varied remarkably between lineages, indicating restriction-based barriers. A comparison of colonizing and invasive S. aureus strain populations revealed that hlb-converting phages were significantly more frequent in colonizing strains.
Author and article information
Journal
Title:
Journal of Clinical Microbiology
Abbreviated Title:
J Clin Microbiol
Publisher:
American Society for Microbiology
ISSN
(Print):
0095-1137
ISSN
(Electronic):
1098-660X
Publication date Created:
September
2018
Publication date
(Electronic):
August
27 2018
Publication date
(Print):
July
05 2018
Volume: 56
Issue: 9
Article
DOI: 10.1128/JCM.00140-18
PMC ID: 6113466
PubMed ID: 29976589
SO-VID: c8ea04f4-ee5f-4ef7-bd20-aa826aaed112
Copyright © ©
2018
History
Data availability: