- Record: found
- Abstract: found
- Article: found
Reconstruction of insect hormone pathways in an aquatic firefly, Sclerotia aquatilis (Coleoptera: Lampyridae), using RNA-seq
research-article
Author(s):
Pornchanan Chanchay
1 ,
Wanwipa Vongsangnak
2
,
3 ,
Anchana Thancharoen
4 ,
Ajaraporn Sriboonlert
1
,
Publication date (Electronic):
2 August 2019
Journal:
PeerJ
Publisher:
PeerJ Inc.
Read this article at
There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.
Abstract
Insect hormones: ecdysteroids and juvenile hormones have crucial functions during the regulation of different developmental pathways in insects. Insect metamorphosis is one of the primary pathways regulated by these hormones. The insect hormone biosynthetic pathway is conserved among arthropods, including insects, with some variations in the form of hormones used among each group of insects. In this study, the candidate genes involved in the insect hormone pathways and their functional roles were assessed in an aquatic firefly, Sclerotia aquatilis using a high-throughput RNA sequencing technique. Illumina next-generation sequencing (NGS) was used to generate transcriptome data for the different developmental stages (i.e., larva, pupa, and adult) of S. aquatilis. A total of 82,022 unigenes were generated across all different developmental stages. Functional annotation was performed for each gene, based on multiple biological databases, generating 46,230 unigenes. These unigenes were subsequently mapped using KEGG pathways. Accordingly, 221 protein-encoding genes involved in the insect hormone pathways were identified, including, JHAMT, CYP15A1, JHE, and Halloween family genes. Twenty potential gene candidates associated with the biosynthetic and degradation pathways for insect hormones were subjected to real-time PCR, reverse transcriptase PCR (RT-PCR) and sequencing analyses. The real-time PCR results showed similar expression patterns as those observed for transcriptome expression profiles for most of the examined genes. RT-PCR and Sanger sequencing confirmed the expressed coding sequences of these gene candidates. This study is the first to examine firefly insect hormone pathways, facilitating a better understanding of firefly growth and development.
Related collections
Most cited references48
- Record: found
- Abstract: found
- Article: not found
CYP15A1, the cytochrome P450 that catalyzes epoxidation of methyl farnesoate to juvenile hormone III in cockroach corpora allata.
C Helvig, Gopalan Unnithan, R Feyereisen … (2004)
The molecular analysis of insect hormone biosynthesis has long been hampered by the minute size of the endocrine glands producing them. Expressed sequence tags from the corpora allata of the cockroach Diploptera punctata yielded a new cytochrome P450, CYP15A1. Its full-length cDNA encoded a 493-aa protein that has only 34% amino acid identity with CYP4C7, a terpenoid omega-hydroxylase previously cloned from this tissue. Heterologous expression of the cDNA in Escherichia coli produced >300 nmol of CYP15A1 per liter of culture. After purification, its catalytic activity was reconstituted by using phospholipids and house fly P450 reductase. CYP15A1 metabolizes methyl (2E,6E)-3,7,11-trimethyl-2,6-dodecatrienoate (methyl farnesoate) to methyl (2E,6E)-(10R)-10,11-epoxy-3,7,11-trimethyl-2,6-dodecadienoate [juvenile hormone III, JH III] with a turnover of 3-5 nmol/min/nmol P450. The enzyme produces JH III with a ratio of approximately 98:2 in favor of the natural (10R)-epoxide enantiomer. This result is in contrast to other insect P450s, such as CYP6A1, that epoxidize methyl farnesoate with lower regio- and stereoselectivity. RT-PCR experiments show that the CYP15A1 gene is expressed selectively in the corpora allata of D. punctata, at the time of maximal JH production by the glands. We thus report the cloning and functional expression of a gene involved in an insect-specific step of juvenile hormone biosynthesis. Heterologously expressed CYP15A1 from D. punctata or its ortholog from economically important species may be useful in the design and screening of selective insect control agents.
- Record: found
- Abstract: found
- Article: not found
Molecular evolution of the insect Halloween family of cytochrome P450s: phylogeny, gene organization and functional conservation.
The insect molting hormone, 20-hydroxyecdysone (20E), is a major modulator of the developmental processes resulting in molting and metamorphosis. During evolution selective forces have preserved the Halloween genes encoding cytochrome P450 (P450) enzymes that mediate the biosynthesis of 20E. In the present study, we examine the phylogenetic relationships of these P450 genes in holometabolous insects belonging to the orders Hymenoptera, Coleoptera, Lepidoptera and Diptera. The analyzed insect genomes each contains single orthologs of Phantom (CYP306A1), Disembodied (CYP302A1), Shadow (CYP315A1) and Shade (CYP314A1), the terminal hydroxylases. In Drosophila melanogaster, the Halloween gene spook (Cyp307a1) is required for the biosynthesis of 20E, although a function has not yet been identified. Unlike the other Halloween genes, the ancestor of this gene evolved into three paralogs, all in the CYP307 family, through gene duplication. The genomic stability of these paralogs varies among species. Intron-exon structures indicate that D. melanogaster Cyp307a1 is a mRNA-derived paralog of spookier (Cyp307a2), which is the ancestral gene and the closest ortholog of the coleopteran, lepidopteran and mosquito CYP307A subfamily genes. Evolutionary links between the insect Halloween genes and vertebrate steroidogenic P450s suggest that they originated from common ancestors, perhaps destined for steroidogenesis, before the deuterostome-arthropod split. Conservation of putative substrate recognition sites of orthologous Halloween genes indicates selective constraint on these residues to prevent functional divergence. The results suggest that duplications of ancestral P450 genes that acquired novel functions may have been an important mechanism for evolving the ecdysteroidogenic pathway.
- Record: found
- Abstract: found
- Article: not found
The IL-15-AKT-XBP1s signaling pathway contributes to effector functions and survival in human NK cells
Yufeng Wang, Yibo Zhang, Ping Yi … (2018)
Interleukin 15 (IL-15) is one of the most important cytokines regulating the biology of natural killer (NK) cells 1 . Here we identified a signaling pathway involving the serine-threonine kinase AKT and XBP1s, a transcription factor that regulates unfolded protein response genes 2,3 , that was activated in response to IL-15 in human NK cells. IL-15 induced the phosphorylation of AKT, which led to the deubiquitination, increased stability and nuclear accumulation of XBP1s protein. XBP1s bound to and recruited the transcription factor T-BET to the gene encoding granzyme B, leading to increased transcription. XBP1s positively regulated the cytolytic activity of NK cells against leukemia cells and was also required for IL-15-mediated NK cell survival through an anti-apoptotic mechanism. Thus, the newly identified IL-15-AKT-XBP1s signaling pathway contributes to enhanced effector functions and survival of human NK cells. Unspliced XBP1 mRNA, known as XBP1u, encodes an unstable cytoplasmic protein with no transactivation domains. As a result of unconventional splicing mediated by the serine/threonine-protein kinase/endoribonuclease, IRE1α, mature XBP1 mRNA is converted to XBP1s 4 . The protein encoded by XBP1s can act as a transcription factor 2,3 . XBP1s has multiple roles in regulating the immune response. It regulates major histocompatibility complex class II (MHC II) gene transcription in HeLa and COS cells 5 , as well as the differentiation of plasma cells, eosinophils and CD8+ T cells 6–8 . XBP1s also modulates anti-tumor immunity by disrupting dendritic cell homeostasis 9 . We investigated the expression of XBP1s in primary human NK cells purified from the blood of healthy donors in response to interleukin 2 (IL-2), IL-12 or IL-15 for 24 h prior to analysis by flow cytometry or immunoblot. IL-15 induced the expression of XBP1s protein, whereas IL-2 and IL-12 showed reduced effects compared to IL-15 (Fig. 1a,b). Although IL-2 and IL-15 share the cognate receptors IL-2Rβ and IL-2Rγc on NK cells, induction of XBP1s by IL-15 was significantly higher than that triggered by similar concentrations of IL-2 (Fig. 1b and Supplementary Fig. 1a). This suggests that the IL-15Rα chain expressed on NK cells may play a critical role in inducing XBP1s. In addition, the expression of transcripts for XBP1s target genes, including ERDJ4 and SEC61A1 9 , was significantly increased in IL-15-treated primary human NK cells compared to non-treated, IL-2- or IL-12-treated cells (Fig. 1c). We next investigated the effects of XBP1s overexpression on NK cell function. Primary human NK cells transfected with pCDH lentivirus carrying a wild-type XBP1s gene (pCDH-XBP1s) and co-cultured with K562, MOLM-13 or U937 leukemia cell lines had a higher percentage of CD107a+ NK cells compared to NK cells transfected with the lentivirus carrying an empty PCDH vector (pCDH-EV) (Fig. 1d). Upon co-culture with MOML-13 target cells, the percentage of CD107a+ cells in primary human NK cells transduced with pLKO.1 lentivirus carrying XBP1 shRNAs (XBP1-knockdown, KD) was significantly decreased (an approximately 35% reduction) compared to cells transduced with pLKO.1 lentivirus carrying scramble shRNAs (scramble-KD) (Fig. 1e). In addition, primary human NK cell degranulation against multiple myeloma MM.1S cells was observed in IL-15-treated, but not in non-treated primary human NK cells (Fig. 1f). When co-cultured with MM.1S multiple myeloma cells, the percentage of CD107a+ NK cells expressing XBP1s was approximately 4-fold greater than that of CD107a+ NK cells lacking XBP1s (Fig. 1f). Moreover, the expression of XBP1s protein was significantly higher in CD107a+ compared to CD107a─ primary human NK cells co-cultured with MM.1S cells (Supplementary Fig. 1b), indicating that expression of XBP1s correlates with NK cell cytotoxicity against tumor cells. Collectively, our results suggest that IL-15 induces XBP1s protein expression and the expression level of the transcriptional factor directly correlates with cytotoxic activity in human NK cells. To investigate how XBP1s regulates NK cell function, we analyzed the expression of genes related to NK cell effector functions, including GZMB (granzyme B), IFNG (interferon-γ), and PRF1 (perforin). Expression of GZMB and IFNG but not PRF1 mRNA was higher in pCDH-XBP1s-transduced primary human NK cells compared to pCDH-EV control NK cells (Fig. 1a), along with increased expression of GZMB protein (Fig. 2b,c). Overexpression of the unspliced form of XBP1, XBP1u, which can be processed into XBP1s through IRE1α-mediated mRNA splicing, in primary human NK cells by transduction with pCDH lentivirus carrying a wild-type XBP1u gene (pCDH-XBP1u) also increased the expression of GZMB compared to pCDH-EV NK cells (Fig. 2b,c). Moreover, primary human NK cells treated with thapsigargin (Thap), a chemical drug that induces ER stress and IRE1α catalytic activity 10 , increased XBP1s protein and GZMB mRNA and protein when compared to NK cells without Thap treatment, in the absence or presence of IL-15 (Supplementary Fig. 2a-c). In addition, downregulation of GZMB protein expression was observed in primary human NK cells transfected with XBP1 siRNAs compared to cells transfected with scramble control siRNAs (Supplementary Fig. 2d,e). We also observed decreased expression of both GZMB and IFNG genes, but not PRF1, in primary human NK cells with XBP1-KD using shRNA, compared to scramble-KD control NK cells (Fig. 1d). Inhibition of XBP1 mRNA splicing in primary human NK cells with 4µ8C, an inhibitor of IRE1α-mediated mRNA splicing 11 , resulted in decreased expression of XBP1s protein and suppression of IL-15-induced GZMB protein and mRNA compared to the cells without 4µ8C treatment (Supplementary Fig. 2f-h). The expression of XBP1s protein was positively correlated with the mRNA expression of GZMB and IFNG, all of which were induced by treatment with IL-15 at multiple time points in primary human NK cells (Fig. 1e). Thus, XBP1s positively regulates the expression of GZMB and IFN-γ in NK cells. We next investigated the cellular localization of XBP1s. Immunoblot analysis of the cytoplasmic and nuclear protein fractions in primary human NK cells treated with IL-15 for 24 h indicated that XBP1s exists almost exclusively in the nucleus following induction by IL-15 (Fig. 2a), consistent with its role in regulating transcription 12 . Next, we overexpressed T-BET and FLAG-XBP1u or FLAG-XBP1s in 293T cells. Co-immunoprecipitation followed by immunoblot using antibodies against FLAG or T-BET indicated that overexpressed FLAG-XBP1s interacted with T-BET (Fig. 3b,c and Supplementary Fig. 3a), a transcriptional regulator important for NK cell function. T-BET was previously assumed to associate with the GZMB promoter, although no specific binding sites have been identified 13,14 . Of note, FLAG-XBP1s did not interact with endogenous STAT5 in 293T cells, an important transcriptional factor downstream of IL-15 signaling (Fig. 2c). Using confocal imaging with antibodies identifying both XBP1u and XBP1s, and a T-BET antibody, we observed the co-localization of T-BET and XBP1 in the nuclei of primary human NK cells (Fig. 2d) and in the human NK cell lymphoma cell line NK-92 (Supplementary Fig. 3b). Confocal microscopy indicated that T-BET has an almost exclusively nuclear distribution in NK cells (Fig. 2d), which was validated by staining with an alternative antibody against T-BET in both primary NK cells and NK-92 cells (Supplementary Fig. 3c). Next, we tested whether XBP1s interacted with its canonical binding motifs (G/C)ACGT 15,16 located within the GZMB proximal promoter (Fig. 2e). Chromatin immunoprecipitation (ChIP) indicated that XBP1s and T-BET bound to the same proximal region of the GZMB promoter in primary human NK cells treated with IL-15, but with little or no binding in untreated cells (Fig. 3e,f). In contrast, T-BET did not bind to the GZMB promoter in primary human NK cells treated with 4µ8C (which do not express XBP1s; Supplementary Fig. 2g) in the presence of IL-15, compared to control cells only treated with IL-15 (Supplementary Fig. 3d). Using a luciferase assay to evaluate GZMB promoter activity, we observed that 293T cells transfected with XBP1s had much higher GZMB promoter activity compared to that of the empty vector-transfected cells (Fig. 2g). Of note, we also observed STAT5 binding to the GZMB promoter in primary human NK cells by ChIP assays (Fig. 2e), consistent with previous reports 17 . STAT5 is known to positively regulate GZMB expression 17–19 ; however, STAT5 did not interact with FLAG-XBP1s in 293T cells by co-immunoprecipitation assays (Fig. 2c). To test whether STAT5 was required for GZMB induction by XBP1s we knocked down the expression of STAT5A or STAT5B using shRNAs in 293T cells that were co-transfected with a pCDH-XBP1s or pCDH-EV and a PGL3 vector carrying the GZMB promoter reporter (PGL3-GZMB) (Supplementary Fig. 4a). The induction of the GZMB promoter reporter by XBP1s overexpression was not inhibited by either STAT5A-KD (279%) or STAT5B-KD (184%) in 293T cells compared to control 293T cells (175%) (Supplementary Fig. 4b), indicating that induction of GZMB promoter activity by XBP1s and T-BET in 293T cells does not require STAT5. Together, our data suggest that XBP1s interacts with T-BET but not STAT5 and regulates the transcriptional activity of GZMB via promoter binding. XBP1 is a survival gene that protects cells from stress-induced death 20,21 , and IL-15 is a critical cytokine for NK cell survival 1,22 . Knockdown of XBP1 by transfection with XBP1 siRNAs resulted in increased expression of cleaved caspase-3 in primary human NK cells compared to cells transfected with scramble siRNAs (Fig. 3a), indicating increased apoptosis in XBP1-KD NK cells. In contrast, pCDH-XBP1u- or pCDH-XBP1s-transduced primary human NK cells showed decreased expression of cleaved caspase-3 compared to pCDH-EV control NK cells (Fig. 3b). Moreover, in IL-15-activated primary human NK cells in which XBP1 splicing was inhibited by treatment with 4µ8C, cleaved caspase-3 was higher and survival was lower compared to similarly activated cells without 4µ8C treatment (Fig. 4c-f). Taken together, these data indicate that XBP1s modulates IL-15-induced survival in human NK cells. Next, we investigated the molecular mechanism by which IL-15 regulated the expression of XBP1s protein. IL-15 stimulation of primary human NK cells did not increase the amount of XBP1s mRNA compared to unstimulated NK cells, as evaluated by XBP1 splicing assays and qPCR; however, XBP1s protein accumulated in the nucleus of IL-15-treated primary human NK cells within 2 h of stimulation (Fig. 5a,b). IL-15 stimulation also induced the phosphorylation of the serine-threonine kinase AKT in NK cells primarily in the cytoplasm (Fig. 4b), as previously reported 23 . Blockade of AKT phosphorylation with the AKT inhibitor AKTi-1/2 24 in IL-15-stimulated primary human NK cells resulted in decreased expression of XBP1s protein compared to cells treated with IL-15 in the absence AKTi-1/2 (Fig. 4c and Supplementary Fig. 5a). Moreover, the expression of GZMB mRNA and GZMB protein was significantly downregulated in primary NK cells transduced with AKT1-shRNA compared to scramble shRNA (Supplementary Fig. 5b,c). On the other hand, the expression of GZMB mRNA was significantly upregulated and GZMB protein was moderately upregulated in primary NK cells transduced with a constitutively active form of AKT (pCDH-myrAKTΔ4−129, encoding a 14 amino acid src myristoylation signal sequence fused to the N-terminus of AKT delta4–129 25 ), compared to cells transduced with control pCDH-EV (Supplementary Fig. 5d,e). Treatment with AKTi-1/2 also reduced the level of XBP1s protein in IL-15-stimulated NK cells in the presence of cycloheximide (CHX), which blocks de novo protein synthesis and thus prevents any confounding effects of increased protein translation 26 (Fig. 4d and Supplementary Fig.6a). These data indicate that AKT plays a role in increasing the IL-15-induced protein levels, but not mRNA expression of XBP1s in primary human NK cells. To further test whether AKT is required for maintaining the level of XBP1s protein, we co-transfected various concentrations of pECE-myrAKTΔ4−129 or pECE-EV with pCDH-FLAG-XBP1s or pCDH-EV into 293T cells. Immunoprecipitation experiments indicated that the level of FLAG-XBP1s protein was markedly increased in a dose-dependent manner by myrAKTΔ4−129 overexpression (Fig. 4e and Supplementary Fig. 6b), while XBP1s mRNA was not induced by overexpression of myrAKTΔ4−129 (Fig. 4f), consistent with the idea that IL-15-induced XBP1s upregulation is independent of XBP1s transcription. In addition, co-transduction of pCDH-XBP1s and pECE-myrAKTΔ4−129 enhanced the activity of the GZMB promoter in 293T cells compared to transfection of pCDH-XBP1s alone (Supplementary Fig. 6c). These data indicate that AKT activation is required for maintaining the level of XBP1s protein. As time advanced during a 4-h incubation, a decrease was observed in FLAG-XBP1s protein in 293T cells transfected with pECE-EV, but not with pECE-myrAKTΔ4−129 following CHX treatment (Fig. 4g and Supplementary Fig. 6d), suggesting that signaling downstream of AKT protects XBP1s from degradation. Block of proteosomal degradation with the cell-permeable proteasome and calpain inhibitor MG132 27 recovered FLAG-XBP1s protein in pECE-EV- but not pECE-myrAKTΔ4−129-transfected 293T cells treated with CHX (Fig. 4g and Supplementary Fig. 6d), indicating that overexpression of myrAKTΔ4−129 enhanced the protein stability of XBP1s in 293T cells. Ubiquitination of FLAG-XBP1s was reduced following transfection of pECE-myrAKTΔ4−129 compared to pECE-EV in 293T cells (Fig. 4h), while ubiquitination of XBP1s was substantially increased in IL-15-stimulated primary human NK cells treated with the AKT inhibitor AKTi-1/2 compared to untreated cells (Fig. 4i). Our data suggest that AKT controls XBP1s stability, possibly through a mechanism involving the ubiquitination of XBP1s. Our studies describe a pathway that links IL-15 signaling with intracellular mechanisms that contribute to NK cell cytotoxicity and survival. We show that IL-15 stabilizes XBP1s protein through phosphorylation of AKT, allowing its downstream interaction with T-BET. T-BET activity correlates with GZMB expression 14 . Yet, there are no direct T-BET binding sites on the GZMB promoter 13,14 . Based on the presence of an XBP1s binding motif within the GZMB promoter 13 , we showed that XBP1s mediates the interaction between T-BET and the GZMB promoter, as suggested by the ability of XBP1s to bind the promoter of GZMB and to interact with T-BET. We showed that AKT is involved in the regulation of XBP1s downstream of IL-15. PI3K-AKT signaling is stimulated by IL-2 and IL-15, with AKT phosphorylation being more sensitive to IL-15 than IL-2 28 , in agreement with our data that IL-15 was the most potent cytokine (among IL-2, IL-12 and IL-15) in increasing XBP1s protein expression and function. AKT is known to regulate both protein ubiquitination and deubiquitination, with distinct mechanisms for each process 29,30 . Ubiquitination and degradation of PTEN, a natural inhibitor of the PI3K-AKT pathway, in tumor cells require the stabilization of the E3 ligase MKRN1 via AKT-mediated phosphorylation 30 . However, AKT also induces protein stabilization by activating USP-14, a ubiquitin-specific protease that handles the turnover of short-lived proteins via deubiquitination 29 . We showed here that AKT signaling caused the deubiquitination and promoted the accumulation of XBP1s. Consistent with our data, deficiency of the PI3K subunits p110γ or p110δ, which regulate AKT activity, has been reported to disrupt NK cell maturation, development and cytotoxicity 31,32 . Moreover, inhibition of PI3K suppresses GZMB expression in NK cells, and also decreases NK cell cytotoxicity against tumor cells 33–35 . These observations are consistent with our findings that IL-15 stimulation of NK cells caused an increase of AKT phosphorylation that correlated with decreased degradation of XBP1s, which subsequently enhanced NK cell degranulation following co-culture with tumor cells. Moreover, the active form of AKT, myrAKTΔ4−129, enhanced the XBP1s-induced transcription of GZMB. Notably, myrAKTΔ4−129 alone slightly induced GZMB transcription in 293T cells, but a synergistic effect on GZMB transcription was observed following co-transfection with XBP1s. IL-15 promotes NK cell survival 22 . However, the molecular basis of this mechanism remains poorly understood. Our current study supports a model in which XBP1s is located downstream of PI3K-AKT and AKT contributes to the protein stability of XBP1s in NK cells following treatment with IL-15, eventually controlling NK cell survival. Consistent with our data, XBP1s is known to rescue cells from pro-apoptotic processes induced by ER stress, oxidative stress or hypoxia 20,21,36 . The anti-apoptotic protein Bcl-2 is highly expressed in resting NK cells 37 and contributes to NK cell survival in the resting state 38,39 . However, Bcl-2 appears to be redundant for survival of activated or proliferating NK cells 38 . Here we found that XBP1s was highly expressed in IL-15-activated NK cells, but its expression was relatively low in resting NK cells. Moreover, inhibition of XBP1s abolished the survival of IL-15-activated NK cells, but had no effect on the survival of resting NK cells. Thus, we speculate that Bcl-2 is responsible for the survival of resting NK cells, while XBP1s is responsible for the survival of IL-15-activated NK cells. In conclusion, we showed that XBP1s acts as an essential transcriptional factor downstream of IL-15 and AKT signaling in controlling two important aspects of NK cell biology: effector functions and survival. The IL-15-AKT-XBP1s axis may offer a potential target to improve the therapeutic efficacy of ex vivo expanded NK cells and/or chimeric antigen receptor (CAR)-modified NK cells 40 for the treatment of various cancers. Methods Isolation of primary human NK cells. Leukocyte-enriched peripheral blood samples of human healthy donors were obtained from the American Red Cross. Primary NK cells were isolated using the MACSxpress® NK Cell Isolation Kit (Miltenyi Biotec) and Erythrocyte Depletion Kit (Miltenyi Biotec). Enriched NK cells were approximately 99% pure, which was confirmed by flow cytometry using anti-CD3 and anti-CD56 antibodies (BD Biosciences). Primary human NK cells were used for the experiments in this study unless otherwise indicated that the NK-92 cell line was used for specific experiments. The protocols for human specimen collection were approved by the IRBs of The Ohio State University. Cell culture. The K562 and NK-92 cell lines were purchased from ATCC. The U937, MM.1S, and MOLM-13 cell lines were obtained from the Caligiuri laboratory. These cell lines and primary NK cells were cultured in RPMI 1640 medium containing L-glutamine (Sigma) and supplemented with 10% or 20% heat-inactivated fetal bovine serum (FBS; Sigma). The 293T cell line, which was purchased from ATCC, was cultured in Dulbecco’s Modified Eagle’s Medium, DMEM (Sigma), supplemented with 10% FBS. All cells were incubated at 37°C in a humidified incubator containing 5% CO2. Antibodies and other reagents. Anti-β-Actin, anti-Lamin B, anti-XBP1, and anti-T-BET antibodies were purchased from Santa Cruz Biotechnology Inc. Anti-p-AKT (S473), anti-AKT, anti-α-Tubulin, anti-FLAG, anti-p-STAT5, anti-STAT5, anti-GZMB, anti-T-BET, anti-ubiquitin (for western), anti-GAPDH, and anti-C-CASP3 antibodies were purchased from Cell Signaling Technology, Inc. (CST). The anti-ubiquitin mAb for IP was purchased from MilliporeSigma. Anti-HA antibody was purchased from Sigma. Anti-XBP1s antibody for immunoblot was purchased from BioLegend. Anti-hCD3-APC-H7 (560176), anti-hCD56-FITC (557699), anti-hCD56-V450 (560360), anti-hCD107a-APC (560664), anti-hCD107a-APC-H7 (561343), anti-XBP1s (563382) and anti-hGZMB (560212) antibodies used for surface and intracellular flow cytometry were purchased from BD Biosciences. Chemical inhibitors (4µ8C, S7272; AKTi-1/2, S7776; MG132, S2619) used in cell treatment experiments were purchased from Selleck Chemicals. CHX (239764) was purchased from Sigma. The CellTrace™ CFSE Cell Proliferation Kit and the Far Red Cell Proliferation Kit were purchased from Thermo Fisher Scientific. The scramble (EHUFLUC) and XBP1 (EHU069131) esiRNAs were purchased from Sigma. The scramble (SHC007), XBP1 (shXBP1 #1, TRCN0000019804; shXBP1 #2, TRCN0000019808), STAT5A shRNA (TRCN0000232134), STAT5B shRNA (TRCN0000232140) and AKT1 shRNA (TRCN0000039797) cloned in the pLKO.1-puro vector were purchased from Sigma. The selection marker, puromycin, in the pLKO.1-puro vector was replaced by GFP for sorting (FACS) of transduced cells. IL-2 (#200–02), IL-12 (#200–12), and IL-15 (#200–15) were purchased from PeproTech. Transient transfection and lentivirus infection. 293T cells were seeded and incubated at 37°C in a 5% CO2 environment until the cells were 60–80% confluent. The cells were transfected with plasmids using Lipofectamine 3000 Reagent (Fisher Scientific). NK cells were transfected with esiRNA (Sigma) using the nucleofection method (Lonza) 41 . To generate lentivirus to infect human NK cells, 293T cells were co-transfected with pCDH expressing XBP1u, XBP1s, myrAKTΔ4−129, or pLKO.1 expressing XBP1 or AKT1 shRNA or corresponding control plasmids with the packaging constructs pCMV-VSVG and pCMV-ΔR9 by a ProFection® Mammalian Transfection System (Promega). The protocols for virus production and infection were modified from our previous reports 42,43 . During the lentiviral infection process, IL-15 was introduced into the cell culture to maintain survival of NK cells. RT-PCR and XBP1 splicing assay. Total RNA was extracted with the RNeasy Mini Kit (74106, Qiagen), and cDNA was synthesized using random hexamers and M-MLV reverse transcriptase (Invitrogen). cDNA was amplified by quantitative (q)-PCR with SYBR® Green PCR Master Mix (Applied Biosystems) and gene specific primers. Relative amplification values were normalized to the amplification of β-actin. For the XBP1 splicing assay, cDNA was amplified by PCR with Taq DNA polymerase (Invitrogen) and gene specific primers 9 . The following primer sequences were used: hXBP1 forward primer: (CCTGGTTGCTGAAGAGGAGG); hXBP1 reverse primer: (CCATGGGGAGTTCTGGAG). The PCR conditions were used: 98°C for 30 sec, followed by 40 cycles of 98°C for 15 sec, 62°C for 30 sec, and 72°C for 60 sec. Immunoblotting. Cells were suspended in lysis buffer on ice for 1 h. Equal amounts of protein (~20 μg) were resolved by 5–20% SDS-polyacrylamide gels (Bio-rad) and then transferred onto a PVDF membrane (Fisher Scientific). The membrane was incubated with a primary antibody at 4°C for 16 h and a horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h at room temperature 44,45 . The immunoblots were visualized with SuperSignal West Femto Maximum Sensitivity Substrate (Fisher Scientific). Densitometric analysis was performed to quantify intensity of gel bands. Immunoprecipitation (IP). Cell lysates were prepared with NP40 lysis buffer. For 293T cells, cell lysates were prepared 48 h after plasmid transfection unless otherwise indicated. A beads-antibody complex was prepared using appropriate primary antibodies and Pierce™ Protein G Agarose (Fisher Scientific), followed by IP according to the manufacturer’s protocol and as we previously reported 43 . The precipitated proteins were detected by immunoblotting. Chromatin immunoprecipitation (ChIP). ChIP assays were carried out with a Magna ChIP™ A/G Chromatin Immunoprecipitation Kit (EMD Millipore). Briefly, an equal amount (10 μg) of rabbit anti-XBP1s antibody (BioLegend), rabbit anti-STAT5 antibody (CST), rabbit anti-T-BET antibody (CST) or normal IgG (Santa Cruz) was used to precipitate the cross-linked DNA/protein complexes from 10 × 106 NK cells. After reversal of cross-linking, the precipitated chromatin of the GZMB promoter region was detected by PCR using the following primers: forward primer: (GGGCTCAAACACATACCTGC); reverse primer: (TGACCACATCATCACCCACAG). Luciferase reporter assay. Luciferase reporter assays were carried out with a Dual-Luciferase Reporter Assay System (Promega), following our published protocol 46 with modifications. After 48 h transfection, cells on a 24-well plate were lysed in 100 µl of 1x Passive Lysis Buffer (Promega). 20 µl of lysates were transferred to a 96-well plate. 100 µl of 1x Glo® luciferase assay substrate (Promega) was added to each well, and firefly luciferase was collected from the transfected pGL3 plasmid using the GloMax® 96 Microplate Luminometer (Promega). Renilla luciferase from the co-transfected pRL-TK plasmid (as a normalized control) was collected after injection with 100 µl of 1x Stop® Substrate (Promega). Flow cytometry. Cells were labeled with monoclonal antibodies at room temperature for 15 min and washed with PBS containing 2% BSA prior to analysis using an LSRII flow cytometer (BD Biosciences) to detect surface expression of each antigen. NK cells were gated as CD56+CD3─ lymphocytes. For analysis by intracellular flow cytometric analysis, cells were permeabilized and fixed using a Foxp3/Transcription Factor Fixation/Permeabilization kit (eBioscience). Statistical analysis. For continuous, normally-distributed data, two-sample t-tests or paired t-tests were used to compare two independent or two paired groups. Linear mixed model was used to compare three or more groups with a variance-covariance structure due to repeated measures from the same donors. Two-way ANOVA model was applied to the synergistic effect test between two factors. P values were adjusted for multiple comparisons using Holm’s procedure. A P value of 0.05 or less was considered statistically significant. Reporting Summary. Further information on experimental design is available in the Nature Research Reporting Summary. Supplementary Material 1 2 3
Author and article information
Contributors
Ajaraporn Sriboonlert
Journal
Journal ID (nlm-ta): PeerJ
Journal ID (iso-abbrev): PeerJ
Journal ID (publisher-id): peerj
Journal ID (pmc): peerj
Title:
PeerJ
Publisher:
PeerJ Inc.
(San Diego, USA
)
ISSN
(Electronic):
2167-8359
Publication date
(Electronic):
2
August
2019
Publication date Collection: 2019
Volume: 7
Electronic Location Identifier: e7428
Affiliations
Article
Publisher ID: 7428DOI: 10.7717/peerj.7428
PMC ID: 6681800
PubMed ID: 31396456
SO-VID: f9b97221-94d3-4eb9-84d8-181bec115a39
Copyright © ©2019 Chanchay et al.
License:
This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, reproduction and adaptation in any medium and for any purpose provided that it is properly attributed. For attribution, the original author(s), title, publication source (PeerJ) and either DOI or URL of the article must be cited.
History
Date
received
: 16
March
2019
Date
accepted
: 7
July
2019
Funding
Funded by: Graduate Scholarship Program, Graduate School, Kasetsart University
Funded by: Kasetsart University Research and Development Institute (KURDI)
This research was financially supported by the Graduate Scholarship Program, Graduate
School, Kasetsart University and the Kasetsart University Research and Development
Institute (KURDI). The funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript.
Categories
Subject:
Bioinformatics
Subject:
Developmental Biology
Subject:
Entomology
Subject:
Genetics
Subject:
Molecular Biology
Data availability: