Proteolysis through the ubiquitin–proteasome pathway has an important role in the
regulation of the cell cycle and division, differentiation and development, as well
as a variety of other basic cellular processes (Ciechanover et al, 2000). In addition,
this pathway plays an important role in the wasting of skeletal muscle seen in a range
of catabolic processes, including starvation, sepsis, metabolic acidosis, weightlessness,
severe trauma, denervation atrophy and cancer cachexia (Lecker et al, 1999). In this
process, proteins are degraded into peptides within the 20S proteasome, a cylindrical
structure of four stacked rings, each composed of seven subunits surrounding a central
cavity. The inner β rings contain proteolytic enzymes, while the two outer α rings
surround a small cavity through which protein substrates must enter. Cellular proteins
are marked for degradation by attachment of a polyubiquitin chain. While the ubiquitin-conjugating
enzyme (E214k) was suggested to be the rate-limiting step in the pathway in starvation
(Wing and Banville, 1994), it has recently been shown that E214k knockout is not associated
with decreased protein catabolism (Adegoke et al, 2002). Instead, ubiquitin-protein
ligases (E3) may play a more important role in muscle atrophy and E3 knockout is clearly
associated with increased protein catabolism (Bodine et al, 2001; Gomes et al, 2001).
Despite the importance of the ubiquitin–proteasome pathway, there is little information
on intracellular signals leading to an increased gene transcription of the rate-limiting
enzymes. It has been suggested that glucocorticoids and a low insulin level in tandem
activate the ubiquitin–proteasome proteolytic system (Mitch et al, 1999). Glucocorticoids
increase protein catabolism by opposing the suppression of the transcription of the
proteasome C3 α-subunit by nuclear factor-κB (NF-κB), by antagonising the interaction
of NF-κB with an NF-κB response element in the C3 subunit promoter region (Du et al,
2000). Also physiological levels of glucocorticoids are necessary, but not sufficient
for the catabolic response in rats with metabolic acidosis (Price et al, 1994), starvation
(Wing and Goldberg, 1993) and sepsis (Tiao et al, 1996). However, chronic excessive
glucocorticoid production, as occurs in Cushing's syndrome is not associated with
an increased mRNA for ubiquitin, the ubiquitin-conjugating enzyme, E214k, or proteasome
subunits (Ralliere et al, 1997), suggesting that other factors may be involved.
We have isolated a sulphated glycoprotein of Mr 24 000 produced by cachexia-inducing
murine and human tumours (Todorov et al, 1996), which induces proteolysis directly
in isolated skeletal muscle (Lorite et al, 1997) and in C2C12 murine myoblasts in
the absence of glucocorticoids (Smith et al, 1999). This factor, named proteolysis-inducing
factor (PIF), induces release of arachidonic acid from muscle cells with an increased
production of prostaglandin (PG) E2 and F2α
together with metabolism through the lipoxygenase pathways to 5-, 12-, and 15-hydroxyeicosatetraenoic
acids (HETEs) (Smith et al, 1999). Release of arachidonic acid and its subsequent
metabolism was shown to be directly related to the induction of protein catabolism,
since it was completely attenuated in the presence of eicosapentaenoic acid (EPA),
which also completely inhibited protein degradation induced by PIF. Of the metabolites
of arachidonate only 15(S)-HETE produced a significant increase in protein degradation
alone, suggesting that it acts as an intracellular signal for the action of PIF. Since
PIF has been shown to upregulate the ubiquitin–proteasome pathway (Lorite et al, 1998),
this suggests that 15(S)-HETE should also induce the key regulatory components of
this pathway.
This study utilizes an in vitro model of skeletal muscle (C2C12 myotubes) to investigate
the effect of 15(S)-HETE on protein degradation and protein and mRNA levels of the
key enzymes of the ubiquitin–proteasome pathway, as well as the involvement of potential
transcription factors.
MATERIALS AND METHODS
Materials
L-[2,6-3H]Phenylalanine (sp. act. 2.00 TBq mmol−1) was purchased from Amersham International
(Bucks, UK). Foetal calf serum (FCS), horse serum (HS) and Dulbecco's modified Eagle's
medium (DMEM) were purchased from Life Technologies (Paisley, Scotland). Mouse anti-p42
antibody was a gift from Dr Jane Arnold, UK. Mouse monoclonal antibody to myosin heavy
chain was purchased from Novocastra (Newcastle-upon-Tyne, UK). Rabbit polyclonal antisera
to residues 1–317 of human I-κBα was purchased from Santa Cruz Biotechnology Inc.,
CA, USA. Peroxidase-conjugated rabbit antimouse antibody was purchased from Dako Ltd,
Cambridge, UK and peroxidase-conjugated goat anti-rabbit antibody from Sigma Chemical
Co., Dorset, UK. 15(S)-HETE was purchased from Biomol Research Laboratories Inc.,
PA, USA. Oligonucleotides for EMSA, T4 polynucleotide kinase 10 × buffer and gel shift
binding buffer were from Santa Cruz Biotechnology Inc., CA, USA. SN50 was purchased
from Calbiochem, Nottingham, UK. Wizard™ mini or maxi preps, used to prepare plasmid
DNA from overnight cultures of bacterial clones, were obtained from Promega, UK (Southampton),
as were the T7 RNA polymerase kit, RNAsin inhibitor, reverse transcriptase, reverse
transcription buffer and PCR grade magnesium chloride. Taq polymerase and Hybond C
were from Amersham Biosciences, UK Ltd (Bucks, UK), TRI reagent for RNA isolation
was purchased from Sigma-Aldrich, Co-Ltd (Dorset, UK), while the oligonucleotide primers
were from MWG Biotech (Ebersberg, Germany). RNA storage buffer was purchased from
Ambion Ltd (Cambridgeshire, UK) and PCR buffer from Roche, Switzerland.
Cell culture
The C2C12 myoblast cell line was grown in DMEM supplemented with 10% FCS plus 1% penicillin
and streptomycin under an atmosphere of 10% CO2 in air at 37°C. Myotubes were formed
by allowing confluent cultures of myoblasts to fuse in DMEM containing 2% HS over
a 7-day period, with changes of medium every 2 days.
Measurement of total protein degradation
This was measured essentially as previously described for murine myoblasts (Lorite
et al, 2001). Myotubes were formed in six-well multidishes containing 2 ml DMEM and
2% HS. Cells were labelled for 24 h with L-[2,6-3H] phenylalanine (0.67 mCi mmole−1),
and washed three times in PBS. They were then incubated for 2 h in DMEM without phenol
red until no more radioactivity appeared in the supernatant, and then for a further
24 h period with various concentrations of 15(S)-HETE in fresh DMEM without phenol
red to reduce quenching of counts, and in the presence of 2 mM cold phenylalanine
to prevent reincorporation of radioactivity. The amount of radioactivity released
into the medium was determined using a 2000CA Tri-Carb liquid scintillation analyzer
and is expressed as a percentage of control cultures determined from myotubes incubated
with the [3H]phenylalanine for 24 h, but not treated.
Measurement of proteasome activity
The functional activity of the β-subunits of the proteasome was determined as the
‘chymotrypsin-like’ enzyme activity determined fluorimetrically according to the method
of Orino et al, (1991). Cells were sonicated in 20 mM Tris-HCl, pH 7.5, 2 mM ATP,
5 mM MgCl2 and 1 mM dithiothreitol (DTT) at 4°C and enzyme activity was determined
on the supernatant fraction, formed by centrifugation for 10 min at 18 000 g, using
the fluorogenic substrate succinyl-LLVY-AMC (0.1 mM) in the presence or absence of
10 μ
M lactacystin, a specific proteasome inhibitor (Fenting and Schreiber 1998). Only
lactacystin suppressible activity was considered to be proteasome specific. The reaction
was terminated by the addition of 80 mM sodium acetate, pH 4.3, and the fluorescence
determined with an excitation wavelength of 360 nm and an emission wavelength of 460 nm.
The activity was adjusted for the protein concentration of the sample, determined
using the Bradford assay (Sigma Chemical Co., Dorset, UK). Both substrate and enzyme
concentrations were optimal and the results were similar to those obtained using purified
proteasomes (Lorite et al, 2001).
Western blot analysis
Myotubes were treated with various concentrations of 15(S)-HETE, with or without 2 h
preincubation with 50 μ
M EPA. The medium was removed and the cells were washed with PBS, followed by scraping
from the plastic surface and sonication in 500–2000 μl of the buffer used to measure
proteasome activity. After centrifugation (18 000 g for 5 min), the supernatant was
assayed for protein concentration using a colourimetric protein assay (Biorad, UK).
Samples of cytosolic protein (2.5 μg) were resolved on 12% sodium dodecylsulphate,
polyacrylamide gels (SDS/PAGE) and transferred to 0.45 μm nitrocellulose membranes
(Hybond A, Amersham, UK), which had been blocked with 5% Marvel in Tris-buffered saline,
pH 7.5, at 4°C overnight. The primary antibodies were used at a 1 : 1500 dilution,
except for myosin heavy chain used at 1 : 250 dilution and I-κBα at 1 : 400. The secondary
antibodies were used at a 1 : 2000 dilution. Incubation was for 1 h at room temperature
and development was by enhanced chemiluminescence (ECL) (Amersham, UK). Blots were
scanned by a densitometer to quantitate differences, and a parallel gel was silver
stained to ensure equal loading.
Quantitative competitive RT–PCR
Total RNA was extracted from muscle using TRI-reagent and the RNA concentration was
determined from the absorbance at 260 nm. To quantitate the mRNA of interest, increasing
amounts of competitor RNA, which differed from the mRNA of interest by containing
a short deletion, were added to 250 ng of total RNA and coamplified using RT–PCR.
The amount of specific mRNA was calculated from the amount of competitor, when equal
amounts of PCR product were obtained from the competitor and target RNA, as previously
described (Wang et al, 1989; Taylor et al, 1998).
The C2 competitor was obtained from the mouse gene using the primer pairs: 5′CGCACGGAGTGCTGGTTGCAC3′
and 5′GTACGA GCTGATTGAGAACGG–CATAACCAGCAATGAGCAGCC3′ at positions 176–187 and 531–552 bp
to 435–455 bp, respectively, which produced a DNA fragment containing a 76-bp deletion.
The C5 competitor was obtained from the mouse gene using the primer pairs: 5′TCAACGGAGGTACTGTATTGG3′
and 5′GCATGGCACTT GCTGAGCC–GCATGGCACTTGCTGAGCC3′ at positions 101–121 and 496 to 514 bp
to 358–378 bp, respectively, producing a DNA fragment containing a 117-bp deletion.
The E214k competitor was obtained from the rat gene using the primer pairs: 5′CTCATGC
GGGATTTCAAGCG3′ and 5′CTCTTCTCATACTCCCGTTTGCAT–CGGTTCTGCAGGATGTC3′ at positions 68–87
and 443–468 bp to 312–321 bp, respectively, producing a DNA fragment containing a
111-bp deletion. The competitor DNAs were blunt ended and then ligated into a pET30a
vector, which had been blunt-end cut with Smal restriction enzyme. The ligated vector
was used to transform DH5α competent cells. Plasmid DNA was prepared from PCR-positive
clones using Wizard-mini-prep. Competitor RNA was produced using T7 RNA polymerase
kit, and quantitated using the optical density at 260 nm. Six serial two-fold dilutions
were prepared containing known concentrations of competitor. The particular dilutions
used were selected to span the selected concentration of C2, C5 and E214k in the sample.
To synthesise the cDNA template, a mixture consisting of 250 ng target RNA, the particular
dilution of the competitor RNA and 0.5 μg of random hexamer was incubated at 70°C
for 5 min in a thermal cycler (Genetic Research, Instrumentation Ltd, Essex, UK) and
then chilled on ice before the addition of 2.5 μl 5 × reverse transcription buffer,
3 μl of 10 mM each at dATP, dGTP, dCTP, dTTP, 5 U of RNAsin inhibitor and 1 U reverse
transcriptase in a total volume of 12.5 μl. Incubation was at 37°C for 1 h. For the
amplification of the cDNA by PCR, 50 μl of PCR mix was added to each tube. The PCR
mixture contained 1 × PCR buffer (without magnesium) together with 3 mM MgC12 (E2),
3.5 mM MgCl2 (C5) and 2.5 mM MgCl2 (C2) together with 1 U Taq polymerase. For the
E2 gene, 10 pmol of each of the primers 5′CTCATGCGGGA TTTCAAGCG3′ and 5′CTCTTCTCATACTCCCGTTTG3′
were used, while for the C5 gene 10 pmol of each of the primers 5′TCAAC GGAGGTACTGTATTGG3′
and 5′GCATGGCACTTGCTGAGCC 3′ were used. For the C2 gene, 20 pmol of each of the primers
5′CGCA CGCAGTGCTGGTTGCAC3′ and 5′GTACGAGCTGATTGAGAAC GG3′ were used. The temperature-cycling
profile for amplification was as follows: 95°C for 2 min for one cycle followed by
95°C for 30 s, 58°C annealing for 1 min and 72°C extension for 1 min for 30 cycles.
Control reactions containing all components except reverse transcriptase and another
without template were carried out alongside each experiment to show that the RNA (both
target and competitor) had no DNA contamination, while the second control showed that
there was no contamination in the PCR mixture. Coamplification of E2 target and competitor
produced DNA fragments of 395 and 284 bp, respectively; C2 target and competitor produced
385 and 309 bp fragments and C5 target and competitor produced 414 and 297 bp fragments,
respectively.
For analysis of results, 15 μl of PCR products were separated on a 2% (w v−1) agarose
gel containing ethidium bromide. The gel images were visualised on a UV transilluminator
and photographed. The intensity of the bands were quantitated using a Phoretix photo-imager
programme. The volumes of the competitor and target bands were plotted against the
known serial dilutions of the competitor used in the experiment. The amount of the
sample RNA corresponds to the amount of competitor when the ratio of competitor to
target is 1.0. A representative gel showing competitor and target RNA, as well as
a dose–response curve is shown in Figure 1
Figure 1
(A) Representative gel illustrating quantitative competitive RT–PCR for C5 mRNA in
control cultures at 4 h incubation. Lanes: M; 100-bp DNA ladder: RT-ve; without reverse
transcriptase, PCR-ve: without template. Lanes 1–5 each contain 0.25 μg target RNA
and a specific amount of the C5 competitor RNA ranging from 0.01875 to 0.3 ng in two-fold
dilutions. (B) Dose–response curve from the gel shown in (A). ▪, target volume; ▴,
competitor volume. The amount of unknown determined from where the two lines intersect=0.0445 ng
mRNA.
.
Preparation of nuclear proteins
Cell monolayers were rinsed, scraped and pelleted in 10 mM HEPES, pH 7.5, 10 mM KCl,
2 mM MgCl2, 1 mM DTT, 0.1 mM EDTA, 0.4 mM PMSF, 0.2 mM NaF, 0.2 mM sodium orthovanadate
and 0.3 mg ml−1 leupeptin. The pellets were resuspended in 300 μl of the same wash
buffer and incubated on ice for 15 min. Lysis was achieved by the addition of 30 μl
of 1% Triton X-100, followed by vortexing, and nuclei were pelleted by a 30 s centrifugation
at 14 000 r.p.m., and the supernatant was thoroughly removed. The nuclear pellet was
resuspended in 50 μl ice-cold lysis buffer (50 mM HEPES, pH 7.8, 50 mM KCl, 0.3 M
NaCl, 0.1 mM EDTA and 1 mM DTT) and the suspension was kept on ice for 20 min with
a 30 s vortex every 3–5 min. Centrifugation at 14 000 r.p.m. for 5 min yielded the
supernatant containing the protein extract.
Electrophoretic mobility shift assay
The transcription factor consensus oligonucleotides for the NF-KB-responsive element
(5′AGT TGA GGG GAC TTT CCC AGG C3′) was purchased from Promega (Southampton, UK).
The probes were labelled with [γ-32P]ATP by using T4 polynucleotide kinase (Promega)
for 10 min at 37°C. For the binding reaction, nuclear extract (10 μg protein) was
incubated in a 10 μl volume with 2 μl EMSA binding buffer (20% glycerol; 5 mM MgCl2;
250 mM NaCl; 2.5 mM EDTA; 2.5 mM DTT; 50 mM Tris-HCl, pH 7.5 and 0.25 mg ml−1 poly
(dI-dC)-poly (dI-dC) and 1 μl γ-32P-labelled probe for 20 min at room temperature
following a 10 min preincubation in the absence of the labelled probe. The specificity
of the binding reaction was determined by coincubating duplicate samples with unlabelled
probes. A negative control reaction was also included which contained everything except
sample. Protein–nucleic acid complexes were resolved using an 8% nondenaturing polyacrylamide
gel and a native 5% polyacrylamide stacking gel in 25 mM Tris, pH glycine for 30 min
at 150 mV. Gels were dried between Whatman 3 M filter paper (Whatman Inc., Clifton,
NJ, USA), dried under vacuum at 80°C for 1 h and exposed to ‘Hyperfilm MP’ (Amersham
Pharmacia Biotech) for 48 h at −70°C.
Statistical analysis
Results are presented as mean±s.e.m. Differences were determined by one-way ANOVA,
followed by Tukey's test.
RESULTS
The effect of 15(S)-HETE on total protein degradation in C2C12 myotubes, as measured
by [3H]phenylalanine release, is shown in Figure 2A
Figure 2
(A) Effect of 15(S)-HETE on total protein degradation in C2C12 myotubes after incubation
for 24 h in cells either olive oil-treated (closed boxes) or pretreated for 2 h with
50 μ
M EPA (hatched boxes). Results are shown as mean±s.e.m. of one experiment where n=3,
and the experiment was repeated three times on different days with similar results.
Differences from controls in the absence of 15(S)-HETE are indicated as (a) P<0.05,
(b) P<0.01 or (c) P<0.001, while differences in the presence of EPA from those in
the absence are indicated as (d) P<0.05, (e) P<0.01 and (f) P<0.001. (B) The effect
of 15(S)-HETE on the proteasome ‘chymotrypsin-like’ enzyme activity in C2C12 myotubes
either alone (⧫) or after pretreatment with 50 μ
M EPA (□). Results are shown as mean±s.e.m. where n=3 and the experiment was repeated
three times with similar results. Differences from controls in the absence of 15(S)-HETE
are indicated as (a) P<0.05 and (b) P<0.01, while differences in the presence of EPA
are indicated as (c) P<0.01 and (d) P<0.001.
. The concentrations of 15(S)-HETE chosen were based on those produced by PIF in murine
myoblasts (Smith et al, 1999). In this study PIF increased 15-HETE production from
25 to 70 nmol per 5 × 106 cells per 2 h, that is, an increase of 9 nmol per 106 cells.
If all the 15-HETE entered the cells in the current experiments, this would give a
value between 1.4 and 6 nmol per 106 cells. As previously reported in C2C12 myoblasts,
15(S)-HETE produced a significant increase in [3H]phenylalanine release with a bell-shaped
dose–response curve, although the concentrations producing maximal protein catabolism
(78–156 nM) were higher than required in myoblasts (Smith et al, 1999). A similar
dose–response curve is observed with PIF (Smith et al, 1999), and with protein breakdown
in muscle of tumour-bearing animals (DeBlaauw et al, 1997), and may result from downregulation
of receptors, or receptor desensitisation as occurs in the stimulation of lipolysis
by isoprenaline. The effect was attenuated down to control values in the presence
of 50 μ
M EPA at all concentrations of 15(S)-HETE (Figure 2A), as well as the highly specific
and irreversible proteasome inhibitor, lactacystin (data not shown), suggesting that
the action of 15(S)-HETE may be mediated through the ubiquitin–proteasome proteolytic
pathway. This concentration of EPA has been previously shown to attenuate PIF-induced
protein catabolism in murine myoblasts (Smith et al, 1999). Lower concentrations of
EPA had no effect. The plasma concentration of EPA in humans consuming large doses
would be in the range 100–200 μ
M. To determine if proteasome proteolytic activity was also increased by 15(S)-HETE,
the ‘chymotrypsin-like’ enzyme activity, the predominant proteolytic activity of the
proteasome, was determined using the fluorogenic substrate Suc LLVY-MCA. The results
presented in Figure 2B show that 15(S)-HETE induced upregulation of the ‘chymotrypsin-like’
activity of the proteasome, with maximal effect in the concentration range 78–312 nM,
as for total protein catabolism (Figure 2A). As with protein catabolism, proteasome
proteolytic activity was attenuated in cells pretreated with 50 μ
M EPA.
To determine whether the increased proteasome proteolytic activity arose from an increased
gene expression mRNA levels of proteasome subunits C2(α) and C5(β), as well as the
ubiquitin-conjugating enzyme, E214k, were determined in C2C12 myotubes exposed to
various concentrations of 15(S)-HETE for various times to determine the earliest time
of gene induction and how long this persisted, using quantitative competitive RT–PCR
(Figure 3
Figure 3
Effect of treatment of C2C12 myotubes with 15(S)-HETE for 4 h on expression of mRNA
for (A) C2 proteasome subunit, (B) C5 proteasome subunit, (C) E214k, as determined
by quantitative competitive RT–PCR. Results represent mean±s.e.m. from three separate
determinations performed on different occasions with different samples. Differences
are indicated as (a) P<0.05, (b) P<0.01 and (c) P<0.001 from cells treated with 0 nM
15(S)-HETE.
). Expression of the mRNA for the 20S proteasome subunits C2 (Figure 3A) and C5 (Figure
3B) was significantly increased with 15(S)-HETE concentrations in the range 78–312 nM
after 4 h, as for protein catabolism with a similar bell-shaped dose–response curve.
The level of expression of mRNA for C5 was approximately 2000-fold greater than for
C2. Expression of mRNA for E214k was also significantly increased 4 h after treatment
with 15(S)-HETE (Figure 3C), although the concentration range was somewhat broader
than for proteasome subunits (78–780 nM). The extent of induction of C2, C5 and E214k
by 15(S)-HETE at 2 h (Figure 5
Figure 5
Effect of treatment of C2C12 myotubes with 15(S)-HETE for 2 h on expression of mRNA
for (A) C2 proteasome subunit, (B) C5 proteasome subunit. Results represent mean±s.e.m.
for three separate determinations on different samples. Differences from control are
indicated as (a) P<0.05 and (b) P<0.001.
) was less than that observed at 4 h. The increased expression of proteasome subunits
in the presence of 15(S)-HETE was attenuated by prior treatment with EPA (Figure 4
Figure 4
Effect of 15(S)-HETE on the expression of mRNA for the C5 proteasome subunit in C2C12
myotubes in the absence (solid boxes) and presence (open boxes) of 50 μ
M EPA. Results represent mean±s.e.m. from two separate determinations performed on
different occasions with different samples. Where there was no differences between
individual measurements no standard error is shown. Differences from control are indicated
as (b) P<0.01 and (c) P<0.001 as determined by Student's t-test.
). There was also evidence for an increased expression of mRNA for both C2 (Figure
6A
Figure 6
Effect of treatment of C2C12 myotubes with 15(S)-HETE for 24 h on expression of mRNA
for (A) C2 proteasome subunit, (B) C5 proteasome subunit, as determined by quantitative
competitive RT–PCR. Results represent mean±s.e.m., where n=3 representing three separate
determinations on different samples. Differences from control are indicated as (b)
P<0.01 and (c) P<0.001.
) and C5 (Figure 6B) proteasome subunits after 24 h. As with studies on PIF (Gomes-Marcondes
et al, 2002), higher concentrations of 15(S)-HETE produced increases in proteasome
mRNA expression at 24 h than at 4 h (Figure 3).
To determine whether increased mRNA expression for proteasome subunits C2 and C5 was
reflected in higher protein levels of other subunits, cellular supernatants of C2C12
myotubes treated with 15(S)-HETE for 24 h were immunoblotted for p42, an ATPase subunit
of the 19S regulator that promotes ATP-dependent association of the 20S proteasome
with the 19S regulator to form the 26S proteasome (Tanahashi et al, 1999) (Figure
7A
Figure 7
Western blots of soluble extracts of C2C12 myotubes treated with 0 (lane 1), 156 nm
(lane 2), 234 nm (lane 3), 312 nm (lane 4), 480 nm (lane 5), 630 nm (lane 6), 780 nm
(lane 7) and 1560 nM 15(S)-HETE, (lane 8) for 24 h on expression of p42 subunit of
19S regulatory subunit (A), myosin (B) and actin control (C). Blots were developed
with the respective antibodies as described in Materials and methods, and are representative
of three separate determinations on different samples. Average densitometric data
are presented under the blots.
). Maximal expression was seen at concentrations of 15(S)-HETE between 156 and 312 nM,
which is in the range where an increased proteasome mRNA expression was seen (Figure
3). Activation of proteasome expression was associated with a decrease in myosin expression
in the same concentration range (78–312 nM) (Figure 7B). These results suggest that
15(S)-HETE leads to an increased expression of the ubiquitin–proteasome pathway, with
an increase in overall protein degradation and depletion of myofibrillar pro teins.
The NF-κB transcriptional pathway was investigated as a possible mediator of the increased
expression of the ubiquitin–proteasome pathway, since NF-κB has been shown to be an
essential mediator of TNF-α-induced protein catabolism in differentiated muscle cells
(Li and Reid, 2000). As shown in Figure 8A
Figure 8
(A) Activation of NF-κB binding to DNA as demonstrated by EMSA. Nuclear extracts of
C2C12 myotubes treated with 0 nm (lane 1), 31 nm (lane 2), 156 nm (lane 3), 234 nm
(lane 4) or 312 nM 15(S)-HETE (lane 5) for 30 min were compared with cells treated
with 0 nm (lane 6), 31 nm (lane 7), 156 nm (lane 8), 234 nm (lane 9) or 156 nM 15(S)-HETE
(lane 10) pretreated with 50 μ
M EPA for 2 h. The gel shown is a representative example of three separate determinations
and the average densitometric data are presented below the blot. (B) Western blot
of I-κBα levels in cytoplasmic extracts of myotubes treated with 0 nm (lane 1), 3.1 nm
(lane 2), 15.6 nm (lane 3), 31 nm (lane 4), 156 nm (lane 5) and 312 nM 15(S)-HETE
(lane 6) for 30 min or after pretreatment for 2 h with EPA (50 μ
M) and treated with 0 nm (lane 7), 3.1 nm (lane 8), 15.6 nm (lane 9), 31 nm (lane
10), 156 nm (lane 11) and 312 nM 15(S)-HETE (lane 12). Detection was by rabbit polyclonal
antisera to residues 1–317 of human I-κBα. The blot shown is representative of three
separate determinations and the average densitometric data are provided below the
blot. (C) The effect of the NF-κB inhibitor peptide SN50 on 15(S)-HETE induced upregulation
of the ‘chymotrypsin-like’ activity of the proteasome. Myotubes were treated with
the cell-permeable NF-κB inhibitor peptide, SN50 (18 μ
M) for 20 min prior to the addition of 15(S)-HETE. The activity shown represents the
lactacystin (10 μ
M) suppressible proteolytic activity. Differences are indicated as (a) P<0.05 and
(b) P<0.01 from those in the absence of 15(S)-HETE and (c) P<0.01 and (d) P<0.001
from those in the absence of SN50.
, 15(S)-HETE induced elevated levels of NF-κB DNA binding activity in the myotube
nucleus, after a 30 min incubation, with a maximal effect between 156 and 234 nM.
Increased nuclear accumulation of NF-κB was not seen after pretreatment with EPA.
Depletion of I-κBα from the cytosol was determined by immunoblotting of cytoplasmic
extracts from the same cells in which NF-κB translocation was measured. Rapid breakdown
of I-κBα was evident 30 min after treatment with 156 nM 15(S)-HETE (Figure 8B), and
this was not seen in cultures pretreated with 50 μ
M EPA, suggesting a mechanism by which EPA could downregulate the increased proteasome
expression seen in the presence of 15(S)-HETE. The NF-κB inhibitor peptide, SN50 (Lin
et al, 1995) attenuated the increased chymotrypsin-like enzyme activity in the presence
of 15(S)-HETE (Figure 8C), suggesting the NF-κB may be involved in transcriptional
activation induced by 15(S)-HETE.
DISCUSSION
There are three main pathways for the intracellular catabolism of proteins in skeletal
muscle; lysosomal proteases, a nonlysosomal calcium-activated process involving the
cysteine proteases calpains I and II and the ubiquitin–proteasome proteolytic pathway.
Of the three, the latter is considered to be most important (Lecker et al, 1999),
since the former two processes contribute less than 15–20% of total protein breakdown
and do not catabolise myofibrillar proteins (Lowell et al, 1986). In cancer cachexia,
where there is extensive and specific loss of skeletal muscle, tissue levels of mRNA
for ubiquitin, 20S proteasome α and β subunits and the ubiquitin-conjugating enzyme,
E214k, have been found to be increased in mouse (Lorite et al, 1998), rat (Temparis
et al, 1994) and humans (Williams et al, 1999). Knowledge of the mechanism of this
increased gene transcription is important for the design of therapeutic agents, because
muscle wastage leads to weakness, fatigue and eventually death through impairment
of respiratory muscle function (Windsor and Hill, 1998).
Previous studies on protein degradation, induced by PIF in vitro, suggested 15(S)-HETE
as a possible intracellular signal responsible for the increased transcription of
the genes of the ubiquitin–proteasome proteolytic pathway (Smith et al, 1999). This
suggestion is supported by recent observations (Whitehouse et al, 2001) showing that
EPA, an inhibitor of 15(S)-HETE, produced in response to PIF, attenuated the development
of muscle catabolism in the MAC16 murine cachexia model by downregulation of the increased
expression of proteasome α-subunits and chymotrypsin-like enzyme activity. In addition,
we have recently found (Whitehouse and Tisdale, 2001) that both EPA and a 12/15-lipoxygenase
inhibitor, CV-6504, were also effective in attenuating protein degradation in acute
starvation mediated through the ubiquitin–proteasome pathway. This suggests that in
both models of muscle wasting the same intracellular-mediator is involved, possibly
15(S)-HETE. The aim of the present study has been to determine whether 15(S)-HETE
alone is capable of upregulation of the key enzymes of the ubiquitin–proteasome pathway
using C2C12 myotubes.
Using this in vitro system, 15(S)-HETE has been shown to induce total protein degradation
at concentrations between 78 and 312 nM, with a bell-shaped dose–response curve similar
to that previously reported in C2C12 myoblasts (Smith et al, 1999), although the concentration
to produce a maximal effect was higher in myotubes. Since the effect of PIF on protein
catabolism in myotubes has been shown to be mediated through an upregulation of the
ubiquitin–proteasome proteolytic pathway (Gomes-Marcondes et al, 2002), if 15(S)-HETE
was acting as an intracellular transducer of PIF action then the effect on protein
degradation would also be mediated by this pathway. Accordingly 15(S)-HETE was shown
to increase the ‘chymotrypsin-like’ enzyme activity of the β subunits of the proteasome,
suggested to be the rate-determining step in protein catabolism (Chen and Hochstrasser,
1996; Rock et al, 1994), in the same concentration range as that stimulating total
protein degradation. Further confirmation that 15(S)-HETE stimulated expression of
the rate-limiting components of the ubiquitin–proteasome pathway was provided by an
increased mRNA level for proteasome subunits C2 and C5, as well as E214k, and increased
protein levels of proteasome subunit, p42, over the same concentration range as that
inducing total protein degradation. Previous studies have reported increased proteasome
subunits (Temparis et al, 1994; Lorite et al, 1998) MSS1 (Combaret et al, 1999) and
E214k with increased muscle catabolism in cancer cachexia, suggesting that they play
important roles in protein degradation. Indeed, cellular levels of the myofibrilar
protein, myosin, were reduced in myotubes treated with 15(S)-HETE over the same concentration
range as that inducing the regulatory components of the ubiquitin–proteasome proteolytic
pathway.
We have suggested (Whitehouse et al, 2001) that EPA attenuates protein degradation
and the increased expression of the key regulatory components of the ubiquitin–proteasome
pathway as a result of the inhibition of 15(S)-HETE production through the PIF-induced
activation of phospholipase A2 and arachidonate release (Smith et al, 1999). It was
therefore surprising that EPA was able to attenuate protein degradation and the increase
in proteasome expression induced by 15(S)-HETE. This suggests that EPA also affects
a downstream pathway involved in induction of proteasome expression by 15(S)-HETE,
possibly a nuclear transcription factor, since Ross et al (1999) have shown that in
the pancreatic cancer cell line, MiaPaCa 2, exposed to EPA for 2 h prior to a pulse
of TNF-α, I-κBα was preserved, suggesting an effect of EPA in stabilising the NF-κB
complex in the cytoplasm.
Watchorn et al (2001) have shown PIF to activate both the transcription factors NF-κB
and STAT3 in hepatic cells. Li et al (1998) showed that TNF-α stimulated protein loss
in C2C12 myotubes involved the ubiquitin–proteasome proteolytic pathway and was accompanied
by nuclear translocation of NF-κB to its targeted DNA sequence by stimulating phosphorylation,
ubiquitin conjugation and proteolysis of I-κBα. Total protein content and myosin heavy
chain levels in C2C12 myotubes were found to be unaltered in cells transfected with
viral plasmid constructs that overexpress mutant I-κBα proteins that are insensitive
to degradation by the ubiquitin–proteasome pathway (Li and Reid, 2000). These data
suggest that NF-κB is an essential mediator of TNF-α-induced protein catabolism in
differentiated muscle cells. However, Du et al (2000) found that NF-κB is a repressor
of C3 proteasome subunit transcription in muscle cells and that glucocorticoids stimulate
C3 proteasome subunit expression by opposing this suppressor action. This mechanism
is surprising, since NF-κB normally acts as a transcriptional activator, and the present
study provides some evidence that NF-κB may be involved in the increase in transcription
of the regulatory components of the ubiquitin–proteasome pathway induced by 15(S)-HETE.
Thus, 15(S)-HETE induced elevated levels of NF-κB binding activity in the nucleus
of C2C12 myotubes with a corresponding decrease in cytosolic I-κBα. The effect was
not seen in myotubes pretreated with EPA, providing a role for EPA in the attenuation
of downstream signalling induced by 15(S)-HETE. The concentrations of 15(S)-HETE affecting
the NF-κB/I-κBα system were the same as those increasing protein degradation and stimulating
increased expression of the key regulatory components of the ubiquitin–proteasome
pathway. Moreover, the NF-κB inhibitor peptide SN50 (Lin et al, 1995) attenuated the
increased proteasome chymotryptic activity in the presence of 15(S)-HETE. These results
suggests that 15(S)-HETE may induce gene expression through the transcription factor
NF-κB.
The mechanism by which 15(S)-HETE could activate NF-κB is not known. One possibility
is that as 15(S)-HETE is oxidised it could result in the generation of reactive oxygen
species, which might regulate the redox sensitive NF-κB, possibly through oxidation
of constituent proteins, which could augment DNA-binding activity or promote the release
from, or degradation of I-κB. Mild oxidative stress has been shown to induce 20S proteasome
subunits and E214k in murine myotubes (Gomes-Marcondes and Tisdale, 2002). However,
it is not clear why 5- and 12-HETE would not have the same properties as 15-HETE if
this were the mechanism. Further studies are required to determine the role of transcription
factors and cellular signalling pathways in the action of 15(S)-HETE.