31
views
0
recommends
+1 Recommend
0 collections
    0
    shares
      • Record: found
      • Abstract: found
      • Article: not found

      Induction of protein catabolism in myotubes by 15( S)-hydroxyeicosatetraenoic acid through increased expression of the ubiquitin–proteasome pathway

      research-article

      Read this article at

      ScienceOpenPublisherPMC
      Bookmark
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          Proteolysis through the ubiquitin–proteasome pathway has an important role in the regulation of the cell cycle and division, differentiation and development, as well as a variety of other basic cellular processes (Ciechanover et al, 2000). In addition, this pathway plays an important role in the wasting of skeletal muscle seen in a range of catabolic processes, including starvation, sepsis, metabolic acidosis, weightlessness, severe trauma, denervation atrophy and cancer cachexia (Lecker et al, 1999). In this process, proteins are degraded into peptides within the 20S proteasome, a cylindrical structure of four stacked rings, each composed of seven subunits surrounding a central cavity. The inner β rings contain proteolytic enzymes, while the two outer α rings surround a small cavity through which protein substrates must enter. Cellular proteins are marked for degradation by attachment of a polyubiquitin chain. While the ubiquitin-conjugating enzyme (E214k) was suggested to be the rate-limiting step in the pathway in starvation (Wing and Banville, 1994), it has recently been shown that E214k knockout is not associated with decreased protein catabolism (Adegoke et al, 2002). Instead, ubiquitin-protein ligases (E3) may play a more important role in muscle atrophy and E3 knockout is clearly associated with increased protein catabolism (Bodine et al, 2001; Gomes et al, 2001). Despite the importance of the ubiquitin–proteasome pathway, there is little information on intracellular signals leading to an increased gene transcription of the rate-limiting enzymes. It has been suggested that glucocorticoids and a low insulin level in tandem activate the ubiquitin–proteasome proteolytic system (Mitch et al, 1999). Glucocorticoids increase protein catabolism by opposing the suppression of the transcription of the proteasome C3 α-subunit by nuclear factor-κB (NF-κB), by antagonising the interaction of NF-κB with an NF-κB response element in the C3 subunit promoter region (Du et al, 2000). Also physiological levels of glucocorticoids are necessary, but not sufficient for the catabolic response in rats with metabolic acidosis (Price et al, 1994), starvation (Wing and Goldberg, 1993) and sepsis (Tiao et al, 1996). However, chronic excessive glucocorticoid production, as occurs in Cushing's syndrome is not associated with an increased mRNA for ubiquitin, the ubiquitin-conjugating enzyme, E214k, or proteasome subunits (Ralliere et al, 1997), suggesting that other factors may be involved. We have isolated a sulphated glycoprotein of Mr 24 000 produced by cachexia-inducing murine and human tumours (Todorov et al, 1996), which induces proteolysis directly in isolated skeletal muscle (Lorite et al, 1997) and in C2C12 murine myoblasts in the absence of glucocorticoids (Smith et al, 1999). This factor, named proteolysis-inducing factor (PIF), induces release of arachidonic acid from muscle cells with an increased production of prostaglandin (PG) E2 and F2α together with metabolism through the lipoxygenase pathways to 5-, 12-, and 15-hydroxyeicosatetraenoic acids (HETEs) (Smith et al, 1999). Release of arachidonic acid and its subsequent metabolism was shown to be directly related to the induction of protein catabolism, since it was completely attenuated in the presence of eicosapentaenoic acid (EPA), which also completely inhibited protein degradation induced by PIF. Of the metabolites of arachidonate only 15(S)-HETE produced a significant increase in protein degradation alone, suggesting that it acts as an intracellular signal for the action of PIF. Since PIF has been shown to upregulate the ubiquitin–proteasome pathway (Lorite et al, 1998), this suggests that 15(S)-HETE should also induce the key regulatory components of this pathway. This study utilizes an in vitro model of skeletal muscle (C2C12 myotubes) to investigate the effect of 15(S)-HETE on protein degradation and protein and mRNA levels of the key enzymes of the ubiquitin–proteasome pathway, as well as the involvement of potential transcription factors. MATERIALS AND METHODS Materials L-[2,6-3H]Phenylalanine (sp. act. 2.00 TBq mmol−1) was purchased from Amersham International (Bucks, UK). Foetal calf serum (FCS), horse serum (HS) and Dulbecco's modified Eagle's medium (DMEM) were purchased from Life Technologies (Paisley, Scotland). Mouse anti-p42 antibody was a gift from Dr Jane Arnold, UK. Mouse monoclonal antibody to myosin heavy chain was purchased from Novocastra (Newcastle-upon-Tyne, UK). Rabbit polyclonal antisera to residues 1–317 of human I-κBα was purchased from Santa Cruz Biotechnology Inc., CA, USA. Peroxidase-conjugated rabbit antimouse antibody was purchased from Dako Ltd, Cambridge, UK and peroxidase-conjugated goat anti-rabbit antibody from Sigma Chemical Co., Dorset, UK. 15(S)-HETE was purchased from Biomol Research Laboratories Inc., PA, USA. Oligonucleotides for EMSA, T4 polynucleotide kinase 10 × buffer and gel shift binding buffer were from Santa Cruz Biotechnology Inc., CA, USA. SN50 was purchased from Calbiochem, Nottingham, UK. Wizard™ mini or maxi preps, used to prepare plasmid DNA from overnight cultures of bacterial clones, were obtained from Promega, UK (Southampton), as were the T7 RNA polymerase kit, RNAsin inhibitor, reverse transcriptase, reverse transcription buffer and PCR grade magnesium chloride. Taq polymerase and Hybond C were from Amersham Biosciences, UK Ltd (Bucks, UK), TRI reagent for RNA isolation was purchased from Sigma-Aldrich, Co-Ltd (Dorset, UK), while the oligonucleotide primers were from MWG Biotech (Ebersberg, Germany). RNA storage buffer was purchased from Ambion Ltd (Cambridgeshire, UK) and PCR buffer from Roche, Switzerland. Cell culture The C2C12 myoblast cell line was grown in DMEM supplemented with 10% FCS plus 1% penicillin and streptomycin under an atmosphere of 10% CO2 in air at 37°C. Myotubes were formed by allowing confluent cultures of myoblasts to fuse in DMEM containing 2% HS over a 7-day period, with changes of medium every 2 days. Measurement of total protein degradation This was measured essentially as previously described for murine myoblasts (Lorite et al, 2001). Myotubes were formed in six-well multidishes containing 2 ml DMEM and 2% HS. Cells were labelled for 24 h with L-[2,6-3H] phenylalanine (0.67 mCi mmole−1), and washed three times in PBS. They were then incubated for 2 h in DMEM without phenol red until no more radioactivity appeared in the supernatant, and then for a further 24 h period with various concentrations of 15(S)-HETE in fresh DMEM without phenol red to reduce quenching of counts, and in the presence of 2 mM cold phenylalanine to prevent reincorporation of radioactivity. The amount of radioactivity released into the medium was determined using a 2000CA Tri-Carb liquid scintillation analyzer and is expressed as a percentage of control cultures determined from myotubes incubated with the [3H]phenylalanine for 24 h, but not treated. Measurement of proteasome activity The functional activity of the β-subunits of the proteasome was determined as the ‘chymotrypsin-like’ enzyme activity determined fluorimetrically according to the method of Orino et al, (1991). Cells were sonicated in 20 mM Tris-HCl, pH 7.5, 2 mM ATP, 5 mM MgCl2 and 1 mM dithiothreitol (DTT) at 4°C and enzyme activity was determined on the supernatant fraction, formed by centrifugation for 10 min at 18 000 g, using the fluorogenic substrate succinyl-LLVY-AMC (0.1 mM) in the presence or absence of 10 μ M lactacystin, a specific proteasome inhibitor (Fenting and Schreiber 1998). Only lactacystin suppressible activity was considered to be proteasome specific. The reaction was terminated by the addition of 80 mM sodium acetate, pH 4.3, and the fluorescence determined with an excitation wavelength of 360 nm and an emission wavelength of 460 nm. The activity was adjusted for the protein concentration of the sample, determined using the Bradford assay (Sigma Chemical Co., Dorset, UK). Both substrate and enzyme concentrations were optimal and the results were similar to those obtained using purified proteasomes (Lorite et al, 2001). Western blot analysis Myotubes were treated with various concentrations of 15(S)-HETE, with or without 2 h preincubation with 50 μ M EPA. The medium was removed and the cells were washed with PBS, followed by scraping from the plastic surface and sonication in 500–2000 μl of the buffer used to measure proteasome activity. After centrifugation (18 000 g for 5 min), the supernatant was assayed for protein concentration using a colourimetric protein assay (Biorad, UK). Samples of cytosolic protein (2.5 μg) were resolved on 12% sodium dodecylsulphate, polyacrylamide gels (SDS/PAGE) and transferred to 0.45 μm nitrocellulose membranes (Hybond A, Amersham, UK), which had been blocked with 5% Marvel in Tris-buffered saline, pH 7.5, at 4°C overnight. The primary antibodies were used at a 1 : 1500 dilution, except for myosin heavy chain used at 1 : 250 dilution and I-κBα at 1 : 400. The secondary antibodies were used at a 1 : 2000 dilution. Incubation was for 1 h at room temperature and development was by enhanced chemiluminescence (ECL) (Amersham, UK). Blots were scanned by a densitometer to quantitate differences, and a parallel gel was silver stained to ensure equal loading. Quantitative competitive RT–PCR Total RNA was extracted from muscle using TRI-reagent and the RNA concentration was determined from the absorbance at 260 nm. To quantitate the mRNA of interest, increasing amounts of competitor RNA, which differed from the mRNA of interest by containing a short deletion, were added to 250 ng of total RNA and coamplified using RT–PCR. The amount of specific mRNA was calculated from the amount of competitor, when equal amounts of PCR product were obtained from the competitor and target RNA, as previously described (Wang et al, 1989; Taylor et al, 1998). The C2 competitor was obtained from the mouse gene using the primer pairs: 5′CGCACGGAGTGCTGGTTGCAC3′ and 5′GTACGA GCTGATTGAGAACGG–CATAACCAGCAATGAGCAGCC3′ at positions 176–187 and 531–552 bp to 435–455 bp, respectively, which produced a DNA fragment containing a 76-bp deletion. The C5 competitor was obtained from the mouse gene using the primer pairs: 5′TCAACGGAGGTACTGTATTGG3′ and 5′GCATGGCACTT GCTGAGCC–GCATGGCACTTGCTGAGCC3′ at positions 101–121 and 496 to 514 bp to 358–378 bp, respectively, producing a DNA fragment containing a 117-bp deletion. The E214k competitor was obtained from the rat gene using the primer pairs: 5′CTCATGC GGGATTTCAAGCG3′ and 5′CTCTTCTCATACTCCCGTTTGCAT–CGGTTCTGCAGGATGTC3′ at positions 68–87 and 443–468 bp to 312–321 bp, respectively, producing a DNA fragment containing a 111-bp deletion. The competitor DNAs were blunt ended and then ligated into a pET30a vector, which had been blunt-end cut with Smal restriction enzyme. The ligated vector was used to transform DH5α competent cells. Plasmid DNA was prepared from PCR-positive clones using Wizard-mini-prep. Competitor RNA was produced using T7 RNA polymerase kit, and quantitated using the optical density at 260 nm. Six serial two-fold dilutions were prepared containing known concentrations of competitor. The particular dilutions used were selected to span the selected concentration of C2, C5 and E214k in the sample. To synthesise the cDNA template, a mixture consisting of 250 ng target RNA, the particular dilution of the competitor RNA and 0.5 μg of random hexamer was incubated at 70°C for 5 min in a thermal cycler (Genetic Research, Instrumentation Ltd, Essex, UK) and then chilled on ice before the addition of 2.5 μl 5 × reverse transcription buffer, 3 μl of 10 mM each at dATP, dGTP, dCTP, dTTP, 5 U of RNAsin inhibitor and 1 U reverse transcriptase in a total volume of 12.5 μl. Incubation was at 37°C for 1 h. For the amplification of the cDNA by PCR, 50 μl of PCR mix was added to each tube. The PCR mixture contained 1 × PCR buffer (without magnesium) together with 3 mM MgC12 (E2), 3.5 mM MgCl2 (C5) and 2.5 mM MgCl2 (C2) together with 1 U Taq polymerase. For the E2 gene, 10 pmol of each of the primers 5′CTCATGCGGGA TTTCAAGCG3′ and 5′CTCTTCTCATACTCCCGTTTG3′ were used, while for the C5 gene 10 pmol of each of the primers 5′TCAAC GGAGGTACTGTATTGG3′ and 5′GCATGGCACTTGCTGAGCC 3′ were used. For the C2 gene, 20 pmol of each of the primers 5′CGCA CGCAGTGCTGGTTGCAC3′ and 5′GTACGAGCTGATTGAGAAC GG3′ were used. The temperature-cycling profile for amplification was as follows: 95°C for 2 min for one cycle followed by 95°C for 30 s, 58°C annealing for 1 min and 72°C extension for 1 min for 30 cycles. Control reactions containing all components except reverse transcriptase and another without template were carried out alongside each experiment to show that the RNA (both target and competitor) had no DNA contamination, while the second control showed that there was no contamination in the PCR mixture. Coamplification of E2 target and competitor produced DNA fragments of 395 and 284 bp, respectively; C2 target and competitor produced 385 and 309 bp fragments and C5 target and competitor produced 414 and 297 bp fragments, respectively. For analysis of results, 15 μl of PCR products were separated on a 2% (w v−1) agarose gel containing ethidium bromide. The gel images were visualised on a UV transilluminator and photographed. The intensity of the bands were quantitated using a Phoretix photo-imager programme. The volumes of the competitor and target bands were plotted against the known serial dilutions of the competitor used in the experiment. The amount of the sample RNA corresponds to the amount of competitor when the ratio of competitor to target is 1.0. A representative gel showing competitor and target RNA, as well as a dose–response curve is shown in Figure 1 Figure 1 (A) Representative gel illustrating quantitative competitive RT–PCR for C5 mRNA in control cultures at 4 h incubation. Lanes: M; 100-bp DNA ladder: RT-ve; without reverse transcriptase, PCR-ve: without template. Lanes 1–5 each contain 0.25 μg target RNA and a specific amount of the C5 competitor RNA ranging from 0.01875 to 0.3 ng in two-fold dilutions. (B) Dose–response curve from the gel shown in (A). ▪, target volume; ▴, competitor volume. The amount of unknown determined from where the two lines intersect=0.0445 ng mRNA. . Preparation of nuclear proteins Cell monolayers were rinsed, scraped and pelleted in 10 mM HEPES, pH 7.5, 10 mM KCl, 2 mM MgCl2, 1 mM DTT, 0.1 mM EDTA, 0.4 mM PMSF, 0.2 mM NaF, 0.2 mM sodium orthovanadate and 0.3 mg ml−1 leupeptin. The pellets were resuspended in 300 μl of the same wash buffer and incubated on ice for 15 min. Lysis was achieved by the addition of 30 μl of 1% Triton X-100, followed by vortexing, and nuclei were pelleted by a 30 s centrifugation at 14 000 r.p.m., and the supernatant was thoroughly removed. The nuclear pellet was resuspended in 50 μl ice-cold lysis buffer (50 mM HEPES, pH 7.8, 50 mM KCl, 0.3 M NaCl, 0.1 mM EDTA and 1 mM DTT) and the suspension was kept on ice for 20 min with a 30 s vortex every 3–5 min. Centrifugation at 14 000 r.p.m. for 5 min yielded the supernatant containing the protein extract. Electrophoretic mobility shift assay The transcription factor consensus oligonucleotides for the NF-KB-responsive element (5′AGT TGA GGG GAC TTT CCC AGG C3′) was purchased from Promega (Southampton, UK). The probes were labelled with [γ-32P]ATP by using T4 polynucleotide kinase (Promega) for 10 min at 37°C. For the binding reaction, nuclear extract (10 μg protein) was incubated in a 10 μl volume with 2 μl EMSA binding buffer (20% glycerol; 5 mM MgCl2; 250 mM NaCl; 2.5 mM EDTA; 2.5 mM DTT; 50 mM Tris-HCl, pH 7.5 and 0.25 mg ml−1 poly (dI-dC)-poly (dI-dC) and 1 μl γ-32P-labelled probe for 20 min at room temperature following a 10 min preincubation in the absence of the labelled probe. The specificity of the binding reaction was determined by coincubating duplicate samples with unlabelled probes. A negative control reaction was also included which contained everything except sample. Protein–nucleic acid complexes were resolved using an 8% nondenaturing polyacrylamide gel and a native 5% polyacrylamide stacking gel in 25 mM Tris, pH glycine for 30 min at 150 mV. Gels were dried between Whatman 3 M filter paper (Whatman Inc., Clifton, NJ, USA), dried under vacuum at 80°C for 1 h and exposed to ‘Hyperfilm MP’ (Amersham Pharmacia Biotech) for 48 h at −70°C. Statistical analysis Results are presented as mean±s.e.m. Differences were determined by one-way ANOVA, followed by Tukey's test. RESULTS The effect of 15(S)-HETE on total protein degradation in C2C12 myotubes, as measured by [3H]phenylalanine release, is shown in Figure 2A Figure 2 (A) Effect of 15(S)-HETE on total protein degradation in C2C12 myotubes after incubation for 24 h in cells either olive oil-treated (closed boxes) or pretreated for 2 h with 50 μ M EPA (hatched boxes). Results are shown as mean±s.e.m. of one experiment where n=3, and the experiment was repeated three times on different days with similar results. Differences from controls in the absence of 15(S)-HETE are indicated as (a) P<0.05, (b) P<0.01 or (c) P<0.001, while differences in the presence of EPA from those in the absence are indicated as (d) P<0.05, (e) P<0.01 and (f) P<0.001. (B) The effect of 15(S)-HETE on the proteasome ‘chymotrypsin-like’ enzyme activity in C2C12 myotubes either alone (⧫) or after pretreatment with 50 μ M EPA (□). Results are shown as mean±s.e.m. where n=3 and the experiment was repeated three times with similar results. Differences from controls in the absence of 15(S)-HETE are indicated as (a) P<0.05 and (b) P<0.01, while differences in the presence of EPA are indicated as (c) P<0.01 and (d) P<0.001. . The concentrations of 15(S)-HETE chosen were based on those produced by PIF in murine myoblasts (Smith et al, 1999). In this study PIF increased 15-HETE production from 25 to 70 nmol per 5 × 106 cells per 2 h, that is, an increase of 9 nmol per 106 cells. If all the 15-HETE entered the cells in the current experiments, this would give a value between 1.4 and 6 nmol per 106 cells. As previously reported in C2C12 myoblasts, 15(S)-HETE produced a significant increase in [3H]phenylalanine release with a bell-shaped dose–response curve, although the concentrations producing maximal protein catabolism (78–156 nM) were higher than required in myoblasts (Smith et al, 1999). A similar dose–response curve is observed with PIF (Smith et al, 1999), and with protein breakdown in muscle of tumour-bearing animals (DeBlaauw et al, 1997), and may result from downregulation of receptors, or receptor desensitisation as occurs in the stimulation of lipolysis by isoprenaline. The effect was attenuated down to control values in the presence of 50 μ M EPA at all concentrations of 15(S)-HETE (Figure 2A), as well as the highly specific and irreversible proteasome inhibitor, lactacystin (data not shown), suggesting that the action of 15(S)-HETE may be mediated through the ubiquitin–proteasome proteolytic pathway. This concentration of EPA has been previously shown to attenuate PIF-induced protein catabolism in murine myoblasts (Smith et al, 1999). Lower concentrations of EPA had no effect. The plasma concentration of EPA in humans consuming large doses would be in the range 100–200 μ M. To determine if proteasome proteolytic activity was also increased by 15(S)-HETE, the ‘chymotrypsin-like’ enzyme activity, the predominant proteolytic activity of the proteasome, was determined using the fluorogenic substrate Suc LLVY-MCA. The results presented in Figure 2B show that 15(S)-HETE induced upregulation of the ‘chymotrypsin-like’ activity of the proteasome, with maximal effect in the concentration range 78–312 nM, as for total protein catabolism (Figure 2A). As with protein catabolism, proteasome proteolytic activity was attenuated in cells pretreated with 50 μ M EPA. To determine whether the increased proteasome proteolytic activity arose from an increased gene expression mRNA levels of proteasome subunits C2(α) and C5(β), as well as the ubiquitin-conjugating enzyme, E214k, were determined in C2C12 myotubes exposed to various concentrations of 15(S)-HETE for various times to determine the earliest time of gene induction and how long this persisted, using quantitative competitive RT–PCR (Figure 3 Figure 3 Effect of treatment of C2C12 myotubes with 15(S)-HETE for 4 h on expression of mRNA for (A) C2 proteasome subunit, (B) C5 proteasome subunit, (C) E214k, as determined by quantitative competitive RT–PCR. Results represent mean±s.e.m. from three separate determinations performed on different occasions with different samples. Differences are indicated as (a) P<0.05, (b) P<0.01 and (c) P<0.001 from cells treated with 0 nM 15(S)-HETE. ). Expression of the mRNA for the 20S proteasome subunits C2 (Figure 3A) and C5 (Figure 3B) was significantly increased with 15(S)-HETE concentrations in the range 78–312 nM after 4 h, as for protein catabolism with a similar bell-shaped dose–response curve. The level of expression of mRNA for C5 was approximately 2000-fold greater than for C2. Expression of mRNA for E214k was also significantly increased 4 h after treatment with 15(S)-HETE (Figure 3C), although the concentration range was somewhat broader than for proteasome subunits (78–780 nM). The extent of induction of C2, C5 and E214k by 15(S)-HETE at 2 h (Figure 5 Figure 5 Effect of treatment of C2C12 myotubes with 15(S)-HETE for 2 h on expression of mRNA for (A) C2 proteasome subunit, (B) C5 proteasome subunit. Results represent mean±s.e.m. for three separate determinations on different samples. Differences from control are indicated as (a) P<0.05 and (b) P<0.001. ) was less than that observed at 4 h. The increased expression of proteasome subunits in the presence of 15(S)-HETE was attenuated by prior treatment with EPA (Figure 4 Figure 4 Effect of 15(S)-HETE on the expression of mRNA for the C5 proteasome subunit in C2C12 myotubes in the absence (solid boxes) and presence (open boxes) of 50 μ M EPA. Results represent mean±s.e.m. from two separate determinations performed on different occasions with different samples. Where there was no differences between individual measurements no standard error is shown. Differences from control are indicated as (b) P<0.01 and (c) P<0.001 as determined by Student's t-test. ). There was also evidence for an increased expression of mRNA for both C2 (Figure 6A Figure 6 Effect of treatment of C2C12 myotubes with 15(S)-HETE for 24 h on expression of mRNA for (A) C2 proteasome subunit, (B) C5 proteasome subunit, as determined by quantitative competitive RT–PCR. Results represent mean±s.e.m., where n=3 representing three separate determinations on different samples. Differences from control are indicated as (b) P<0.01 and (c) P<0.001. ) and C5 (Figure 6B) proteasome subunits after 24 h. As with studies on PIF (Gomes-Marcondes et al, 2002), higher concentrations of 15(S)-HETE produced increases in proteasome mRNA expression at 24 h than at 4 h (Figure 3). To determine whether increased mRNA expression for proteasome subunits C2 and C5 was reflected in higher protein levels of other subunits, cellular supernatants of C2C12 myotubes treated with 15(S)-HETE for 24 h were immunoblotted for p42, an ATPase subunit of the 19S regulator that promotes ATP-dependent association of the 20S proteasome with the 19S regulator to form the 26S proteasome (Tanahashi et al, 1999) (Figure 7A Figure 7 Western blots of soluble extracts of C2C12 myotubes treated with 0 (lane 1), 156 nm (lane 2), 234 nm (lane 3), 312 nm (lane 4), 480 nm (lane 5), 630 nm (lane 6), 780 nm (lane 7) and 1560 nM 15(S)-HETE, (lane 8) for 24 h on expression of p42 subunit of 19S regulatory subunit (A), myosin (B) and actin control (C). Blots were developed with the respective antibodies as described in Materials and methods, and are representative of three separate determinations on different samples. Average densitometric data are presented under the blots. ). Maximal expression was seen at concentrations of 15(S)-HETE between 156 and 312 nM, which is in the range where an increased proteasome mRNA expression was seen (Figure 3). Activation of proteasome expression was associated with a decrease in myosin expression in the same concentration range (78–312 nM) (Figure 7B). These results suggest that 15(S)-HETE leads to an increased expression of the ubiquitin–proteasome pathway, with an increase in overall protein degradation and depletion of myofibrillar pro teins. The NF-κB transcriptional pathway was investigated as a possible mediator of the increased expression of the ubiquitin–proteasome pathway, since NF-κB has been shown to be an essential mediator of TNF-α-induced protein catabolism in differentiated muscle cells (Li and Reid, 2000). As shown in Figure 8A Figure 8 (A) Activation of NF-κB binding to DNA as demonstrated by EMSA. Nuclear extracts of C2C12 myotubes treated with 0 nm (lane 1), 31 nm (lane 2), 156 nm (lane 3), 234 nm (lane 4) or 312 nM 15(S)-HETE (lane 5) for 30 min were compared with cells treated with 0 nm (lane 6), 31 nm (lane 7), 156 nm (lane 8), 234 nm (lane 9) or 156 nM 15(S)-HETE (lane 10) pretreated with 50 μ M EPA for 2 h. The gel shown is a representative example of three separate determinations and the average densitometric data are presented below the blot. (B) Western blot of I-κBα levels in cytoplasmic extracts of myotubes treated with 0 nm (lane 1), 3.1 nm (lane 2), 15.6 nm (lane 3), 31 nm (lane 4), 156 nm (lane 5) and 312 nM 15(S)-HETE (lane 6) for 30 min or after pretreatment for 2 h with EPA (50 μ M) and treated with 0 nm (lane 7), 3.1 nm (lane 8), 15.6 nm (lane 9), 31 nm (lane 10), 156 nm (lane 11) and 312 nM 15(S)-HETE (lane 12). Detection was by rabbit polyclonal antisera to residues 1–317 of human I-κBα. The blot shown is representative of three separate determinations and the average densitometric data are provided below the blot. (C) The effect of the NF-κB inhibitor peptide SN50 on 15(S)-HETE induced upregulation of the ‘chymotrypsin-like’ activity of the proteasome. Myotubes were treated with the cell-permeable NF-κB inhibitor peptide, SN50 (18 μ M) for 20 min prior to the addition of 15(S)-HETE. The activity shown represents the lactacystin (10 μ M) suppressible proteolytic activity. Differences are indicated as (a) P<0.05 and (b) P<0.01 from those in the absence of 15(S)-HETE and (c) P<0.01 and (d) P<0.001 from those in the absence of SN50. , 15(S)-HETE induced elevated levels of NF-κB DNA binding activity in the myotube nucleus, after a 30 min incubation, with a maximal effect between 156 and 234 nM. Increased nuclear accumulation of NF-κB was not seen after pretreatment with EPA. Depletion of I-κBα from the cytosol was determined by immunoblotting of cytoplasmic extracts from the same cells in which NF-κB translocation was measured. Rapid breakdown of I-κBα was evident 30 min after treatment with 156 nM 15(S)-HETE (Figure 8B), and this was not seen in cultures pretreated with 50 μ M EPA, suggesting a mechanism by which EPA could downregulate the increased proteasome expression seen in the presence of 15(S)-HETE. The NF-κB inhibitor peptide, SN50 (Lin et al, 1995) attenuated the increased chymotrypsin-like enzyme activity in the presence of 15(S)-HETE (Figure 8C), suggesting the NF-κB may be involved in transcriptional activation induced by 15(S)-HETE. DISCUSSION There are three main pathways for the intracellular catabolism of proteins in skeletal muscle; lysosomal proteases, a nonlysosomal calcium-activated process involving the cysteine proteases calpains I and II and the ubiquitin–proteasome proteolytic pathway. Of the three, the latter is considered to be most important (Lecker et al, 1999), since the former two processes contribute less than 15–20% of total protein breakdown and do not catabolise myofibrillar proteins (Lowell et al, 1986). In cancer cachexia, where there is extensive and specific loss of skeletal muscle, tissue levels of mRNA for ubiquitin, 20S proteasome α and β subunits and the ubiquitin-conjugating enzyme, E214k, have been found to be increased in mouse (Lorite et al, 1998), rat (Temparis et al, 1994) and humans (Williams et al, 1999). Knowledge of the mechanism of this increased gene transcription is important for the design of therapeutic agents, because muscle wastage leads to weakness, fatigue and eventually death through impairment of respiratory muscle function (Windsor and Hill, 1998). Previous studies on protein degradation, induced by PIF in vitro, suggested 15(S)-HETE as a possible intracellular signal responsible for the increased transcription of the genes of the ubiquitin–proteasome proteolytic pathway (Smith et al, 1999). This suggestion is supported by recent observations (Whitehouse et al, 2001) showing that EPA, an inhibitor of 15(S)-HETE, produced in response to PIF, attenuated the development of muscle catabolism in the MAC16 murine cachexia model by downregulation of the increased expression of proteasome α-subunits and chymotrypsin-like enzyme activity. In addition, we have recently found (Whitehouse and Tisdale, 2001) that both EPA and a 12/15-lipoxygenase inhibitor, CV-6504, were also effective in attenuating protein degradation in acute starvation mediated through the ubiquitin–proteasome pathway. This suggests that in both models of muscle wasting the same intracellular-mediator is involved, possibly 15(S)-HETE. The aim of the present study has been to determine whether 15(S)-HETE alone is capable of upregulation of the key enzymes of the ubiquitin–proteasome pathway using C2C12 myotubes. Using this in vitro system, 15(S)-HETE has been shown to induce total protein degradation at concentrations between 78 and 312 nM, with a bell-shaped dose–response curve similar to that previously reported in C2C12 myoblasts (Smith et al, 1999), although the concentration to produce a maximal effect was higher in myotubes. Since the effect of PIF on protein catabolism in myotubes has been shown to be mediated through an upregulation of the ubiquitin–proteasome proteolytic pathway (Gomes-Marcondes et al, 2002), if 15(S)-HETE was acting as an intracellular transducer of PIF action then the effect on protein degradation would also be mediated by this pathway. Accordingly 15(S)-HETE was shown to increase the ‘chymotrypsin-like’ enzyme activity of the β subunits of the proteasome, suggested to be the rate-determining step in protein catabolism (Chen and Hochstrasser, 1996; Rock et al, 1994), in the same concentration range as that stimulating total protein degradation. Further confirmation that 15(S)-HETE stimulated expression of the rate-limiting components of the ubiquitin–proteasome pathway was provided by an increased mRNA level for proteasome subunits C2 and C5, as well as E214k, and increased protein levels of proteasome subunit, p42, over the same concentration range as that inducing total protein degradation. Previous studies have reported increased proteasome subunits (Temparis et al, 1994; Lorite et al, 1998) MSS1 (Combaret et al, 1999) and E214k with increased muscle catabolism in cancer cachexia, suggesting that they play important roles in protein degradation. Indeed, cellular levels of the myofibrilar protein, myosin, were reduced in myotubes treated with 15(S)-HETE over the same concentration range as that inducing the regulatory components of the ubiquitin–proteasome proteolytic pathway. We have suggested (Whitehouse et al, 2001) that EPA attenuates protein degradation and the increased expression of the key regulatory components of the ubiquitin–proteasome pathway as a result of the inhibition of 15(S)-HETE production through the PIF-induced activation of phospholipase A2 and arachidonate release (Smith et al, 1999). It was therefore surprising that EPA was able to attenuate protein degradation and the increase in proteasome expression induced by 15(S)-HETE. This suggests that EPA also affects a downstream pathway involved in induction of proteasome expression by 15(S)-HETE, possibly a nuclear transcription factor, since Ross et al (1999) have shown that in the pancreatic cancer cell line, MiaPaCa 2, exposed to EPA for 2 h prior to a pulse of TNF-α, I-κBα was preserved, suggesting an effect of EPA in stabilising the NF-κB complex in the cytoplasm. Watchorn et al (2001) have shown PIF to activate both the transcription factors NF-κB and STAT3 in hepatic cells. Li et al (1998) showed that TNF-α stimulated protein loss in C2C12 myotubes involved the ubiquitin–proteasome proteolytic pathway and was accompanied by nuclear translocation of NF-κB to its targeted DNA sequence by stimulating phosphorylation, ubiquitin conjugation and proteolysis of I-κBα. Total protein content and myosin heavy chain levels in C2C12 myotubes were found to be unaltered in cells transfected with viral plasmid constructs that overexpress mutant I-κBα proteins that are insensitive to degradation by the ubiquitin–proteasome pathway (Li and Reid, 2000). These data suggest that NF-κB is an essential mediator of TNF-α-induced protein catabolism in differentiated muscle cells. However, Du et al (2000) found that NF-κB is a repressor of C3 proteasome subunit transcription in muscle cells and that glucocorticoids stimulate C3 proteasome subunit expression by opposing this suppressor action. This mechanism is surprising, since NF-κB normally acts as a transcriptional activator, and the present study provides some evidence that NF-κB may be involved in the increase in transcription of the regulatory components of the ubiquitin–proteasome pathway induced by 15(S)-HETE. Thus, 15(S)-HETE induced elevated levels of NF-κB binding activity in the nucleus of C2C12 myotubes with a corresponding decrease in cytosolic I-κBα. The effect was not seen in myotubes pretreated with EPA, providing a role for EPA in the attenuation of downstream signalling induced by 15(S)-HETE. The concentrations of 15(S)-HETE affecting the NF-κB/I-κBα system were the same as those increasing protein degradation and stimulating increased expression of the key regulatory components of the ubiquitin–proteasome pathway. Moreover, the NF-κB inhibitor peptide SN50 (Lin et al, 1995) attenuated the increased proteasome chymotryptic activity in the presence of 15(S)-HETE. These results suggests that 15(S)-HETE may induce gene expression through the transcription factor NF-κB. The mechanism by which 15(S)-HETE could activate NF-κB is not known. One possibility is that as 15(S)-HETE is oxidised it could result in the generation of reactive oxygen species, which might regulate the redox sensitive NF-κB, possibly through oxidation of constituent proteins, which could augment DNA-binding activity or promote the release from, or degradation of I-κB. Mild oxidative stress has been shown to induce 20S proteasome subunits and E214k in murine myotubes (Gomes-Marcondes and Tisdale, 2002). However, it is not clear why 5- and 12-HETE would not have the same properties as 15-HETE if this were the mechanism. Further studies are required to determine the role of transcription factors and cellular signalling pathways in the action of 15(S)-HETE.

          Related collections

          Most cited references37

          • Record: found
          • Abstract: found
          • Article: not found

          Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence.

          To control agonist-induced nuclear translocation of transcription factor kappa B (NF-kappa B) in intact cells, cell-permeable synthetic peptides were devised. Their import into intact cells was dependent on a hydrophobic region selected from the signal peptide sequences and was verified by their inaccessibility to extracellular proteases and by confocal laser scanning microscopy. When a cell-permeable peptide carried a functional cargo representing the nuclear localization sequence of NF-kappa B p50, it inhibited in a concentration-dependent manner nuclear translocation of NF-kappa B in cultured endothelial and monocytic cells stimulated with lipopolysaccharide or tumor necrosis factor-alpha. Synthetic peptide analogues with deleted hydrophobic cell membrane-permeable motif or with a mutated nuclear localization sequence were inactive. Cell membrane-permeable peptides were not cytotoxic within the concentration range used in these experiments. These results suggest that cell-permeable synthetic peptides carrying a functional cargo can be applied to control signal transduction-dependent subcellular traffic of transcription factors mediating the cellular responses to different agonists. Moreover, this approach can be used to study other intracellular processes involving proteins with functionally distinct domains.
            Bookmark
            • Record: found
            • Abstract: found
            • Article: not found

            Skeletal muscle myocytes undergo protein loss and reactive oxygen-mediated NF-kappaB activation in response to tumor necrosis factor alpha.

            Skeletal muscle atrophy and weakness are thought to be stimulated by tumor necrosis factor alpha (TNF-alpha) in a variety of chronic diseases. However, little is known about the direct effects of TNF-alpha on differentiated skeletal muscle cells or the signaling mechanisms involved. We have tested the effects of TNF-alpha on the mouse-derived C2C12 muscle cell line and on primary cultures from rat skeletal muscle. TNF-alpha treatment of differentiated myotubes stimulated time- and concentration-dependent reductions in total protein content and loss of adult myosin heavy chain (MHCf) content; these changes were evident at low TNF-alpha concentrations (1-3 ng/ml) that did not alter muscle DNA content and were not associated with a decrease in MHCf synthesis. TNF-alpha activated binding of nuclear factor kappaB (NF-kappaB) to its targeted DNA sequence and stimulated degradation of I-kappaBalpha, an NF-kappaB inhibitory protein. TNF-alpha stimulated total ubiquitin conjugation whereas a 26S proteasome inhibitor (MG132 10-40 microM) blocked TNF-alpha activation of NF-kappaB. Catalase 1 kU/ml inhibited NF-kappaB activation by TNF-alpha; exogenous hydrogen peroxide 200 microM activated NF-kappaB and stimulated I-kappaBalpha degradation. These data demonstrate that TNF-alpha directly induces skeletal muscle protein loss, that NF-kappaB is rapidly activated by TNF-alpha in differentiated skeletal muscle cells, and that TNF-alpha/NF-kappaB signaling in skeletal muscle is regulated by endogenous reactive oxygen species.
              Bookmark
              • Record: found
              • Abstract: found
              • Article: not found

              Characterization of a cancer cachectic factor.

              Cancer cachexia is a syndrome of progressive wasting which has been suggested to be mediated by tumour-necrosis factor-alpha, interleukins 1 and 6, interferon-gamma and leukaemia-inhibitory factor. It has proved difficult to correlate levels of tumour-necrosis factor-alpha and interleukin-6 with cancer cachexia, and the weight loss induced by leukaemia-inhibitory factor may be due to toxicity. In the murine adenocarcinoma MAC16, cachexia is mediated by circulatory catabolic factors, which we have now isolated using an antibody cloned from splenocytes of mice transplanted with the MAC16 tumour, with a delayed cachexia. The material is a proteoglycan of relative molecular mass 24K which produces cachexia in vivo by inducing catabolism of skeletal muscle. The 24K material was also present in urine of cachectic cancer patients, but was absent from normal subjects, patients with weight loss due to trauma, and cancer patients with little or no weight loss. This suggests that cachexia in mice and humans may be produced by the same material.
                Bookmark

                Author and article information

                Journal
                Br J Cancer
                British Journal of Cancer
                Nature Publishing Group
                0007-0920
                1532-1827
                12 August 2003
                18 August 2003
                : 89
                : 4
                : 737-745
                Affiliations
                [1 ] 1Pharmaceutical Sciences Research Institute, Aston University, Birmingham B4 7ET, UK
                Author notes
                [* ]Author for correspondence: M.J.Tisdale@ 123456aston.ac.uk
                Article
                6601184
                10.1038/sj.bjc.6601184
                2376908
                12915888
                fae9c16f-c05f-4160-ab37-cc00d2f35c3c
                Copyright 2003, Cancer Research UK
                History
                : 03 February 2003
                : 17 June 2003
                : 17 June 2003
                Categories
                Experimental Therapeutics

                Oncology & Radiotherapy
                protein catabolism,15(s)-hydroxyeicosatetraenoic acid (15-hete),nuclear factor-κb (nf-κb),protenscore induction

                Comments

                Comment on this article